ID: 1090210856

View in Genome Browser
Species Human (GRCh38)
Location 11:124920407-124920429
Sequence CCTCCGAGGGAGGCTGTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 968
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 921}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090210847_1090210856 28 Left 1090210847 11:124920356-124920378 CCATCTCTTTTATTCATGAACAG 0: 1
1: 0
2: 2
3: 28
4: 306
Right 1090210856 11:124920407-124920429 CCTCCGAGGGAGGCTGTGGGAGG 0: 1
1: 0
2: 4
3: 42
4: 921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090210856 Original CRISPR CCTCCGAGGGAGGCTGTGGG AGG Exonic
900093434 1:930430-930452 CATCTGAGGGAAGGTGTGGGAGG - Intronic
900387790 1:2418495-2418517 CGTCCGAGGGAGGCAGTGGGTGG - Intergenic
901052093 1:6430323-6430345 CCTGCCAGGGAGGCTGTGGGTGG + Intronic
901148435 1:7084341-7084363 GCTCCAGGGGAAGCTGTGGGAGG + Intronic
901158321 1:7155330-7155352 TCTCGGAGGGAGCCTGTGGGAGG + Intronic
901319268 1:8329854-8329876 CCTCGGAGGGAGGATGTGCCCGG + Intronic
901479997 1:9518626-9518648 CCTCTGAGGGAGGCAGGGTGTGG - Intergenic
901517758 1:9760773-9760795 GCTCTGAGGGAGGCTGAGGCAGG - Intronic
901545363 1:9952647-9952669 CCTACTAGGGAGGCTGAGGCAGG - Intronic
901625346 1:10621456-10621478 GCTCCTCGGGAGGCTGTGGCTGG - Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902288256 1:15420451-15420473 GCTACTAGGGAGGCTGTGGTGGG - Intronic
902306075 1:15540396-15540418 GCTACGTGGGAGGCTGTGGTTGG - Intronic
902346042 1:15818428-15818450 GCTACGTGGGAGGCTGAGGGGGG + Intergenic
902451336 1:16498854-16498876 GCTCCGCGGGCGGCCGTGGGAGG - Intergenic
902501534 1:16914428-16914450 GCTCCGCGGGCGGCCGTGGGAGG + Intronic
902590609 1:17471713-17471735 GCTTCTAGGGAGGCTGTGGTGGG - Intergenic
902909478 1:19584706-19584728 ACTACTTGGGAGGCTGTGGGAGG - Intergenic
902948423 1:19861084-19861106 CCTCCCAGGGAGCCAGTGGTGGG - Intergenic
903014246 1:20351538-20351560 CCTACTAGGGAGGCTGAGGCAGG + Intronic
903290439 1:22310484-22310506 GCTACTAGGGAGGCTGAGGGCGG - Intergenic
904037569 1:27567046-27567068 AATCCTAGGGAGGCTGTGGAGGG + Intronic
904259499 1:29280238-29280260 CCTGCGTGGGAGACTGAGGGAGG - Intronic
904434611 1:30486058-30486080 CCCTCCAGGGAGGGTGTGGGAGG + Intergenic
904713613 1:32450046-32450068 CCTACTCGGGAGGCTGAGGGGGG - Intergenic
904756293 1:32770540-32770562 CTCCCCAGGGAGGCAGTGGGAGG + Exonic
905215332 1:36402315-36402337 GCTACGTGGGAGGCTGTGGCTGG + Intergenic
905755110 1:40502578-40502600 GCTACGAGGGAGGCTGAGGTGGG + Intergenic
906099362 1:43248427-43248449 GCTACGAGGGAGGCTGAGGCAGG - Intronic
906332743 1:44901225-44901247 CCTCCTATGGAGGCTGAGGCAGG - Intronic
906341794 1:44987139-44987161 GCTCCTCGGGAGGCTGAGGGAGG - Intergenic
906469511 1:46116404-46116426 CCTACTTGGGAGGCTGAGGGAGG + Intronic
906487635 1:46244028-46244050 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
907010964 1:50962270-50962292 GCTACTAGGGAGGCTGAGGGAGG + Intronic
907086498 1:51680140-51680162 CCTCCTCGGGAGGCTGAGGCTGG + Intronic
907190011 1:52640565-52640587 CCTACCAGGGAGGCTGAGGCAGG + Intronic
907282912 1:53362612-53362634 GCTGTGAGGGAGGCAGTGGGAGG - Intergenic
907345562 1:53776064-53776086 GCTACGAGGGAGGCTGAGGTGGG - Intronic
907361231 1:53917030-53917052 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
907434743 1:54437762-54437784 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
908756580 1:67474286-67474308 GCTCCAAGGGAGGCTGAGGCAGG - Intergenic
909647881 1:77937575-77937597 CCTACTAGGGAGGCTGAGGCAGG + Intronic
909837972 1:80281243-80281265 ACTACGCGGGAGGCTGTGGCAGG + Intergenic
911673364 1:100632089-100632111 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
911827040 1:102499650-102499672 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
912794136 1:112680812-112680834 CCTACGTGGGAGGCTGAGGCAGG - Intronic
913235337 1:116775972-116775994 GCTACTAGGGAGGCTGTGGTAGG + Intergenic
913966373 1:143380842-143380864 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
914060746 1:144206449-144206471 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
914118404 1:144759920-144759942 CCTCCTCGGGAGGCTGAGGCAGG + Intergenic
915577367 1:156788771-156788793 ACTACTAGGGAGGCTGAGGGAGG - Intronic
916156766 1:161857991-161858013 GCTACTAGGGAGGCTGTGGCAGG + Intronic
916659938 1:166914001-166914023 CCTACTTGGGAGGCTGAGGGAGG + Exonic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917353400 1:174101930-174101952 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
918381352 1:183958916-183958938 AATCCGATGGAGGCTGTTGGGGG - Intronic
918573475 1:186026744-186026766 CCTACTAGGGAGGCTGAGGTGGG - Intronic
918603952 1:186399315-186399337 CCTACTAGGGAGGCTGAGGTAGG - Intronic
919635495 1:199999396-199999418 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
919722301 1:200851310-200851332 GCTACTAGGGAGGCTGTGGCAGG - Intronic
919977020 1:202619357-202619379 CCGGAGAGGGAGGCTGGGGGTGG + Intronic
920195152 1:204221852-204221874 CCTCCTAGGGATGAGGTGGGAGG + Exonic
920434882 1:205941278-205941300 GCTCCTAGGGAGGCTGAGGCAGG - Intronic
921263359 1:213403014-213403036 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
922481132 1:225940772-225940794 ACTCTGTGGGAGGCTGTGTGAGG - Intronic
922524539 1:226289830-226289852 CCTCCGGGGGGGGGGGTGGGGGG + Intronic
922532513 1:226355232-226355254 GCTGCTAGGGAGGCTGTGGTCGG - Intergenic
922532806 1:226357299-226357321 GCTACTAGGGAGGCTGTGGCGGG + Intergenic
922558262 1:226549144-226549166 CCGCCGCGGGAGGGCGTGGGGGG + Intronic
922738369 1:228001979-228002001 CCTCTGTGGGAGGCTGTGTGTGG - Intergenic
923597828 1:235374610-235374632 GCTCCTAGGGAGGCTGAGGCAGG - Intronic
923895358 1:238263629-238263651 GCTCCTTGGGAGGCTGAGGGAGG - Intergenic
924144930 1:241064069-241064091 GCTACGAGGGAGGCTGAGGCAGG + Intronic
924324221 1:242879166-242879188 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
924364654 1:243278892-243278914 GCTACTAGGGAGGCTGTGGTAGG - Intronic
924410776 1:243803034-243803056 GCTACTAGGGAGGCTGTGGCAGG + Intronic
924539907 1:244970778-244970800 CCTCCGAGGGAGGGGGAAGGAGG - Exonic
1062817694 10:512800-512822 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1062856424 10:781697-781719 GCTCCTTGGGAGGCTGAGGGAGG - Intergenic
1063207808 10:3851074-3851096 GCTCCTAGGGAGGCTGAGGTGGG + Intergenic
1063515354 10:6689767-6689789 ACACAGAGGAAGGCTGTGGGAGG - Intergenic
1064061003 10:12137150-12137172 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1064187117 10:13171874-13171896 GCTACTAGGGAGGCTGTGGCAGG - Intronic
1064249926 10:13699165-13699187 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1064338764 10:14467982-14468004 CCTCCCAGGGAGACTCTGAGAGG + Intergenic
1064345014 10:14524151-14524173 GCTCCTCGGGAGGCTGAGGGAGG - Intronic
1064374796 10:14785812-14785834 GCTACTTGGGAGGCTGTGGGAGG - Intergenic
1064565219 10:16632831-16632853 CCTCCTAGGGAGGCTGAGATGGG + Intronic
1064761339 10:18624537-18624559 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1065016852 10:21470123-21470145 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1065866770 10:29921244-29921266 CACCCTGGGGAGGCTGTGGGTGG + Intergenic
1066412380 10:35185212-35185234 GCTCCTCGGGAGGCTGAGGGAGG - Intronic
1066456037 10:35573200-35573222 CGTCCCAGGGAGGCTGAGGCGGG - Intergenic
1067313305 10:45136000-45136022 CCTGCAAGGGACGCTGAGGGTGG + Intergenic
1067533650 10:47092602-47092624 CCACTGAGGGAGGCTGTCAGGGG - Intergenic
1068351071 10:55845921-55845943 CCTCCTAGGCAGTGTGTGGGGGG - Intergenic
1068801153 10:61141561-61141583 GCTCCTAGGGAGGCTGAGGTGGG - Intergenic
1069087802 10:64161837-64161859 TCTACTAGGGAGGCTGAGGGAGG - Intergenic
1069374383 10:67779236-67779258 GCTACGAGGGAGGCTGAAGGGGG + Intergenic
1069383949 10:67867308-67867330 CCTACCCGGGAGGCTGTGGCAGG - Intergenic
1069400713 10:68042509-68042531 CCTACTAGGGAGGCTGTGGTGGG + Intronic
1069452514 10:68528528-68528550 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1069561824 10:69436051-69436073 CCTGGGAGGGAGGCTGAGGTGGG - Intergenic
1069681127 10:70286231-70286253 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
1069920814 10:71814545-71814567 CCTACGTGGGAGGCTGAGGCCGG + Intronic
1070152090 10:73811403-73811425 CATCCAAGGGAGTCTGTTGGGGG + Intronic
1070254801 10:74804832-74804854 CCTCCCAGGGAGGCAGAGGTGGG + Intergenic
1070321820 10:75360230-75360252 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1070329760 10:75408774-75408796 CGTCCCAGGGCGGCTGTGCGGGG - Intergenic
1070762336 10:79032086-79032108 CCTACCAGGGAGGCTGAGGTGGG - Intergenic
1071530633 10:86388418-86388440 CCTCTGAGGGAGGCGGGAGGCGG - Intergenic
1071548555 10:86547736-86547758 GCTACTAGGGAGGCTGAGGGTGG + Intergenic
1072119777 10:92396114-92396136 CCTACTTGGGAGGCTGAGGGAGG + Intergenic
1072410056 10:95193675-95193697 CCTCAGCGGGGGGCGGTGGGAGG - Intergenic
1072721317 10:97782625-97782647 CCCTGGAGGGAGGCTGTGGCCGG - Intergenic
1073168408 10:101478825-101478847 CCTCTGTGGGAGGCTGAGGCAGG + Intronic
1073300382 10:102467766-102467788 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1073334164 10:102692818-102692840 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1073408772 10:103322302-103322324 GCTCCTAGGGAGGCTGAGGTGGG - Intronic
1073414436 10:103369088-103369110 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1073457580 10:103646985-103647007 CCTCCAAGGGAGGTGGTTGGAGG - Intronic
1074951538 10:118342066-118342088 CTTTCGAGGAAGGCTGAGGGCGG + Intronic
1075792318 10:125093815-125093837 ACTCCCAGCGAGGCCGTGGGAGG - Intronic
1076438248 10:130460912-130460934 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1076680874 10:132170528-132170550 TCACCGAGGGCAGCTGTGGGGGG - Intronic
1076700906 10:132272124-132272146 CCTCCGAGCGTGGCTGTGTGTGG + Intronic
1076769605 10:132655858-132655880 CCTCCCAGAGAGGCTGCGTGGGG + Intronic
1076993762 11:288877-288899 CGTCCCGGGGCGGCTGTGGGTGG - Intergenic
1077067101 11:646464-646486 CCCCCGTGAGAGGATGTGGGCGG + Intronic
1077204893 11:1337339-1337361 CCTCCGAGGGACCCCGTGCGAGG - Intergenic
1077213407 11:1383766-1383788 GCTACGAGGGAGGCTGGGGCAGG - Intergenic
1077320872 11:1941304-1941326 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1077366634 11:2163843-2163865 CCTCTGAGTGAGGCTGGGGTGGG + Intergenic
1077376610 11:2208209-2208231 CCTCCCTGGGAAGCTGTGGGAGG + Intergenic
1078175366 11:8965547-8965569 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1078849528 11:15151297-15151319 CCATGCAGGGAGGCTGTGGGTGG - Intronic
1079135362 11:17773446-17773468 CCTCGGTGGGAGGCTGTTGCTGG - Intronic
1080056827 11:27915430-27915452 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1080917211 11:36672473-36672495 GCTACCAGGGAGGCTGTGGCAGG - Intergenic
1080952040 11:37045113-37045135 GCTCCTTGGAAGGCTGTGGGGGG - Intergenic
1081873164 11:46392230-46392252 CCCCAGCGGGAGGCTGCGGGTGG + Intergenic
1082091683 11:48095690-48095712 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1082284467 11:50303778-50303800 GCTACTAGGGAGGCTGTGGTGGG - Intergenic
1082687748 11:56260614-56260636 CATGGGAGGGAGGCTGTGGGGGG - Intergenic
1083302440 11:61746044-61746066 CCACCCAGGGAGGCTGCAGGTGG - Exonic
1083506143 11:63159343-63159365 CATGGGAGGGAGCCTGTGGGAGG + Intronic
1083712972 11:64560078-64560100 CCTCCGATGGAGGCTGCTGGGGG - Intronic
1083923549 11:65792969-65792991 CTTCCGAGGGAGGCTGATGTGGG - Intronic
1084046709 11:66573005-66573027 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1084102881 11:66961373-66961395 GCTACTAGGGAGGCTGTGGCAGG + Intergenic
1084125060 11:67093968-67093990 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1084185904 11:67471055-67471077 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
1084617627 11:70246906-70246928 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1084830545 11:71765471-71765493 CCTTCCAGGCAGGCTGTGTGGGG + Intergenic
1084858039 11:72001292-72001314 CCTCCCAGGCCGACTGTGGGAGG + Exonic
1084865639 11:72054354-72054376 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1085205836 11:74731385-74731407 CCGCGGAGGGAGGCTGAGCGCGG + Intronic
1085525424 11:77160923-77160945 CCCCCGGGGGAGGGTGTGGCTGG + Intronic
1086470236 11:87100748-87100770 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1087601945 11:100328242-100328264 CCTACTAGGGAGGCTGAGGTGGG + Intronic
1088356875 11:108953278-108953300 GCTACTAGGGAGGCTGTGGCAGG + Intergenic
1088875062 11:113928646-113928668 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1089654932 11:119940507-119940529 TCACCAAGTGAGGCTGTGGGAGG + Intergenic
1089735524 11:120547971-120547993 ACTCAGAGGGTGGCTGTGGGAGG + Intronic
1090035778 11:123248388-123248410 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
1090210856 11:124920407-124920429 CCTCCGAGGGAGGCTGTGGGAGG + Exonic
1090885662 11:130874132-130874154 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1091395968 12:154413-154435 ACTCAGAGAGAGGCTCTGGGAGG + Intronic
1091731280 12:2882589-2882611 CCTACTGGGGAGGCTGAGGGTGG + Intronic
1091768688 12:3137958-3137980 CCTCCGAGGAAGGTCGTGTGAGG + Intronic
1092182286 12:6453901-6453923 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1092249769 12:6887060-6887082 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1092276601 12:7066080-7066102 CTACCGAGGGAGGCTGAGGCAGG + Intronic
1092281635 12:7101949-7101971 TCTCCGAGGAAGGCTGTGTGCGG + Exonic
1092659506 12:10723048-10723070 CCTCCGTCGGAGCCTGCGGGAGG + Exonic
1092808617 12:12251040-12251062 CCTACGAGGGAGGCTGAGGCAGG - Intronic
1093030976 12:14288260-14288282 CCTACTTGGGAGGCTGAGGGAGG - Intergenic
1093042685 12:14402237-14402259 GCTCCCTGGGAGGCTGTGGTGGG - Intronic
1093142349 12:15523907-15523929 CCTACTAGGGAGGCTGAGGTGGG - Intronic
1093723099 12:22468328-22468350 GCTCCGTGGGAGGCTGAGGTGGG - Intronic
1093916528 12:24808546-24808568 GCTACGAGGGAGGCTGTGGCAGG - Intergenic
1093919443 12:24843489-24843511 GCTGCTAGGGAGGCTGAGGGAGG + Intronic
1094823127 12:34243071-34243093 ACTACTAGGGAGGCTGTGGTTGG - Intergenic
1095091554 12:38112014-38112036 ACTACTAGGGAGGCTGTGGTGGG + Intergenic
1095099283 12:38163693-38163715 CGACGGAGGGAGGCTCTGGGAGG - Intergenic
1095354247 12:41252626-41252648 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1095963945 12:47854231-47854253 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1095989552 12:48025309-48025331 ATGCCGTGGGAGGCTGTGGGTGG + Exonic
1096365260 12:51023877-51023899 GCTACTAGGGAGGCTGTGGCAGG + Intronic
1096703614 12:53404057-53404079 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1096778914 12:53980913-53980935 CCTCGGAGAGAAGCTTTGGGAGG - Intergenic
1096847350 12:54414733-54414755 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1097117459 12:56708255-56708277 GCTACCAGGGAGGCTGTGGCAGG - Intergenic
1097476954 12:60069986-60070008 GCTCCCAGGGAGGCTGAGGCAGG - Intergenic
1097962119 12:65542908-65542930 GCTCCTTGGGAGGCTGTGGCAGG - Intergenic
1098332815 12:69372644-69372666 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1098548747 12:71739939-71739961 ACTCGGAGGGAGGCTGAGGCAGG - Intergenic
1098615702 12:72519934-72519956 CCTCCCAGTGAGGCTGTTTGGGG + Intronic
1099277298 12:80592897-80592919 ACTCCTTGGGAGGCTGAGGGAGG + Intronic
1099355599 12:81631004-81631026 GCTACTTGGGAGGCTGTGGGAGG - Intronic
1100190948 12:92190961-92190983 CCTACTTGGGAGGCTGAGGGAGG + Intergenic
1101386927 12:104266412-104266434 CCTACTAGGGAGGCTGAGGTAGG + Intronic
1101813603 12:108129197-108129219 GCTCCCCGGGAGGCTGCGGGAGG + Intergenic
1101955879 12:109212214-109212236 CCTCCCTGGGAGGCTGTGGTGGG + Intronic
1102160692 12:110766229-110766251 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
1102325144 12:111974544-111974566 CCTACTAGGGAGGCTGAGGTGGG + Intronic
1102356256 12:112238612-112238634 CCTACTTGGGAGGCTGTGGTCGG + Intronic
1102860158 12:116329565-116329587 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1103308802 12:119988896-119988918 GCTCTGAGCGAGGCTGAGGGCGG + Intergenic
1103465622 12:121139844-121139866 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1103497452 12:121374137-121374159 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1103524711 12:121560114-121560136 CCTCCTTGGGAGGCTGAGGTCGG - Intronic
1103531324 12:121604125-121604147 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1103655151 12:122464834-122464856 GCTACTAGGGAGGCTGTGGCAGG + Intergenic
1103775613 12:123364626-123364648 CCCCCGAGGGTGGGAGTGGGAGG + Intronic
1103965673 12:124637901-124637923 CACCCGAGGTAGGCTGTGGCAGG + Intergenic
1104051569 12:125198006-125198028 CCTTGTAGGGAGGCTGTGGAGGG + Intronic
1104419065 12:128620118-128620140 GCTCCTAGGGAGGCTGAGGTGGG + Intronic
1104742480 12:131188630-131188652 CATGGGAGGGAGGCTGAGGGGGG + Intergenic
1104901358 12:132191025-132191047 CCAGCGAGGGAGGAGGTGGGAGG + Intergenic
1107172117 13:37354957-37354979 CCTGCTAGGGAGGCTGAGGCAGG + Intergenic
1107496028 13:40926919-40926941 GCTCCGCGGGAGGCTGAGGCAGG + Intergenic
1107604888 13:42048109-42048131 CCTCGGAGTGGGGCTGGGGGTGG + Intronic
1107689762 13:42941506-42941528 CCTACGTGGGAGGCTGAGGTGGG + Intronic
1107986819 13:45783340-45783362 TTTCCTAGGGAGGCTGTGTGGGG + Exonic
1109070087 13:57754248-57754270 CCTCCTTGGGAGGCTGAGGCAGG - Intergenic
1110170342 13:72492534-72492556 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
1111767312 13:92547939-92547961 GCTCCTCGGGAGGCTGTGGCAGG - Intronic
1111773021 13:92623052-92623074 GCTACTAGGGAGGCTGTGGTGGG + Intronic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1111922319 13:94425244-94425266 CTGCTGAGGGAGGCTGTGTGAGG + Intergenic
1112460378 13:99598777-99598799 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1112925029 13:104663352-104663374 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1112979951 13:105370951-105370973 CCTGCCTGGGAGGCTGAGGGAGG + Intergenic
1113231690 13:108218763-108218785 CCCTCCCGGGAGGCTGTGGGGGG + Intronic
1113419652 13:110160818-110160840 GCTACGAGGGAGGCTGAGGTGGG - Intronic
1113470676 13:110543238-110543260 CCTACGTGGGAGGCTGAGGCAGG - Intronic
1113508225 13:110831635-110831657 CCTCCATGGGGGGCTGTGGGGGG - Intergenic
1113675317 13:112202869-112202891 CCTGCAGTGGAGGCTGTGGGAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113751531 13:112779791-112779813 CCTACTAGGGAGGCTGAGGCGGG + Intronic
1114191971 14:20446546-20446568 GCTCCAAGGGAGGCTGAGGCGGG - Intronic
1114279549 14:21179081-21179103 GCACTGTGGGAGGCTGTGGGCGG - Intergenic
1114468072 14:22938791-22938813 GCTACTAGGGAGGCTGTGGTGGG + Intergenic
1114905747 14:27124090-27124112 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1115216337 14:31017385-31017407 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1115219049 14:31041259-31041281 GCTACTAGGGAGGCTGTGGCAGG - Intronic
1115500542 14:34045803-34045825 CCTACTAGGGAGGCTGAGGTAGG - Intronic
1115587861 14:34833128-34833150 GCTGCTAGGGAGGCTGTGGTGGG + Intronic
1115718309 14:36130305-36130327 CATGGGAGGGAGCCTGTGGGAGG + Intergenic
1115776922 14:36725361-36725383 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1116034684 14:39613319-39613341 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1116306434 14:43262774-43262796 CCTCCCAGTGAGGCTGCTGGGGG - Intergenic
1116905784 14:50402085-50402107 GCTACGCGGGAGGCTGAGGGAGG + Intronic
1117210179 14:53489443-53489465 GCTCCTTGGGAGGCTGAGGGAGG - Intergenic
1118147701 14:63157943-63157965 CCTACGTGGGAGGCTGAGGCAGG + Intergenic
1119651970 14:76390375-76390397 CCTCCTTGGGAGGCTGAGGCAGG + Intronic
1119845252 14:77824543-77824565 TCTACTAGGGAGGCTGAGGGAGG - Intronic
1119845776 14:77828644-77828666 AATCCCAGGGAGGCTGAGGGAGG - Intronic
1120367671 14:83591456-83591478 GCTACTAGGGAGGCTGTGGCAGG - Intergenic
1121029193 14:90643692-90643714 GCTCCTCGGGAGGCTGAGGGAGG - Intronic
1121255624 14:92528238-92528260 CCTAGGAGGGAGGCGGTGGGAGG - Intronic
1121410243 14:93744427-93744449 CCTCCTATGGCGGCTGGGGGAGG + Intronic
1121557191 14:94847300-94847322 CCTACTCGGGAGGCTGAGGGAGG - Intergenic
1121603030 14:95220286-95220308 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1121849051 14:97202710-97202732 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
1122124966 14:99573914-99573936 GCACCTAGGGAGGGTGTGGGAGG - Intronic
1122404659 14:101492947-101492969 CTTCCCAGGGAGGCTGGGGTGGG - Intergenic
1122889847 14:104727220-104727242 CCAAGGCGGGAGGCTGTGGGAGG - Intronic
1123035840 14:105471608-105471630 CCTCCGTGGGAGCCTGTGCTGGG + Intergenic
1123045369 14:105510354-105510376 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1124360725 15:29034993-29035015 CCTCCCCGGGAGCCTGTGGGTGG - Intronic
1125141545 15:36413796-36413818 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1125543190 15:40484188-40484210 GCTACTTGGGAGGCTGTGGGAGG - Intergenic
1125556188 15:40587056-40587078 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1125632611 15:41159684-41159706 CCTCCTAGGGAGGCTAAGGTGGG - Intergenic
1125721410 15:41846854-41846876 CCCACCAGGGAGGCGGTGGGTGG + Intronic
1125964781 15:43865382-43865404 GCTCCTAGGGAGGCTGAGGCCGG - Intronic
1126628641 15:50711319-50711341 GCTACTAGGGAGGCTGAGGGGGG - Intronic
1127155135 15:56115828-56115850 GCTACGTGGGAGGCTGTGGCAGG + Intronic
1127367568 15:58305995-58306017 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1127788763 15:62379713-62379735 CCTCCGAAGGAGGCTGAGGTGGG + Intergenic
1127849482 15:62900635-62900657 CCTCAGTGCCAGGCTGTGGGTGG + Intergenic
1127927065 15:63557180-63557202 CCCCCTTGGGAGGCTGTGGCAGG - Intronic
1127958637 15:63874459-63874481 CCTGCTAGGGAGGCTGAGGCAGG - Intergenic
1128066596 15:64768683-64768705 CCTACTAGGGAGGCTGAGGTGGG + Intronic
1128361950 15:66968499-66968521 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1128679639 15:69638749-69638771 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
1129325982 15:74800535-74800557 CCTGCGTGGGAGGAGGTGGGTGG - Intronic
1129488765 15:75903630-75903652 GCTACGAGGGAGGCTGAGGCGGG + Intergenic
1129929461 15:79398407-79398429 TCTCCAAGGGAGGCTGGGGCAGG - Intronic
1129990741 15:79960128-79960150 GCTACTAGGGAGGCTGTGGCGGG + Intergenic
1130196952 15:81788542-81788564 CCTACGCGGGAGGCTGAGGCAGG + Intergenic
1130543707 15:84839991-84840013 CCTACCAGGGAGCCTGAGGGTGG + Exonic
1131218977 15:90565052-90565074 CCTACTCGGGAGGCTGTGGCAGG - Intronic
1131387808 15:92021836-92021858 CGCCCGAGGGAGGCTGTGGGAGG + Intronic
1132584329 16:699782-699804 CCTTCCAGTGAGGCTGTGGCAGG - Intronic
1132665739 16:1080595-1080617 CCCCCATGGGAGGCTGCGGGCGG + Intergenic
1132748139 16:1445477-1445499 CCTCCGTGGGGGGCTGGGTGCGG - Exonic
1132764237 16:1526319-1526341 ACTTCTGGGGAGGCTGTGGGAGG - Intronic
1132981671 16:2741380-2741402 CCCTCGAGGGAAGCTCTGGGAGG + Intergenic
1133036667 16:3037362-3037384 GCTACGGGGGAGGCTGTGGTGGG - Intergenic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133126248 16:3648054-3648076 TCTACTAGGGAGGCTGAGGGAGG + Intronic
1134209563 16:12264668-12264690 CCTACTTGGGAGGCTGAGGGAGG + Intronic
1134877113 16:17710674-17710696 GCTCCTAGGGAGGCTGAGGTGGG + Intergenic
1135035169 16:19071245-19071267 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
1135078755 16:19416067-19416089 CCTCCTTGGGAGGCTGAGTGAGG + Intronic
1135079389 16:19421326-19421348 CATGAGAGGGACGCTGTGGGAGG + Intronic
1135470608 16:22726494-22726516 GCTCCTAGGGAGGCTGAGGTGGG - Intergenic
1135555760 16:23435253-23435275 GCTCCTTGGGAGGCTGAGGGAGG + Intronic
1135566769 16:23517166-23517188 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1135681905 16:24464640-24464662 CATGGGAGGGACGCTGTGGGAGG + Intergenic
1135777220 16:25267328-25267350 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1136114036 16:28083373-28083395 CCTCCCTGGGAGGCTGAGGTGGG - Intergenic
1136293365 16:29288893-29288915 CGTCCGTAGGAGGCTGTGTGGGG - Intergenic
1136342080 16:29650685-29650707 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1136359928 16:29772431-29772453 CCTACTTGGGAGGCTGTGGCAGG + Intergenic
1136412423 16:30085127-30085149 CCTCAGACGGAGGCTGGGCGTGG + Exonic
1136424761 16:30162289-30162311 CCTCCTGGGGAGACTGTGGCAGG + Intergenic
1136630936 16:31488868-31488890 CCTCCGCCGCAGGCTCTGGGTGG + Exonic
1136636844 16:31529573-31529595 CCTCCGGGGGAGGGTGCGCGGGG + Intergenic
1136848842 16:33597936-33597958 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138812508 16:60167259-60167281 GCTACGAGGGAGGCTGTGGCAGG + Intergenic
1139324189 16:66139325-66139347 GCTACTAGGGAGGCTGAGGGGGG - Intergenic
1139609529 16:68045497-68045519 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1139674422 16:68513292-68513314 GCTACGAGGGAGGCTGAGGCTGG + Intergenic
1139761772 16:69189623-69189645 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
1139897801 16:70301815-70301837 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140359137 16:74330075-74330097 GCTTCGAGGGAGGCTGAGGCAGG - Intergenic
1141580273 16:84993207-84993229 CCTACTAGGGAGGCTGAGGGGGG + Intronic
1141641290 16:85343060-85343082 CCTCCCTGAGAGGCTGAGGGAGG - Intergenic
1141780523 16:86157395-86157417 GCTTCAAGGGAGGCTGTAGGTGG - Intergenic
1142099248 16:88262900-88262922 CATCCGTAGGAGGCTGTGTGGGG - Intergenic
1142181146 16:88671125-88671147 GCTACTTGGGAGGCTGTGGGAGG + Intergenic
1142270954 16:89088962-89088984 CCTCCGGGAAAGGCTGGGGGTGG + Intronic
1142279040 16:89138187-89138209 CCACAGGGAGAGGCTGTGGGAGG - Intronic
1142351743 16:89583818-89583840 GCTCCGAGGGGTGTTGTGGGCGG + Intronic
1142363486 16:89638060-89638082 CCTCCTCGGGAGCCTGTGTGAGG - Exonic
1142379392 16:89722914-89722936 CCTCCGCGGGAGCCTCTGGGTGG + Intronic
1142407060 16:89896129-89896151 CCTGCGAGTGAGGCTGGGGGAGG + Intronic
1203110549 16_KI270728v1_random:1446586-1446608 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
1142555957 17:777528-777550 CGTACTAGGGAGGCTGAGGGAGG + Intronic
1142988015 17:3709061-3709083 CCTCCTTGGGAGGCTGAGGCAGG - Intergenic
1143327378 17:6108345-6108367 CCAGGGAGGGAGGCAGTGGGTGG - Intronic
1143352356 17:6298078-6298100 CCTGGGAGGGAGGCTGGGAGGGG - Intergenic
1143457321 17:7076701-7076723 CCTCCGAGTATGGGTGTGGGGGG - Intronic
1143542770 17:7579534-7579556 CCCCTGAGTCAGGCTGTGGGTGG + Exonic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1143885473 17:10061782-10061804 CCTGAGAGGGAGGCTGGGAGTGG - Intronic
1143988272 17:10934380-10934402 CCCCAGAGGTATGCTGTGGGGGG + Intergenic
1144707583 17:17379888-17379910 CCTCTGAGGTGGGCAGTGGGAGG - Intergenic
1144887117 17:18470884-18470906 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1145083213 17:19913087-19913109 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1145098676 17:20054777-20054799 ACTCCTAGGGAGGCTGAGGTGGG - Intronic
1145145099 17:20473411-20473433 CATCAGAGGGAGGGTGCGGGAGG - Intergenic
1145177196 17:20711323-20711345 CCTCCTTGGGAGGCTGAGGCAGG - Intergenic
1146127119 17:30238467-30238489 GCTCAGAGGGAGGGAGTGGGAGG - Intergenic
1146264242 17:31441134-31441156 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1146353836 17:32117959-32117981 CATCAGAGGGAGGGTGCGGGAGG + Intergenic
1146369271 17:32254958-32254980 CAGCAGAGGGAGGCTGTGCGTGG - Intergenic
1147052244 17:37803999-37804021 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1147749807 17:42723261-42723283 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1147926376 17:43948582-43948604 CCTCCTCGGGAGGCTGAGGCAGG + Intergenic
1147963834 17:44182518-44182540 CCTACAAGGGAGGCTGAGGCAGG + Intergenic
1147971233 17:44219915-44219937 CCGCCCGGGCAGGCTGTGGGAGG - Intronic
1148001110 17:44387711-44387733 GCTACGCGGGAGGCTGTGGCAGG + Intronic
1148443393 17:47723654-47723676 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1148599659 17:48884651-48884673 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
1148875218 17:50683260-50683282 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1149059808 17:52409133-52409155 CCTCCCAGTTAGGCTGTTGGGGG + Intergenic
1149428205 17:56575984-56576006 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1149522965 17:57332210-57332232 GCTCCTAGGGAGGCTGAGGCAGG - Intronic
1149585862 17:57786030-57786052 CCTCCTAGCCAGGCAGTGGGGGG - Intergenic
1149693517 17:58598200-58598222 CCTGCTAGGGAGGCTGAGGCAGG + Intronic
1149708367 17:58716572-58716594 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1149997591 17:61412915-61412937 CCTCCGAAGGGGGCTGTGGCTGG + Exonic
1150051196 17:61964822-61964844 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1150090216 17:62317250-62317272 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1151366748 17:73622585-73622607 ACTCCAAGTGAGGCAGTGGGTGG - Intronic
1151468643 17:74304008-74304030 CCTACGTGGGAGGCTGAGGTGGG + Intronic
1151554658 17:74840647-74840669 CCTGGGAGGAAGGCTGTGGCAGG - Intergenic
1151686822 17:75652427-75652449 CTTACCAGGGAGGCTGTGTGCGG + Intronic
1151699279 17:75734246-75734268 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1151795685 17:76343721-76343743 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1151816902 17:76475691-76475713 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1152163716 17:78686891-78686913 GCTACCAGGGAGGCTGTGGCAGG - Intronic
1152258482 17:79254008-79254030 CCTCTGAGGGCGGGTATGGGAGG + Intronic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152501555 17:80714048-80714070 CCTCCTTGGGAGGCTGAGGCAGG - Intronic
1152530315 17:80914718-80914740 CATGGGAGGGAGGCTGAGGGTGG + Intronic
1152944501 17:83191700-83191722 CCTCAGAGGGAGGCTTGGTGGGG + Intergenic
1203168467 17_GL000205v2_random:122246-122268 CCTGGGAGGGACCCTGTGGGAGG + Intergenic
1153457260 18:5295368-5295390 CCTCCGCCGGCGGCTGTAGGCGG + Intronic
1153660800 18:7324449-7324471 CCTCCTAGGGATGCTGTGTGGGG + Intergenic
1153878351 18:9396944-9396966 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1153893921 18:9542193-9542215 GCTACGCGGGAGGCTGTGGCAGG - Intergenic
1154161171 18:11981627-11981649 CCGCCGAGGGGGGCTGGAGGTGG + Exonic
1154455366 18:14517748-14517770 GCTCCTTGGGAGGCTGAGGGAGG + Intronic
1155039345 18:22052068-22052090 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1155267509 18:24107868-24107890 CCTACTTGGGAGGCTGTGGTGGG - Intronic
1155318857 18:24598258-24598280 CCTCCTTGGGAGGCTGAGGCAGG + Intergenic
1155445811 18:25912118-25912140 CCTACAAGGGAGGCTGAGGCAGG - Intergenic
1155507338 18:26547006-26547028 CCAGCGAGGGCGGCTGGGGGCGG + Intronic
1157086480 18:44585512-44585534 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1157366139 18:47065851-47065873 CCTCCTTGGGAGGCTGAGGTGGG + Intronic
1158460225 18:57639962-57639984 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1159536824 18:69725597-69725619 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
1159673888 18:71256913-71256935 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1159704755 18:71673875-71673897 GCTCCGTGAGAGGCTGTGGCTGG + Intergenic
1160059746 18:75518182-75518204 CCTCAGGGTGAGACTGTGGGTGG + Intergenic
1160434418 18:78834951-78834973 CCTCCGGGGGTGGCTGTGGATGG - Intergenic
1160686391 19:438856-438878 ACAGCGAGGGCGGCTGTGGGTGG + Intronic
1161061046 19:2215102-2215124 GCTCCCAGGGAGGCTGAGGCAGG + Intronic
1161100899 19:2421398-2421420 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1161124104 19:2546342-2546364 CCTGGGAGGGCGGCTGTGTGTGG + Intronic
1161158079 19:2745000-2745022 CATCCCAGGGAGGCCGAGGGGGG + Intergenic
1161255238 19:3305176-3305198 GCTCGGAGGGAGACTGTGAGGGG + Intergenic
1161324900 19:3658905-3658927 CCGACGAAGGAGGCTGTGGGGGG - Intronic
1161337419 19:3721920-3721942 CCTCCAAGGGTGGCAGGGGGAGG + Intronic
1161355416 19:3816704-3816726 CCTCCGCAGCAGGCTGTGCGTGG + Exonic
1161370665 19:3909123-3909145 GCTACTAGGGAGGCTGTGGCAGG + Intronic
1161413180 19:4128567-4128589 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
1161434712 19:4256060-4256082 CCTACTAGGGAGGCTGAGGCGGG + Intronic
1161728203 19:5942914-5942936 GCTCCCAGGGAGGCTGAGGCAGG + Intronic
1161792079 19:6366183-6366205 CCTCACAGGGAGGCTGGAGGTGG - Intronic
1161965408 19:7545136-7545158 GCTTCGAGGGAGGCTGAGGTGGG - Intronic
1162050933 19:8032515-8032537 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1162103882 19:8358123-8358145 GCTCCTCGGGAGGCTGAGGGAGG - Intronic
1162338391 19:10075925-10075947 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1162382827 19:10341728-10341750 GCTCCTAGGGAGGCTGAGGTGGG - Intergenic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162772529 19:12957736-12957758 GCTCCGCGGGAGGCTGAGGCAGG + Intergenic
1162796052 19:13088284-13088306 CCCGGGAGGGAGGCTGTGGTTGG - Intronic
1162863760 19:13528080-13528102 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1162900322 19:13791649-13791671 GCTACGTGGGAGGCTGAGGGAGG - Intergenic
1162918176 19:13885347-13885369 GCTTCGAGGAGGGCTGTGGGAGG + Intronic
1163483356 19:17571954-17571976 GCTCCTCGGGAGGCTGTGGCAGG - Intronic
1163794212 19:19327099-19327121 GCTCCTGGGGAGGCTGTGTGTGG - Intronic
1164243516 19:23410498-23410520 ACTACTAGGGAGGCTGTGGCAGG + Intergenic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164813525 19:31176676-31176698 GCTCCTAGGGAGGCTGAGGTGGG + Intergenic
1164916057 19:32053145-32053167 TTCCCAAGGGAGGCTGTGGGGGG + Intergenic
1164978558 19:32594552-32594574 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
1165042636 19:33080167-33080189 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1165236014 19:34422257-34422279 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1165241666 19:34473650-34473672 GCTACGTGGGAGGCTGAGGGAGG - Intergenic
1165724644 19:38104250-38104272 CCGCTGAAGGAGGCTGTAGGAGG + Intronic
1165862275 19:38915579-38915601 CCCCCGAGGGCTGCTGTGGGTGG + Exonic
1165989447 19:39800747-39800769 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1166077935 19:40424980-40425002 GCTTCGAGGAAGACTGTGGGGGG + Intronic
1166119779 19:40678977-40678999 GCTACTAGGGAGGCTGTGGCAGG + Intronic
1166132740 19:40756155-40756177 GCTCCTTGGGAGGCTGTGGTGGG + Intronic
1166319885 19:42010915-42010937 GCTCCGTGGGAGGCTGAGGTGGG - Intronic
1166696951 19:44857351-44857373 GCTACTAGGGAGGCTGTGGCAGG - Intronic
1166741201 19:45115860-45115882 CCTACTCGGGAGGCTGAGGGAGG + Intronic
1166815578 19:45543119-45543141 GCTACGAGGGAGGCTGAGGTGGG - Intronic
1166859178 19:45799933-45799955 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1166928536 19:46286485-46286507 CCTACGTGGGAGGCTGAGGTGGG + Intergenic
1167203230 19:48081967-48081989 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1167249786 19:48393769-48393791 TGGCCGAGGGAGGCTGCGGGAGG - Intergenic
1167295169 19:48645517-48645539 CCCCCGAGGGAGGGTGGAGGTGG - Intronic
1167490773 19:49791836-49791858 CCTCCCAGGAAGGGTGTGCGAGG - Intronic
1167497117 19:49826227-49826249 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1167768986 19:51502009-51502031 ACTGAGAGGGAGGCAGTGGGCGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1168286918 19:55339888-55339910 GAGCCGAAGGAGGCTGTGGGAGG + Exonic
1168342755 19:55635180-55635202 CCTGCGAAGGAGGCTTGGGGAGG + Intronic
1168674394 19:58266401-58266423 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1202700154 1_KI270712v1_random:158337-158359 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
925169881 2:1744086-1744108 CCTCCGAAGGGGGACGTGGGGGG - Intronic
925375015 2:3378024-3378046 CCGCGGAGGCCGGCTGTGGGTGG + Intergenic
925812615 2:7715400-7715422 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
926272518 2:11377378-11377400 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
926342479 2:11915268-11915290 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
927102828 2:19800998-19801020 CTTCCCAAGTAGGCTGTGGGAGG - Intergenic
927510563 2:23641491-23641513 CCTCTGAGGGAGGCAGGGGAAGG - Intronic
927551226 2:24001847-24001869 GCTACGTGGGAGGCTGAGGGAGG + Exonic
927551287 2:24002291-24002313 GCTACTAGGGAGGCTGAGGGAGG + Exonic
927911323 2:26901948-26901970 CCTCTGAAAGAGGCTGTGGCAGG + Intronic
927948434 2:27151443-27151465 CCTACTCGGGAGGCTGAGGGAGG - Intronic
928096219 2:28406808-28406830 CCTAGCAGGGAGGCTGGGGGAGG - Intronic
928206953 2:29291250-29291272 GCTACTAGGGAGGCTGTGGCAGG + Intronic
928655763 2:33449645-33449667 ACTCCTAGGGAGGCTGAGGCAGG + Intronic
928708265 2:33976013-33976035 GCTCCTCGGGAGGCTGAGGGAGG - Intergenic
929090011 2:38206703-38206725 CCTGGGAGGGACCCTGTGGGAGG + Intergenic
929604742 2:43226783-43226805 CCTCCGGGGGAGGGTGCTGGAGG + Intergenic
929762889 2:44820737-44820759 CCTTCGAGGTAGGGTGTGGTGGG - Intergenic
929986983 2:46744099-46744121 GCTACTAGGGAGGCTGAGGGAGG - Intronic
930066951 2:47334931-47334953 TCTCTGAGGGAGGTTTTGGGAGG + Intergenic
930597878 2:53410321-53410343 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
930734761 2:54765570-54765592 CCTACTAGGGAGGCTGAGGCAGG - Intronic
931778162 2:65557407-65557429 CCTACTAGGGAGGCTGAGGAGGG - Intergenic
932435500 2:71700659-71700681 ACCCCGGGGGAGGCGGTGGGGGG + Intergenic
932492133 2:72128955-72128977 GCTCCGAGTGTGGCTGTGGCTGG - Intergenic
932555991 2:72825570-72825592 GCCCCGAGGGAGGCAGCGGGAGG + Intronic
932620893 2:73264494-73264516 GCCCCGAGGGAGGCAGTGGGCGG - Exonic
933304167 2:80576852-80576874 GCTACTTGGGAGGCTGTGGGAGG + Intronic
934040420 2:88123770-88123792 CCTTCGAGGGAGGCTGGATGAGG - Intronic
934171087 2:89541812-89541834 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
934281393 2:91616130-91616152 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
935207663 2:100910638-100910660 GCTACTTGGGAGGCTGTGGGAGG - Intronic
935227943 2:101070522-101070544 GCTCCTAGGGAGGCTGAGGCAGG - Intronic
935433642 2:103004528-103004550 CCTCCAAGAGAGGCTGCAGGTGG - Intergenic
937119521 2:119431965-119431987 CCGCCGTGGGAGGTTGGGGGTGG + Intronic
937218251 2:120326486-120326508 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
937553210 2:123120798-123120820 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
937598407 2:123697758-123697780 ACTCCTAGGGAGGCTGAGGCAGG + Intergenic
937651222 2:124321329-124321351 CCTACTAGGGAGGCTGAGGTAGG + Intronic
937957343 2:127428750-127428772 CCTGCGAGGGCGACAGTGGGGGG + Exonic
938037856 2:128051261-128051283 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
938067916 2:128291990-128292012 CATCCTAGGGTGGCTGTGTGGGG + Intronic
938090184 2:128426184-128426206 CCTCCCAGGGAGGCTGGGAAGGG - Intergenic
938099063 2:128485913-128485935 CCTCAGAGGGAGGCTCAGAGAGG - Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938309953 2:130283340-130283362 CTTCCTAGGGAGGCGGTGTGGGG + Intergenic
938413417 2:131084299-131084321 GCTCCTAGGGAGGCTGAGGTGGG - Intronic
938444965 2:131369030-131369052 CTTCCTAGGGAGGCGGTGTGGGG - Intergenic
940081973 2:149813184-149813206 GCTACTTGGGAGGCTGTGGGAGG + Intergenic
942468150 2:176230592-176230614 CCTCCTCGGGAGGCTGAGGCAGG - Intergenic
943150076 2:184100393-184100415 CCTACTTGGGAGGCTGTGGCAGG - Intergenic
943721601 2:191208674-191208696 CCTACTAGGGAGGCTGAGGTAGG + Intergenic
944625068 2:201562297-201562319 CCTACTCGGGAGGCTGAGGGAGG - Intronic
945037579 2:205717229-205717251 CCTCTGAGGAAGGGAGTGGGTGG - Intronic
945235056 2:207625554-207625576 CCGCCGAGGGAGGCGCTGTGGGG + Intronic
946083493 2:217148454-217148476 GCTACTGGGGAGGCTGTGGGGGG - Intergenic
946737488 2:222768513-222768535 CCTCCTCGGGAGGCTGAGGCAGG + Intergenic
946967546 2:225053998-225054020 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
948273037 2:236688413-236688435 CCTCCAAGGGAGGGTGGGAGGGG - Intergenic
948819655 2:240534488-240534510 GCTCCTAGGGAGGCTGAGGTGGG + Intronic
949030189 2:241792123-241792145 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1168793314 20:594869-594891 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1168809528 20:695384-695406 CCTCCCAGGGAGCCTGGGAGAGG - Intergenic
1169201602 20:3712859-3712881 CCCCTTAGGGAGGCTGGGGGAGG + Intergenic
1169215267 20:3790038-3790060 GCTCCTAGGGAGGCTGGGGTGGG + Intronic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1169768390 20:9174248-9174270 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1170211976 20:13854937-13854959 GCTCCTTGGGAGGCTGTGGCAGG + Intronic
1170646385 20:18199547-18199569 CCTCCTTGGGAGGCTGAGGCAGG + Intergenic
1170785288 20:19462369-19462391 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1170934616 20:20798819-20798841 GCTACTAGGGAGGCTGAGGGTGG + Intergenic
1171949531 20:31408338-31408360 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1172525074 20:35595845-35595867 GCTATGAGGGAGGCTGGGGGTGG - Intergenic
1172630904 20:36377663-36377685 CCTCCCAGGGAGGTTGAAGGGGG - Intronic
1173234533 20:41232699-41232721 CCCCCGCGGGAGGCTGAGGCAGG - Intronic
1173575933 20:44113040-44113062 CCTCCCAGGGAAGCTGGGTGGGG - Exonic
1173576699 20:44116596-44116618 CCTCAAAGGGAGGCTCTGAGAGG + Intronic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1173959310 20:47058726-47058748 GCTACTTGGGAGGCTGTGGGAGG + Intronic
1174221103 20:48956304-48956326 TATCCTAGGAAGGCTGTGGGGGG - Intronic
1174271555 20:49373217-49373239 GCTCCCAGGGAGGCTTTTGGGGG + Exonic
1174352998 20:49981719-49981741 CCTCCCAGGGAAGCTGGGGTGGG + Intergenic
1174363392 20:50042153-50042175 GCTACGAGGGAGGCTGAGGCCGG + Intergenic
1174367771 20:50066867-50066889 ACTCCCAGGGAGGGTGTGGATGG - Intergenic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174542157 20:51297993-51298015 CCTACTTGGGAGGCTGTGGCAGG + Intergenic
1175158316 20:56989191-56989213 CCTACTAGGGAGGCTGAGGCTGG + Intergenic
1175222722 20:57426625-57426647 CCTCCTGGGGGTGCTGTGGGAGG - Intergenic
1175631199 20:60537695-60537717 CCTCCTCGGGAGGCTGAGGCAGG + Intergenic
1175814077 20:61874527-61874549 CCCCAGAGGGAGGCCCTGGGCGG + Intronic
1175902015 20:62363704-62363726 CCCCCAAGGGAGGCTGGGCGGGG - Intronic
1175931381 20:62495473-62495495 CGTCCTCAGGAGGCTGTGGGCGG + Intergenic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1176293677 21:5059394-5059416 CCACCAAGGAAGGGTGTGGGGGG + Intergenic
1176333078 21:5568434-5568456 CCTGGGAGGGACCCTGTGGGAGG - Intergenic
1176372164 21:6068785-6068807 ACTCCGAGGGAGGGGGTTGGGGG - Intergenic
1176394679 21:6252518-6252540 CCTGGGAGGGACCCTGTGGGAGG + Intergenic
1176442478 21:6736586-6736608 CCTGGGAGGGACCCTGTGGGAGG - Intergenic
1176466740 21:7063656-7063678 CCTGGGAGGGACCCTGTGGGAGG - Intronic
1176490301 21:7445434-7445456 CCTGGGAGGGACCCTGTGGGAGG - Intergenic
1176510341 21:7692949-7692971 CCTGGGAGGGACCCTGTGGGAGG + Intergenic
1176818803 21:13635568-13635590 GCTCCTTGGGAGGCTGAGGGAGG - Intronic
1176873766 21:14105528-14105550 ACTACTAGGGAGGCTGTGGTGGG - Intergenic
1177185870 21:17795586-17795608 GCTCCTAGGGAGGCTGAGGTGGG - Intronic
1178017333 21:28364530-28364552 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1178517847 21:33263964-33263986 CTTGCGAGGGAGGCTGAGGCAGG - Exonic
1178533650 21:33395126-33395148 GCTACTCGGGAGGCTGTGGGAGG - Intergenic
1178722044 21:35018788-35018810 CCACTGAGGGGGACTGTGGGAGG - Intronic
1178813968 21:35910400-35910422 CTTGGGAGGGAGCCTGTGGGAGG + Intronic
1179203396 21:39248524-39248546 GCTACTAGGGAGGCTGAGGGGGG + Intronic
1179400183 21:41076188-41076210 GCTCCGTGTGAGGCTGTGGCTGG - Intergenic
1179484889 21:41703941-41703963 CCTACGAGGGAGGGAGTGGGGGG + Intergenic
1179677776 21:42996101-42996123 GCTCCGTGGGAGGCTGAGGCAGG + Intronic
1179751355 21:43469754-43469776 ACTCCGAGGGAGGGGGTTGGGGG + Intergenic
1179863583 21:44204254-44204276 CCACCAAGGAAGGGTGTGGGGGG - Intergenic
1180080297 21:45483585-45483607 CCTCCGGGGGCGTCTGTGGTGGG - Intronic
1180167294 21:46036723-46036745 CCTCGGGGAGAGGCAGTGGGAGG + Intergenic
1180228391 21:46411965-46411987 CATCCATGCGAGGCTGTGGGTGG - Exonic
1181128769 22:20717297-20717319 CTTCCCATGGAGGCGGTGGGGGG + Intronic
1181504529 22:23343222-23343244 CCTACTCGGGAGGCTGAGGGAGG + Intergenic
1181655647 22:24295834-24295856 CCTACTCGGGAGGCTGAGGGAGG + Intronic
1181709528 22:24673453-24673475 CCTACTCGGGAGGCTGAGGGAGG + Intergenic
1182316323 22:29449665-29449687 CCACCGAGTGGGTCTGTGGGGGG + Intergenic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1182883222 22:33751877-33751899 CCTACTAGGGAGGCTGAGGTAGG - Intronic
1183418360 22:37695842-37695864 CCTCTGAAGGTGGCTGGGGGAGG - Intronic
1183652449 22:39165639-39165661 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1183797347 22:40130669-40130691 CCCCCGCGGGAGGCTGAGGCAGG + Intronic
1183838255 22:40475423-40475445 GCTACCAGGGAGGCTGTGGCAGG + Intronic
1184072815 22:42156509-42156531 CCTCCTTAGGGGGCTGTGGGAGG - Intergenic
1184470580 22:44693348-44693370 GCTACCAGGGAGGCTGTGGGAGG + Intronic
1184515192 22:44957423-44957445 CCCCAGAGGAAGGCTGTGAGGGG - Intronic
1184789774 22:46692791-46692813 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1184947077 22:47811158-47811180 CCTTGGAGGGAGGCTGGAGGAGG - Intergenic
949100957 3:144877-144899 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
949136034 3:566586-566608 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
949301748 3:2591987-2592009 CATACTAGGGAGGCTGAGGGAGG - Intronic
950050029 3:9981091-9981113 GCTACTCGGGAGGCTGTGGGAGG + Intronic
950298717 3:11855352-11855374 CCTACGGGGGAGGCTGAGGCAGG - Intergenic
950507141 3:13402085-13402107 GCTACATGGGAGGCTGTGGGAGG + Intronic
950710634 3:14810766-14810788 CCGCGGAGGGAGGCGGTGTGCGG + Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951783898 3:26396830-26396852 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
952367622 3:32688801-32688823 GCTCCTAGGGAGGCTGAGGTGGG + Intronic
953166427 3:40469204-40469226 GCTACTGGGGAGGCTGTGGGGGG - Intergenic
953508507 3:43510317-43510339 CCTACTGGGGAGGCTGAGGGAGG + Intronic
953723503 3:45377275-45377297 CCTACTTGGGAGGCTGTGGCAGG - Intergenic
954024698 3:47773739-47773761 GCTGCTAGGGAGGCTGAGGGAGG - Intronic
954064197 3:48092806-48092828 GCTACGTGGGAGGCTGTGGTGGG + Intergenic
954105826 3:48409464-48409486 CCTCAGAGGCAAGCTGCGGGTGG + Exonic
954180380 3:48876982-48877004 CCTACTAGGGAGGCTGAGGCAGG + Intronic
954624652 3:52015956-52015978 CATGCGATGGAGGCTGGGGGTGG + Intergenic
955257877 3:57352975-57352997 GCTACGAGGGAGGCTGAGGCAGG + Intronic
955294907 3:57726254-57726276 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
955327553 3:58020960-58020982 CCTCCTAGGGAGGCCGGGGCAGG + Intronic
955456272 3:59125546-59125568 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
955692123 3:61601142-61601164 CCTCCTTGGGAGGCTGAGGTGGG + Intronic
955810858 3:62787181-62787203 CCTACGTGGGAGGCTGAGGCAGG + Intronic
956690081 3:71869076-71869098 CCTGGGAGGGACCCTGTGGGAGG + Intergenic
956707440 3:72011509-72011531 CCACCCAGGGAGTCTGTGGCTGG - Intergenic
956747529 3:72321416-72321438 CCTCCCATGGAGGCTGGGGTAGG + Intergenic
956810365 3:72858417-72858439 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
957417998 3:79930249-79930271 GCTCTGAGTGAGGCTGTGGCTGG - Intergenic
957422014 3:79982564-79982586 CCTACTTGGGAGGCTGAGGGAGG - Intergenic
957614603 3:82510233-82510255 GCTCCGTAGGAGGCTGTGGCTGG - Intergenic
958028487 3:88077442-88077464 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
958140361 3:89554906-89554928 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
958659466 3:97047386-97047408 CCTACTAGGGAGGCTGAGGCAGG + Intronic
958771995 3:98436111-98436133 CCTTCTAGGGAGGCTGAGGCAGG + Intergenic
959069414 3:101688469-101688491 GCTCCTCGGGAGGCTGCGGGAGG + Intergenic
959494626 3:107035870-107035892 GCTACTTGGGAGGCTGTGGGAGG + Intergenic
960889927 3:122436887-122436909 GCTACGCGGGAGGCTGAGGGAGG - Intronic
961022350 3:123518883-123518905 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
961135429 3:124505519-124505541 GCTCCTAGGGAGGCTGAGGTGGG + Intronic
961244806 3:125441727-125441749 GCTCCTAGGGAGGCTGAGGTGGG + Intergenic
961327509 3:126118086-126118108 CCGACCAGGGAGCCTGTGGGCGG + Exonic
961557785 3:127708407-127708429 GCTCGGATGGGGGCTGTGGGTGG + Intronic
961889604 3:130119740-130119762 CCTTCCAGGCAGGCTGTGTGGGG - Intergenic
962032483 3:131615974-131615996 CCTCAGAAGGGGGCTGTGGCGGG - Intronic
962198924 3:133385519-133385541 CCTCCTTTGGAGGCTGAGGGAGG - Intronic
963207259 3:142649524-142649546 GCTACTAGGGAGGCTGTGGCAGG + Intronic
963247406 3:143075541-143075563 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
964407934 3:156369064-156369086 TCTTCTAGGGAGGCAGTGGGTGG - Intronic
964479933 3:157130279-157130301 GCCCCGAGGGAGGCTGGGGTAGG + Intergenic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
966006914 3:175025919-175025941 CCTACTAGGGAGGCTGAGGTGGG - Intronic
967513031 3:190335153-190335175 GCTACTAGGGAGGCTGTGGCAGG - Intronic
967861511 3:194155579-194155601 CCTACGTGGGAGGCTGAGGCAGG - Intergenic
968038884 3:195571889-195571911 GCTCCTGGGGAGGCTGAGGGAGG - Intronic
968090525 3:195895841-195895863 CCGCCGGGGCAGGCTGGGGGCGG - Intronic
968205740 3:196798453-196798475 CCTACTAGGGAGGCTGAGGCAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969617098 4:8260067-8260089 CCTCCCCCGGAGGCTTTGGGGGG - Intergenic
969933294 4:10654987-10655009 CCTACTAGGGAGGCTGAGGCAGG + Intronic
970441454 4:16083801-16083823 CCTCCGCGGCCGGCAGTGGGAGG - Intronic
971577482 4:28294517-28294539 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
971913747 4:32831668-32831690 GCTACTAGGGAGGCTGTGGTGGG + Intergenic
972489259 4:39571466-39571488 CCTACTAGGGAGGCTGAGGTGGG + Intronic
972624422 4:40782454-40782476 GCTACGAGGGAGGCTGAGGCTGG + Intronic
973220817 4:47723882-47723904 CCTACTAGGGAGGCTGAGGCAGG + Intronic
973226334 4:47789190-47789212 GCTACTAGGGAGGCTGTGGCAGG + Intronic
973861444 4:55069092-55069114 CTTCCCAAGGATGCTGTGGGAGG + Intergenic
974259732 4:59510505-59510527 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
974330317 4:60469395-60469417 CCTGGGAGGGACCCTGTGGGAGG + Intergenic
974420247 4:61663399-61663421 GCTCCCAGCGAGGCTGTGGCTGG - Intronic
974762947 4:66302167-66302189 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
975603910 4:76133415-76133437 GCTACGAGGGAGGCTGAGGCAGG - Intronic
976057326 4:81083360-81083382 GCTACGAGGGAGGCTGAGGTGGG + Intergenic
976127226 4:81846732-81846754 ACTCGGAGGGAGGCTGAGGTGGG + Intronic
977112450 4:92975043-92975065 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
977931876 4:102758652-102758674 GCTACGAGGGAGGCTGAGGTGGG - Intronic
978103677 4:104875041-104875063 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
978913236 4:114091388-114091410 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
980326115 4:131348944-131348966 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
980809670 4:137859607-137859629 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
981478281 4:145210019-145210041 CCTACGTGGGAGGCTGAGGCAGG + Intergenic
982135421 4:152270368-152270390 CCTCCCAGGGTTGCTGTGTGAGG - Intergenic
982203178 4:152977552-152977574 GCTCTGAGGGAGGCTGAGGTGGG - Exonic
982677923 4:158397519-158397541 GCTACGTGGGAGGCTGTGGTAGG - Intronic
982701914 4:158666167-158666189 CCAGCGAGGGAGGCTGAGGCAGG + Intergenic
983000473 4:162408541-162408563 CCTCCCTGAGAGGCTGTGGCTGG + Intergenic
983356552 4:166667242-166667264 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
984811878 4:183802484-183802506 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
984827323 4:183938035-183938057 GCTCCTTGGGAGGCTGTGGTGGG + Intronic
984992894 4:185398067-185398089 CCTACTAGGGAGGCTGAGGCAGG - Intronic
985245789 4:187978589-187978611 CACCTGAGGGAGGCTGTGAGTGG - Intergenic
985666106 5:1182258-1182280 CCTCTTAGGGAGGCTGAGGCAGG - Intergenic
985696880 5:1345653-1345675 CCTCGGAGGGCGGCCGGGGGAGG + Intergenic
985935221 5:3092424-3092446 CCTGCTGGGGAGGCCGTGGGTGG - Intergenic
986015390 5:3752970-3752992 CCTCAGAGGGAGGGTCAGGGTGG - Intergenic
986304105 5:6502821-6502843 CATCAGAGTGTGGCTGTGGGGGG - Intergenic
986708675 5:10471729-10471751 CCTCCCTGGGGGGATGTGGGGGG - Intronic
986727397 5:10609438-10609460 GCTACTAGGGAGGCTGAGGGGGG + Intronic
988069983 5:26275463-26275485 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
988521686 5:31951177-31951199 GCTACCAGGGAGGCTGTGGGTGG - Intronic
988580892 5:32467955-32467977 TCTCTGAGGGAGCATGTGGGGGG - Intergenic
989004372 5:36793653-36793675 CCTACTCGGGAGGCTGAGGGAGG + Intergenic
989716395 5:44468243-44468265 GTTCTGGGGGAGGCTGTGGGTGG + Intergenic
990467418 5:56083301-56083323 GCTACCAGGGAGGCTGAGGGAGG - Intergenic
990545210 5:56815522-56815544 CCTGCGAGGGAGGGAGGGGGCGG - Intergenic
990739681 5:58899711-58899733 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
991930225 5:71747058-71747080 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
992041720 5:72841230-72841252 CCTACTAGGGAGGCTGAGGCAGG - Intronic
992250532 5:74871500-74871522 GCTCCTTGGGAGGCTGAGGGAGG + Intergenic
992475863 5:77101079-77101101 CCTGCTAGGGAGGCTGAGGCAGG - Intergenic
993703390 5:91143867-91143889 CATGGGAGGGAGGCTGAGGGGGG - Intronic
993713280 5:91249304-91249326 GCTACGAGGGAGGCTGAGGTGGG - Intergenic
995506705 5:112868510-112868532 GCTCCTAGGGAGGCTGAGGCAGG - Exonic
995658991 5:114460352-114460374 CCTACTTGGGAGGCTGAGGGAGG - Intronic
995807612 5:116070922-116070944 CCTCAAAGGGAGGCTTTGGGTGG + Intergenic
996092980 5:119369163-119369185 CCTACTTGGGAGGCTGAGGGAGG - Intronic
996368134 5:122724704-122724726 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
996846228 5:127902158-127902180 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
998039515 5:138943642-138943664 CCGCCTGGGGAGGCTGTGGAAGG - Intergenic
998155631 5:139785333-139785355 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
998336140 5:141374137-141374159 GCTCCTGGGGACGCTGTGGGGGG + Exonic
999323411 5:150628321-150628343 CCTCCCAGGGTTGCTGCGGGTGG + Intronic
999854131 5:155575014-155575036 CCTACGTGGGAGGCTGAGGCAGG + Intergenic
1000238190 5:159383200-159383222 GCTACTAGGGAGGCTGTGGCAGG + Intergenic
1000238201 5:159383237-159383259 GCTACTAGGGAGGCTGTGGCAGG + Intergenic
1000901912 5:166921521-166921543 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
1001115830 5:168938740-168938762 CCTACTAGGGAGGCTGAGGCGGG - Intronic
1001510444 5:172317047-172317069 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1001568239 5:172714143-172714165 CCTCCGGGGGAGGCAGGGGAGGG - Intergenic
1001701495 5:173709949-173709971 CCACCCAGGGAGGCTGAGCGGGG - Intergenic
1002012238 5:176292654-176292676 GCTACGCGGGAGGCTGTGGCAGG - Intronic
1002215585 5:177629963-177629985 GCTACGCGGGAGGCTGTGGCAGG + Intergenic
1002325461 5:178402242-178402264 GCTCCTAGGGAGGCTGAGGTGGG + Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002358157 5:178647864-178647886 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1002713630 5:181210742-181210764 GCTACGAGGGAGGCTGAGGCAGG - Intergenic
1003526460 6:6902103-6902125 ACTCCGAAGGAGGCTGAGGCAGG - Intergenic
1003892833 6:10578556-10578578 CCTACGCGGGAGGCTGAGGCAGG - Intronic
1004182589 6:13393888-13393910 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
1004403164 6:15307332-15307354 GCTCCTAGGGAGGCTGAGGCAGG - Intronic
1005144725 6:22675484-22675506 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1005301221 6:24472885-24472907 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1005325111 6:24692527-24692549 GCTCCGAGGGAAGCTGGGGTGGG - Intronic
1005357186 6:24995912-24995934 GCTCCTAGGGAGGCTGAGGCAGG - Intronic
1005511947 6:26519239-26519261 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
1005635896 6:27752836-27752858 CCTACTCGGGAGGCTGAGGGAGG + Intergenic
1006095505 6:31653791-31653813 CCTACTAGGGAGGCTGAGGTGGG - Intronic
1006461891 6:34164187-34164209 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
1006549730 6:34811916-34811938 GCTCCTTGGGAGGCTGAGGGAGG + Intronic
1007049321 6:38810478-38810500 GCTGCTAGGGAGGCTGTGGCAGG + Intronic
1007353706 6:41294603-41294625 CCACAGAGGGAGGGTGTGGTGGG - Intergenic
1007724550 6:43907178-43907200 GCTCTGAGGGAGGCTGTGGGAGG - Intergenic
1007768222 6:44173692-44173714 GCTCCTTGGGAGGCTGAGGGAGG - Intronic
1007775540 6:44222662-44222684 CCTCCAAGGGAGGGGGAGGGAGG - Intronic
1008856624 6:56095956-56095978 CCTACTCGGGAGGCTGTGGCAGG - Intronic
1009838905 6:69041714-69041736 CCTACTAGGGAGGCTGAGGCGGG - Intronic
1011098574 6:83695163-83695185 CCTACTAGGGAGGCTGAGAGAGG + Intronic
1011463186 6:87627405-87627427 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1011464853 6:87644587-87644609 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1011475282 6:87745376-87745398 CCTACCAGGGAGGCTGAGGTGGG - Intergenic
1011527156 6:88277449-88277471 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
1012216991 6:96599305-96599327 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1012515791 6:100057564-100057586 ACTCCGAGAGAGGATGAGGGAGG + Intergenic
1013102887 6:107001723-107001745 GCTACTTGGGAGGCTGTGGGAGG + Intergenic
1013121066 6:107141190-107141212 GCTACTAGGGAGGCTGTGGCAGG + Intergenic
1013264242 6:108479101-108479123 CCTACCAGGGAGGCTGAGGTGGG - Intronic
1013270482 6:108541038-108541060 GCTCCTCGGGAGGCTGAGGGAGG + Intergenic
1013538878 6:111087943-111087965 CCCCCGAGGGCGGCTGGGGCTGG + Exonic
1013627887 6:111955593-111955615 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1013791198 6:113838761-113838783 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1014133650 6:117863535-117863557 GCTCCTAGGGAGGCTGAGGCTGG + Intergenic
1014435779 6:121419199-121419221 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1014652053 6:124051961-124051983 CCTCCCAGGCAGTCTGTAGGAGG - Intronic
1015032243 6:128609024-128609046 ACTCCTAGGGAGGCTGAGGTGGG - Intergenic
1015718686 6:136217993-136218015 CCTCCAAGGGAGGCCATGGCAGG + Intergenic
1015790585 6:136960465-136960487 CCTTCTAGGGAGGCTGAGGTGGG - Intergenic
1016575773 6:145568429-145568451 GCTACCAGGGAGGCTGAGGGAGG - Intronic
1016656459 6:146523581-146523603 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1017010081 6:150057688-150057710 CCCCCGCGCCAGGCTGTGGGAGG - Intergenic
1017802589 6:157910999-157911021 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
1018022270 6:159772677-159772699 GCTACTAGGGAGGCTGTGGTGGG + Intronic
1018193561 6:161333627-161333649 GCTACGTGGGAGGCTGAGGGAGG + Intergenic
1018255399 6:161913060-161913082 CCTCCCAGGGAGGCTGAGGCAGG + Intronic
1019083397 6:169452275-169452297 CCTGCGCCAGAGGCTGTGGGAGG - Intergenic
1019306811 7:339504-339526 CCTACTTGGGAGGCTGAGGGCGG - Intergenic
1019386790 7:761632-761654 CCTGGGAGGGACCCTGTGGGAGG - Intronic
1019470178 7:1215461-1215483 GCTCCTAGGGAGGCTGAGGTGGG + Intergenic
1019598458 7:1869282-1869304 CCTCTGGGAGAGGCTGTGGGAGG - Intronic
1019750761 7:2727799-2727821 GCACTGTGGGAGGCTGTGGGAGG + Intronic
1019768651 7:2869866-2869888 GCTACGTGGGAGGCTGTGGCAGG + Intergenic
1019785123 7:2971866-2971888 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1020115141 7:5471974-5471996 CCTCCTCGGGAGGCTGGGGCAGG + Intronic
1020194322 7:6025744-6025766 CCTCCTTGGGAGGCTGAGGCAGG - Intronic
1020639653 7:10739397-10739419 CCTACGTGGGAGGCTGAGGCAGG + Intergenic
1021293642 7:18876812-18876834 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1021677776 7:23098121-23098143 GCTCCGTGCGAGGCTGTGGCTGG - Intergenic
1021728343 7:23571739-23571761 CCTGCTAGGGAGGCTGAGGTGGG + Intergenic
1021842043 7:24728698-24728720 CCTGCGGGGGAGACAGTGGGCGG - Intronic
1022090014 7:27102033-27102055 GCCCCGAGAGTGGCTGTGGGGGG - Intronic
1022257232 7:28671141-28671163 CCTACGTGGGAGGCTGAGGTGGG + Intronic
1023010223 7:35919285-35919307 GCTCCCAGGGAGGCTGAGGTGGG - Intergenic
1023390722 7:39709168-39709190 GCTACCAGGGAGGCTGAGGGAGG + Intergenic
1023506455 7:40904040-40904062 CCTGCCAGAGAGGCTGAGGGTGG - Intergenic
1023836922 7:44073886-44073908 CCTCCAGGGGCTGCTGTGGGGGG - Exonic
1023985476 7:45091978-45092000 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1024080599 7:45852293-45852315 GCTCCCAGGGAGGCTGAGGTGGG + Intergenic
1024233446 7:47380134-47380156 GCTCCGAGTGGGGCTGTGGCAGG + Intronic
1024537477 7:50450158-50450180 ACTTCGCGGGAGGCCGTGGGAGG - Intronic
1025114864 7:56248850-56248872 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1025123857 7:56329384-56329406 GCTCCCAGGGAGGCTGAGGTGGG - Intergenic
1025187874 7:56875127-56875149 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1025188149 7:56876801-56876823 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1025188363 7:56878127-56878149 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1025683567 7:63698793-63698815 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
1025683774 7:63700119-63700141 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
1025684047 7:63701797-63701819 CCTACTAGGGAGGCTGAGGTGGG - Intergenic
1025994182 7:66517960-66517982 CCTACTCGGGAGGCTGAGGGAGG - Intergenic
1026020923 7:66705323-66705345 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1026044178 7:66894413-66894435 GCTCCTAGGGAGGCTGAGGTGGG + Intergenic
1026090709 7:67298401-67298423 GCTCCTCGGGAGGCTGAGGGAGG - Intergenic
1026218988 7:68375097-68375119 ACTCCTAGGGAGGCTGAGGTGGG + Intergenic
1026335002 7:69386653-69386675 CCTCCTTGGGAGGCTGAGGCGGG - Intergenic
1026467606 7:70668089-70668111 CCTACGTGGGAGGCTGAGGCAGG - Intronic
1026545712 7:71320346-71320368 CCTACTTGGGAGGCTGAGGGAGG - Intronic
1026641048 7:72125912-72125934 CCTACTTGGGAGGCTGAGGGAGG - Intronic
1026719348 7:72817294-72817316 CCTACCTGGGAGGCTGAGGGAGG + Intronic
1027050135 7:75016587-75016609 CCTCTCAGGGAGGCTCTGGGTGG - Intronic
1027120305 7:75513764-75513786 GCTCCTCGGGAGGCTGAGGGAGG - Intergenic
1027195267 7:76025676-76025698 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1027262357 7:76474031-76474053 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1027313739 7:76972130-76972152 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1027546450 7:79532797-79532819 GCTACGTGGGAGGCTGTGGCAGG - Intergenic
1029116446 7:98239995-98240017 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1029183442 7:98721153-98721175 GCTACTAGGGAGGCTGAGGGTGG + Intergenic
1029382898 7:100225081-100225103 CCTCCCAGGAAGGCTCTGGGTGG + Intronic
1029488009 7:100854796-100854818 CCTGCTAGGGAGGGTGTGGAAGG + Intronic
1029677684 7:102081742-102081764 AATCCCAGGGAGGCTGAGGGAGG - Intronic
1029774280 7:102675299-102675321 GCACCTAGGGAGGCTGAGGGAGG + Intergenic
1030034668 7:105398493-105398515 GCTCCTAGGGAGGCTGAGGCAGG - Intronic
1030099117 7:105929510-105929532 GCTACGAGGGAGGCTGAGGAGGG + Intronic
1030335153 7:108317795-108317817 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
1032218623 7:129977206-129977228 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1032307196 7:130746182-130746204 CCTGCTAGGGAGGCTGAGGCAGG + Intergenic
1032912735 7:136452290-136452312 CCTACTTGGGAGGCTGAGGGAGG - Intergenic
1033087719 7:138357673-138357695 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1034418346 7:150976766-150976788 GCCCAGGGGGAGGCTGTGGGCGG - Intronic
1034885367 7:154794578-154794600 CCGCTGGGGGAGGCTGTCGGCGG - Intronic
1035115054 7:156517290-156517312 GCTGTGAGGGAGGCTGTGTGAGG + Intergenic
1035115088 7:156517462-156517484 CCCGTGAGGGAGGCTGTGTGAGG + Intergenic
1035115094 7:156517488-156517510 GCTATGAGGGAGGCTGTGTGAGG + Intergenic
1035115170 7:156517866-156517888 TATGCGAGGGAGGCTGTGTGAGG + Intergenic
1035174973 7:157044100-157044122 TGACCAAGGGAGGCTGTGGGTGG - Intergenic
1035217483 7:157379593-157379615 CCTCCTTGGGAGGCTGAGGCAGG - Intronic
1035643272 8:1199939-1199961 CCTCTGCGGGGGGTTGTGGGGGG - Intergenic
1036086690 8:5620292-5620314 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1037030615 8:14099611-14099633 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1037337705 8:17807564-17807586 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1037885844 8:22595896-22595918 GCTACCTGGGAGGCTGTGGGAGG - Intronic
1038270615 8:26072403-26072425 CCTCCTTGGGAGGCTGAGGTGGG - Intergenic
1038290148 8:26241932-26241954 CCTGGGAGGGAGGCTGAGGTGGG + Intergenic
1039242572 8:35572913-35572935 GCTGCGTGGGAGGCTGAGGGAGG - Intronic
1040047165 8:42975815-42975837 GCTACTAGGGAGGCTGTGGCAGG - Intronic
1040423499 8:47261243-47261265 CCGCCGAGGGACGCAGCGGGCGG + Intronic
1040475753 8:47775933-47775955 GCTGCTAGGGAGGCTGAGGGAGG - Intronic
1041395409 8:57385037-57385059 GCTACTTGGGAGGCTGTGGGAGG - Intergenic
1041982850 8:63882792-63882814 GCTCCTTGGGAGGCTGAGGGAGG - Intergenic
1042156922 8:65854151-65854173 ACTCCGGGGGAGGAGGTGGGAGG + Intergenic
1042584358 8:70318654-70318676 GCTACTCGGGAGGCTGTGGGAGG + Intronic
1042588116 8:70365218-70365240 GCTACGAGGGAGGCTGAGGTGGG + Intronic
1043113536 8:76218704-76218726 GCTACGAGGGAGGCTGAGGGAGG - Intergenic
1043578837 8:81688547-81688569 GCTACGAGGGAGGCTGAGGCAGG + Intergenic
1045509960 8:102806546-102806568 CCTCCGGGGGAGGCGGGGGCGGG - Intergenic
1047374009 8:124279024-124279046 CCACCGAGGGGGGCTCTGGAGGG - Intergenic
1047554248 8:125911640-125911662 CCTCCCAGGGAGACTGGGGGAGG - Intergenic
1047611946 8:126529567-126529589 GCTACTAGGGAGGCTGTGGCAGG + Intergenic
1049498203 8:142946610-142946632 CCTCCGAGTGAGACTGTGTCTGG - Intergenic
1049614253 8:143569264-143569286 CCTGGGAGGGAGACTGGGGGCGG + Intronic
1049619303 8:143590793-143590815 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
1049795268 8:144494422-144494444 CCTCCTCGGGAGGCTGAGGTGGG - Intronic
1049878304 8:145042602-145042624 CCTCCTTGGGAGGCTGAGTGGGG - Intergenic
1050357332 9:4795187-4795209 GCTACGAGGGAGGCTGAGGCAGG - Intronic
1050523554 9:6526609-6526631 ACTACCAGGGAGGCTGAGGGGGG - Intergenic
1050550989 9:6748052-6748074 CCTATGAGGGAGGCTGAGGCAGG + Intronic
1051016731 9:12485779-12485801 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1051212283 9:14757441-14757463 CCTCCTGGGGAGGCTGAGGCAGG + Intronic
1051427510 9:16948353-16948375 CCTACTCGGGAGGCTGAGGGAGG - Intergenic
1051624528 9:19086197-19086219 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1052290961 9:26840164-26840186 CCTACGCGGGAGGCTGAGGCAGG - Intergenic
1052927826 9:34032031-34032053 CCTCCTTGGGAGGCTGAGGCGGG + Intronic
1053200661 9:36149585-36149607 CTCCCGAGGGAGGCTGTGCGAGG - Intronic
1053257349 9:36628976-36628998 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1053319611 9:37084261-37084283 CCACCTTGGGAGGCTGAGGGAGG - Intergenic
1055070070 9:72157149-72157171 CCTCCTCGGGAGGCTGAGGCAGG - Intronic
1055302874 9:74900464-74900486 GCTCCTCGGGAGGCTGAGGGAGG - Intergenic
1056167417 9:83952681-83952703 GCTACGAGGGAGGCTGAGGCAGG + Intronic
1056395428 9:86176868-86176890 GCTATGAGGGAGGCTGTGGGAGG + Intergenic
1056593361 9:87983627-87983649 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1056674207 9:88659561-88659583 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1056811149 9:89764935-89764957 GCTTCTTGGGAGGCTGTGGGAGG + Intergenic
1056992755 9:91425722-91425744 ACTACCAGGGAGGCTGTGGCCGG - Intergenic
1057061188 9:92004991-92005013 GCTCCTAGGGAGGCTGAGGCAGG - Intergenic
1057225190 9:93289323-93289345 GGGCCGAGGGTGGCTGTGGGGGG - Exonic
1057375440 9:94517392-94517414 GCTACTTGGGAGGCTGTGGGAGG + Intergenic
1057891405 9:98872662-98872684 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
1058234121 9:102467669-102467691 CCTACTCGGGAGGCTGTGGCAGG + Intergenic
1058455229 9:105132374-105132396 CCTCCTTGGGAGGCTGAGGCAGG - Intergenic
1058655993 9:107220964-107220986 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1059101107 9:111472394-111472416 TCTCCAAGGGAGGCTGAGGTAGG + Intronic
1059426378 9:114223340-114223362 GCTCAGAGGGAGGCTGGAGGAGG + Intronic
1060980925 9:127791453-127791475 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1061059926 9:128245182-128245204 CCCCAGAGGGCGGCTGGGGGAGG - Intronic
1061246999 9:129405591-129405613 GCTCCGAGGGAGGCAGAGTGTGG + Intergenic
1061259277 9:129470823-129470845 GCTCCTAGGGAGGCTGAGGTAGG - Intergenic
1061446581 9:130641858-130641880 GCTACTAGGGAGGCTGAGGGAGG + Intergenic
1062120425 9:134831145-134831167 CCACCCAGGGAGGCTGGGGCTGG - Intronic
1062322153 9:135995550-135995572 CCTACTCGGGAGGCTGAGGGAGG - Intergenic
1062437401 9:136552608-136552630 CCTCGGAGACAGGCTCTGGGAGG - Intergenic
1203770832 EBV:49245-49267 CCTCCAGGGGAGGCTGGAGGCGG + Intergenic
1203428619 Un_GL000195v1:66788-66810 CCTGGGAGGGACCCTGTGGGAGG + Intergenic
1203437669 Un_GL000195v1:156454-156476 CCTGGGAGGGACCCTGTGGGAGG - Intergenic
1203528554 Un_GL000213v1:113937-113959 GCTCCTTGGGAGGCTGAGGGAGG + Intergenic
1185499971 X:589284-589306 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1185546580 X:950305-950327 GCTCCTTGGGAGGCTGAGGGAGG - Intergenic
1186042128 X:5492225-5492247 CCTGGGAGGGACACTGTGGGAGG + Intergenic
1186496275 X:10015003-10015025 ACCCCGAGGGAGACTGGGGGCGG + Intergenic
1187071954 X:15897387-15897409 CCTACTAGGGAGGCTGAGGCAGG - Intergenic
1187366204 X:18667431-18667453 GCTACTAGGGAGGCTGAGGGAGG + Intronic
1187929326 X:24279564-24279586 CCTACTCGGGAGGCTGAGGGAGG + Intergenic
1188549665 X:31349328-31349350 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
1189523974 X:41800313-41800335 CTTCAGAGGGAGGATCTGGGTGG + Intronic
1190057681 X:47191159-47191181 CCTCGGAGGCAGGGTTTGGGGGG + Intronic
1190321639 X:49183445-49183467 GCTACAAGGGAGGCTGTGGTGGG + Intronic
1190815359 X:53924560-53924582 CCTACTTGGGAGGCTGAGGGAGG - Intergenic
1190868305 X:54403265-54403287 GCTACTAGGGAGGCTGAGGGCGG + Intergenic
1191870754 X:65742944-65742966 CCTCCTACGGAGGCTGAGGCAGG - Intergenic
1192127620 X:68516928-68516950 CCTACTAGGGAGGCTGAGGCAGG - Intronic
1192591139 X:72360241-72360263 GCTCCTAGGGAGGCTGAGGCAGG + Intronic
1192820758 X:74642766-74642788 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
1193086657 X:77452963-77452985 GCTACGAGGGAGGCTGAGGTGGG + Intronic
1193233256 X:79074230-79074252 GCTCTGAGGGAGGCTGAGGCAGG + Intergenic
1193483589 X:82059042-82059064 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1193584190 X:83300457-83300479 ACTACCAGGGAGGCTGTGGTAGG + Intergenic
1194024431 X:88734682-88734704 GCTCCTAGGGAGGCTGAGGCAGG + Intergenic
1194973824 X:100373251-100373273 ATCCCGAGGGAGGCTGAGGGGGG - Intronic
1195444157 X:104932101-104932123 GCTACTAGGGAGGCTGAGGGAGG - Intronic
1195893100 X:109717382-109717404 CCTACTAGGGAGGCTGAGGCAGG + Intronic
1198120649 X:133589486-133589508 GCTCCTCGGGAGGCTGAGGGAGG - Intronic
1198167941 X:134075642-134075664 CCTACTAGGGAGGCTGAGGTGGG + Intergenic
1199068123 X:143444118-143444140 CCTACTAGGGAGGCTGAGGCAGG + Intergenic
1199069904 X:143463820-143463842 GCTACTAGGGAGGCTGAGGGAGG - Intergenic
1199247179 X:145619522-145619544 GCTACTAGGGAGGCTGAGGGAGG - Intergenic