ID: 1090211080

View in Genome Browser
Species Human (GRCh38)
Location 11:124921405-124921427
Sequence CTCCGGGGCCGGGTTCTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090211075_1090211080 -7 Left 1090211075 11:124921389-124921411 CCGTCGCGCTTCGAGGCTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1090211080 11:124921405-124921427 CTCCGGGGCCGGGTTCTCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 139
1090211071_1090211080 9 Left 1090211071 11:124921373-124921395 CCGGGCGGGCCGGGCTCCGTCGC 0: 1
1: 0
2: 1
3: 18
4: 237
Right 1090211080 11:124921405-124921427 CTCCGGGGCCGGGTTCTCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 139
1090211072_1090211080 0 Left 1090211072 11:124921382-124921404 CCGGGCTCCGTCGCGCTTCGAGG 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1090211080 11:124921405-124921427 CTCCGGGGCCGGGTTCTCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090211080 Original CRISPR CTCCGGGGCCGGGTTCTCCT CGG Exonic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
900371620 1:2334685-2334707 CTCCGCGGCCAGGTCGTCCTGGG + Intronic
900392635 1:2440333-2440355 CACCATGGCCGGGTGCTCCTGGG - Intronic
900513433 1:3070618-3070640 CTCCGGGGCCGGGTCCCTCCAGG + Intronic
901011719 1:6206170-6206192 TTCCAGGGCCGGCTACTCCTCGG + Exonic
901086515 1:6614649-6614671 CTCGGGGGCCGCGTCCTCCGGGG + Intronic
904271038 1:29350254-29350276 CTCCAGGGCCGGGTTCTGATTGG - Intergenic
914971029 1:152308167-152308189 CCCCGGGGCCTGCTTGTCCTGGG + Exonic
920578879 1:207085989-207086011 CTCCAGGACAGGGTCCTCCTGGG - Intronic
1064533787 10:16337026-16337048 CTCCTGGGCCTGTTTCTTCTTGG + Intergenic
1069594841 10:69663896-69663918 CTCCGGTCTCGGGCTCTCCTGGG + Intergenic
1076233823 10:128848200-128848222 CTCTGGGGACCAGTTCTCCTGGG - Intergenic
1076345680 10:129777491-129777513 CTCCGTGGCTGTGTTCTCCGGGG + Intergenic
1076675539 10:132145787-132145809 CTCCTGGGTCCTGTTCTCCTGGG + Intronic
1076917177 10:133430108-133430130 CTCCAGGCCCAGCTTCTCCTGGG + Intergenic
1076937272 10:133574867-133574889 CTCCAGGCCCAGCTTCTCCTGGG + Intergenic
1077479612 11:2807555-2807577 CTCCCGGGCCGGGCCCTCCTCGG + Intronic
1079359641 11:19759607-19759629 CTCTGGTGCTGGGTACTCCTGGG + Intronic
1081651521 11:44827215-44827237 CTCCGGGGCCTAGAGCTCCTGGG - Intronic
1081773651 11:45664355-45664377 CTCTGGGGCCGGCTTCCTCTTGG - Intronic
1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG + Intergenic
1084276359 11:68053107-68053129 CCCCTGGGCAGGGTTCTCCAAGG - Exonic
1084768318 11:71326533-71326555 CTCCAGAGGCCGGTTCTCCTTGG + Intergenic
1085555081 11:77412145-77412167 CTCCAGGGCCAGGTTTTCCAGGG + Intronic
1086331883 11:85762375-85762397 CTCCTGGGGCAAGTTCTCCTTGG + Intronic
1090211080 11:124921405-124921427 CTCCGGGGCCGGGTTCTCCTCGG + Exonic
1090259191 11:125306399-125306421 CTCCCAGGCCCGCTTCTCCTGGG + Intronic
1091243327 11:134069452-134069474 CCCCGGGGGCGGGCTCTTCTCGG + Intronic
1091665861 12:2418175-2418197 CTCCCAGGCTGGCTTCTCCTGGG + Intronic
1095289734 12:40464169-40464191 CTCCAGGGCCTGCTTCTCCAGGG - Exonic
1099261014 12:80382678-80382700 CTCCTGGGCCTGTTACTCCTTGG - Intergenic
1101518219 12:105457129-105457151 CTCCTGGGCCAGGTTCCTCTAGG + Intergenic
1103941146 12:124501911-124501933 CCCCCGGGCCGGCTTCTCCTCGG - Intronic
1104965481 12:132507115-132507137 ATGCGGGGGCGGGTCCTCCTCGG + Intronic
1104975087 12:132548665-132548687 CTCCGGGGCCTGATGCTCCTCGG - Intronic
1106145638 13:27047455-27047477 CTCCGAGCCTGCGTTCTCCTGGG + Intergenic
1113956759 13:114103472-114103494 CTCCGGTGTCAGGTGCTCCTCGG - Intronic
1121024772 14:90607452-90607474 CGCCAGGGCTGGGTTCTCCCAGG + Intronic
1122848177 14:104512240-104512262 CTGCTGGGCTGGGTTGTCCTGGG - Intronic
1124983196 15:34583030-34583052 ATCCGGGCTCGGGTTCTCCCGGG + Intronic
1129458593 15:75688779-75688801 CTCCAGGGCCAGGTTCTCCACGG + Exonic
1129725199 15:77898093-77898115 CTCCAGGGCCAGGCTCTCCATGG - Intergenic
1130133324 15:81161394-81161416 CTCTGGGGACGGGAACTCCTTGG + Intronic
1131173129 15:90192291-90192313 CTCCAGAGCCAGGTTCCCCTGGG + Intronic
1132228197 15:100160342-100160364 CTCCCTGGCTGGGATCTCCTGGG + Intronic
1132743368 16:1426921-1426943 CCCCGGGGCCCTGCTCTCCTTGG + Intergenic
1133051441 16:3119478-3119500 CTCCGGGACGCGGTACTCCTGGG - Exonic
1136367003 16:29813539-29813561 CTCAGGGGTGGGGTCCTCCTGGG - Exonic
1137630595 16:49941006-49941028 CTCCAGGGGCGGGAGCTCCTGGG - Intergenic
1139547074 16:67654340-67654362 CTCAGTGGCCGGGTCCTCCTCGG - Exonic
1141468566 16:84222951-84222973 CTGCGTGGCCTGGTTCTCCCTGG - Exonic
1142509713 17:385945-385967 CTCCGGGCCCGGGCGCTGCTCGG + Intronic
1143949367 17:10620542-10620564 CTCCAGGGCCTGGTTCTCAGAGG + Intergenic
1145969651 17:28949669-28949691 CTGCCCGGCCGGGATCTCCTCGG - Intronic
1150790456 17:68197629-68197651 CGCCGGGGCAGTGTCCTCCTTGG + Intergenic
1152291562 17:79442806-79442828 CTCCTGGGAGGGGTTCTTCTGGG - Intronic
1152642107 17:81453628-81453650 CTCCTGGGGGGGGGTCTCCTGGG + Intronic
1152928674 17:83099364-83099386 CTCCTGGGCCCTGCTCTCCTGGG + Intergenic
1160005163 18:75063858-75063880 CACGGCGGCCGGGCTCTCCTGGG - Exonic
1161154718 19:2726725-2726747 CTCTGGGGCGGGGCTGTCCTGGG - Intronic
1161345178 19:3765381-3765403 CTCCGGGAAGGGGTCCTCCTGGG - Intronic
1161478608 19:4499627-4499649 CTCCCCGGCCAGCTTCTCCTCGG - Exonic
1161571264 19:5032036-5032058 CTCTGGGGAAGGGTCCTCCTTGG - Intronic
1161802068 19:6421820-6421842 CTCAGGGGCCAGTCTCTCCTGGG - Intronic
1162776851 19:12984958-12984980 CTCGGGGGCGGGGGTGTCCTAGG + Intergenic
1162802388 19:13118545-13118567 CTGCGGGCCCGGCTCCTCCTCGG - Intronic
1165056902 19:33183257-33183279 CTCCAGGGCTTGATTCTCCTAGG - Intronic
1165090023 19:33381408-33381430 CTCCTGGGACAGCTTCTCCTGGG - Exonic
1165266720 19:34667413-34667435 CCCCGGGCCCAGGTTCTCCTGGG - Intronic
1166315644 19:41988098-41988120 ATCCCGGGCCAGGATCTCCTGGG + Exonic
1167409759 19:49337983-49338005 CTCCTCGGCCGCGGTCTCCTCGG - Exonic
1168107172 19:54172405-54172427 CGCCGGGGGCCTGTTCTCCTGGG - Intronic
1168508468 19:56955661-56955683 GCCCGGGGCCGGGGGCTCCTTGG - Intergenic
925395327 2:3529453-3529475 CTCCGCGGCCTGGACCTCCTGGG - Intergenic
925919033 2:8626612-8626634 CTTGGGGGCCGTGGTCTCCTGGG - Intergenic
926685391 2:15694141-15694163 CTGAGGGGCCGGGGTCTCCTTGG + Intronic
927511815 2:23648682-23648704 CGCCGGGGCCAGGTCCTCCATGG + Intronic
934655498 2:96115113-96115135 CTACGTGGCCAGGTGCTCCTGGG - Exonic
938583976 2:132670919-132670941 CCCCGGGACGGCGTTCTCCTAGG - Intronic
943351295 2:186799352-186799374 CTCAGGGCCCGGGTTCTCACTGG - Intergenic
946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG + Intronic
947434489 2:230061112-230061134 CTCCGGGGCAGAGTGCTCCCTGG - Intronic
948826675 2:240576448-240576470 CTCAGGGTCTGGGGTCTCCTGGG + Intronic
1168848752 20:962255-962277 CTCCGGGGAGGGGGACTCCTGGG + Intronic
1176247025 20:64102274-64102296 TGGCGGGGCCGGGCTCTCCTGGG + Intergenic
1178238403 21:30870732-30870754 CTCGCGGGCCGGTTTCTCCGAGG + Intergenic
1178915082 21:36701485-36701507 CTCCGCTGCCGGGTGCTCCCGGG - Intronic
1179710769 21:43211823-43211845 CTCCCGGGCAGGGCTCCCCTCGG + Intergenic
1181078100 22:20394627-20394649 CTCCGGGGCAGGGATCTCCATGG - Exonic
1183188919 22:36309064-36309086 CACCGTGGCCGGGTCCTCCTGGG - Intronic
1184385033 22:44169157-44169179 CTCCTGGGCTGGGCTCTCCTTGG + Intronic
1185269667 22:49923182-49923204 CTCCCTGGCCGGGCTGTCCTGGG + Intronic
949623266 3:5840017-5840039 CTGTGGGGCCGGATTCTCCAAGG - Intergenic
962318120 3:134371251-134371273 CTCTGGGGCCAGGATCTCCAGGG + Exonic
962809080 3:138946567-138946589 CGCCGGGTCCGGCTTCTCCGGGG + Exonic
964928238 3:161982961-161982983 CATCTGGGCAGGGTTCTCCTGGG - Intergenic
968085398 3:195871906-195871928 CTCCAGGGGAGGGTTCTCCGGGG - Intronic
968085405 3:195871921-195871943 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085415 3:195871951-195871973 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085421 3:195871966-195871988 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085427 3:195871981-195872003 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085437 3:195872011-195872033 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085443 3:195872026-195872048 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968703316 4:2066812-2066834 CTCAGGGGCCTGGGGCTCCTGGG + Exonic
984060395 4:174982850-174982872 CTGCTGGGCTGGGGTCTCCTCGG - Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
986759669 5:10868490-10868512 CTCTGAGGCTGGGTTCTCCCAGG - Intergenic
987095625 5:14546677-14546699 CTGCAGGGCTGGTTTCTCCTGGG - Intergenic
988682954 5:33501967-33501989 CTCAGGGCCCGGGTTCTCACTGG - Intergenic
989571939 5:42953327-42953349 CTCCGTGGCGGGGCTCTCCCAGG + Intergenic
990984159 5:61626287-61626309 CTCAGGGGCGGGGTCCTCCAGGG - Intergenic
998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG + Exonic
1005494962 6:26380465-26380487 CTCCGGGTCCCGGTTCTTCCAGG + Intergenic
1006380225 6:33692981-33693003 CTCCGGGCCAGGGTTCCCCAGGG - Intronic
1018799095 6:167209113-167209135 TCCCAGGGCCGGGGTCTCCTGGG - Intergenic
1018803085 6:167238321-167238343 CTCCCCGGCCGGGTTCCCCATGG - Intergenic
1019209745 6:170395307-170395329 CTCCTGAGCCGGGTTCTCTGGGG + Intronic
1019352848 7:563078-563100 TTCCGGGCCCAGGCTCTCCTGGG - Intronic
1022140933 7:27492350-27492372 CTCCGAGGCCAGGTACTCCCTGG + Intergenic
1022473881 7:30698048-30698070 CTCCAAGGCTGGGCTCTCCTGGG + Intronic
1023992112 7:45134535-45134557 GACCGGGGCCTGGGTCTCCTGGG + Intergenic
1025929371 7:65982073-65982095 CTCCCGCGACGGGCTCTCCTGGG + Exonic
1026840899 7:73669474-73669496 CCGCAGGGCCAGGTTCTCCTTGG - Exonic
1029597463 7:101545396-101545418 CTGCTGGGCCGGGTGGTCCTGGG - Exonic
1032277789 7:130474935-130474957 CTCTTGGGCTTGGTTCTCCTTGG + Intergenic
1035264754 7:157684777-157684799 CCCCCGGGCCGGGGTCTCCTCGG + Intronic
1037819559 8:22129111-22129133 CTCTGGGGCCGTCTTCTCCCAGG + Exonic
1039984701 8:42437390-42437412 TTCCTGGGCTGGCTTCTCCTCGG + Exonic
1045931549 8:107633095-107633117 CTCCAGGGCCTGCTTCTCCAGGG - Intergenic
1047186142 8:122635048-122635070 TTCCCAGGCAGGGTTCTCCTGGG - Intergenic
1048990910 8:139759695-139759717 CACGGGGGCCGGGCTCCCCTGGG + Intronic
1049125175 8:140780105-140780127 CTCGGGAGCAGGCTTCTCCTGGG - Intronic
1049724846 8:144140976-144140998 CTCAGGGCCCGTATTCTCCTTGG + Intergenic
1049792308 8:144477828-144477850 CTCCGCGGCTGGGACCTCCTTGG - Intergenic
1057257773 9:93564350-93564372 CTGGGGAGCCGGCTTCTCCTCGG - Exonic
1061348163 9:130043112-130043134 CTCCTCGCCCGGGGTCTCCTCGG + Exonic
1061623006 9:131823948-131823970 CGCCGGCGCCGGGCTCTCCGCGG - Intergenic
1061693927 9:132356670-132356692 CCTCGGGCCAGGGTTCTCCTCGG - Intergenic
1061715261 9:132514853-132514875 CTCCAGGGCCTGTTTCTTCTAGG - Intronic
1061780804 9:132995072-132995094 CTCCAGGGCTGCCTTCTCCTAGG - Intergenic
1061825055 9:133252678-133252700 CTCCAGGCCCGGTTTGTCCTGGG + Intronic
1062037718 9:134390136-134390158 CTCCTGGGTCGGCATCTCCTTGG + Intronic
1062374889 9:136257615-136257637 CTGGGGGGCCTGGTGCTCCTGGG - Intergenic
1185654975 X:1677344-1677366 CTCCTGAGCTGGATTCTCCTGGG - Intergenic
1186841527 X:13488971-13488993 CTTGGGAGCAGGGTTCTCCTTGG + Intergenic
1189332556 X:40152661-40152683 CTCCGGGGCCCGGGTGGCCTGGG - Intronic
1189843067 X:45102888-45102910 CTCCAGGGTTGTGTTCTCCTAGG - Intronic
1190276858 X:48904623-48904645 CTCCGGGGCCTGGCTCCTCTGGG - Exonic
1192510964 X:71720090-71720112 CTCCAGGGCCAGGCTTTCCTTGG - Intergenic
1192515733 X:71761463-71761485 CTCCAGGGCCAGGCTTTCCTTGG + Intergenic
1192523552 X:71822985-71823007 CTCCAGGGCCAGGCTTTCCTTGG - Intergenic
1195757559 X:108214201-108214223 CTCTGGGGCCTGGTTGTCCAGGG + Exonic
1200154706 X:153969343-153969365 CTCCGCGGCCGTTCTCTCCTGGG - Intronic