ID: 1090211615

View in Genome Browser
Species Human (GRCh38)
Location 11:124924753-124924775
Sequence CTCCCCAGTGAAGGTGTCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090211607_1090211615 28 Left 1090211607 11:124924702-124924724 CCTCTTTCCCTGCCAGAGCGCTT 0: 1
1: 0
2: 2
3: 25
4: 215
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90
1090211609_1090211615 20 Left 1090211609 11:124924710-124924732 CCTGCCAGAGCGCTTTACCATCT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90
1090211613_1090211615 3 Left 1090211613 11:124924727-124924749 CCATCTACAGTAAGGTTGATGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90
1090211610_1090211615 16 Left 1090211610 11:124924714-124924736 CCAGAGCGCTTTACCATCTACAG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90
1090211608_1090211615 21 Left 1090211608 11:124924709-124924731 CCCTGCCAGAGCGCTTTACCATC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090211615 Original CRISPR CTCCCCAGTGAAGGTGTCGT CGG Exonic
900992384 1:6104033-6104055 CTTCCCAGGGAAGGTGCCTTGGG - Exonic
903003755 1:20284726-20284748 CTCCCCAGAGAAGGTGGCAGTGG - Intergenic
904833716 1:33321408-33321430 CTCCCCAGGGGAAGTGTCTTTGG + Intergenic
905199005 1:36303917-36303939 CTCCCCACTGAACTTGTCATGGG - Exonic
906698817 1:47842904-47842926 CATCCCAGTGAAGCTGTCCTTGG - Intronic
907115100 1:51961242-51961264 CTCCCCTGTGAAGTTGTAGTGGG + Intronic
907296798 1:53460764-53460786 CTCCCCCGTGGTGGTGTGGTGGG + Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
912561249 1:110553164-110553186 CTCCTCAGTGAAGGTGGCCTGGG + Intergenic
913336657 1:117715356-117715378 TTCCCCAGTGAGGGTGTGTTTGG - Intergenic
914757615 1:150573233-150573255 CTCCCAAGCAAAGGTGTGGTAGG - Intergenic
916273580 1:162969665-162969687 CTCCCCAGGGTAGGAGTAGTAGG + Intergenic
918526826 1:185473789-185473811 CTCCCTAGGGAGGGTGTCGAGGG + Intergenic
919627774 1:199928856-199928878 CTCCCTAGTGAAGCTTTCCTCGG + Intergenic
921348534 1:214211909-214211931 CTCCACAGCTAAGGTGTCCTTGG + Intergenic
922469338 1:225866295-225866317 CTCCCCTGTGAAGCTGTGGGCGG + Intronic
922527450 1:226316487-226316509 CTCCCTAGTGAAGATTTCTTAGG - Intergenic
1063393516 10:5665997-5666019 CGCTCCAGTGAAGGTGGCCTTGG - Intronic
1067342910 10:45419063-45419085 CTTTCCAGTGAAGGCGCCGTAGG + Intronic
1074213495 10:111360787-111360809 CTACCCAATGAAGGAGTCTTTGG - Intergenic
1084718930 11:70891754-70891776 CTCCCCTCTGAAGGTCTCCTGGG + Intronic
1085453904 11:76655201-76655223 CTCCCCAGAGAAGGTGATGGAGG + Intergenic
1088608055 11:111550229-111550251 CTGCCCAGTGAAAGTGCAGTTGG - Intronic
1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG + Exonic
1091456300 12:610546-610568 CCCACCAGTGAAGCTGTGGTGGG - Intronic
1103925022 12:124418832-124418854 CATCCCAGTGAAGTTTTCGTAGG - Intronic
1103925601 12:124422095-124422117 CATCCCAGTGAAGTTTTCGTAGG - Intronic
1104569996 12:129916761-129916783 CTCCTCAGTGAAGGTCTTATTGG + Intergenic
1114339568 14:21728953-21728975 CTCCACAGTGTTGGTGTCTTAGG - Intergenic
1116210828 14:41941176-41941198 CTCCCTAGTGAAGTTCTCTTGGG + Intergenic
1116817952 14:49600082-49600104 CTCCTCCGGGAAGGCGTCGTTGG - Intronic
1120905538 14:89618096-89618118 CTCCCGTGTGGAGCTGTCGTAGG - Intronic
1122296962 14:100711247-100711269 CTTCCCAGTGGAGGTGACCTTGG - Intergenic
1122391863 14:101394894-101394916 GTCCCCAGCGCAGGTGTCTTTGG - Intergenic
1128453716 15:67821541-67821563 CTCCCCGGGGAAGGTGTGGGAGG + Intronic
1130127859 15:81109068-81109090 CTCTCCAGTGAAGCTCTCCTGGG + Intronic
1131355565 15:91742879-91742901 CTCCCCACTGAACTTGTCATGGG + Intergenic
1142154945 16:88528615-88528637 CTCCACAGTGGAGGTGTCCCTGG + Intronic
1142899332 17:3002630-3002652 CTCCCCAGTGGAGGCCTCCTGGG - Intronic
1144556448 17:16286668-16286690 CACCCCAGGGAAGGAGTCGTCGG + Intronic
1147143937 17:38474593-38474615 GACCCCAGTGGAGGTGTCCTGGG + Intronic
1149617593 17:58014441-58014463 CTCTCCAGTGAAGCTTTCCTGGG - Intergenic
1152685108 17:81690056-81690078 CACCCAAGTGAAGGTGTCTGGGG - Intronic
1157686681 18:49648408-49648430 CTCCCCAGTGAATATGGCCTAGG + Intergenic
1158488296 18:57887942-57887964 CTCTCCAGTGAAGTTGCCCTGGG - Intergenic
1162349968 19:10142682-10142704 CTCCCCAGTTAGGGAGTCATAGG + Intronic
1162893676 19:13751675-13751697 CTTCCCTGCGAAGATGTCGTGGG - Exonic
1166304474 19:41929677-41929699 TTCCCCAGAGAAGGTGGTGTGGG - Intronic
1167250585 19:48396662-48396684 CTCCCCAGGGAAGGGGTTGGGGG - Intronic
925363977 2:3298622-3298644 CTCCCCCGAGAAGATGTCGTGGG + Intronic
928220321 2:29397984-29398006 CTCCCAAGTGAACATATCGTTGG - Intronic
929966945 2:46543135-46543157 CTCCTCCGGGAAGGCGTCGTTGG - Exonic
932464512 2:71907727-71907749 CACCACAGTGAATGTGTCATAGG - Intergenic
938613480 2:132973135-132973157 CTCCCCAGTGACGGTGTAGAAGG - Intronic
946167054 2:217870716-217870738 CTCCCGAGTGAATGTGCCTTTGG - Intronic
946168701 2:217880917-217880939 ATGCCCACTGAAGTTGTCGTAGG + Exonic
947642259 2:231713748-231713770 CTCCCCAGTTAAGGCTTCTTGGG - Intergenic
947933763 2:233985706-233985728 ATTCCCAGTGAAGGTGCAGTGGG - Exonic
948460381 2:238127441-238127463 CTCCCCAGAGAAGGTCCAGTGGG + Intronic
1171216379 20:23355617-23355639 TTCCCCAGTTAAGTTGTCTTTGG + Intergenic
1174844221 20:53927826-53927848 CTCCTCAGAGAAGCTGTCGCTGG + Intergenic
1175688638 20:61049751-61049773 CTCACCAGCGAAGCTGTCCTGGG - Intergenic
1177041188 21:16113624-16113646 CTCCTCAGTCATGGTGTCCTGGG - Intergenic
1179615292 21:42579603-42579625 CACCCCAGGGAAGGTGCTGTGGG + Intronic
1179992297 21:44954378-44954400 CTCCCGAGAGAAGGTGGCCTGGG - Intronic
1181328325 22:22068847-22068869 CTCCTCAGTGAATGTGGCCTTGG + Intergenic
1183027122 22:35073646-35073668 CTTCCCAGAGAAGCTGTGGTCGG + Intronic
952233532 3:31455797-31455819 CTCCCCACTGAATTTGTCATGGG - Intergenic
954151662 3:48660832-48660854 CTCGCCAGTGAGGCTGTCGATGG + Exonic
954391511 3:50270310-50270332 CTCCCCAGGGAAGGAGCCCTGGG + Intronic
954397887 3:50302687-50302709 CTCCCCAGTGGGCGTGTAGTAGG + Exonic
954433205 3:50482294-50482316 CTCCCCAGGGAAGGTGGCCCAGG - Intronic
969288333 4:6222210-6222232 CTCCCCAGTGAGGGCGTCCCTGG + Intergenic
969892452 4:10272366-10272388 CTGCCCAGAGAAGGTGCCATTGG - Intergenic
992499382 5:77327131-77327153 CTCCCCAGGGAATGTGTGCTGGG - Intronic
996128418 5:119752755-119752777 TTCCCCAGTGAGGGTGTGTTTGG - Intergenic
1004074870 6:12335947-12335969 CTTCCCAGTGCAGGTGACCTTGG - Intergenic
1006684311 6:35819629-35819651 CTCCCCAGTGAGGGTCTCAGAGG - Intronic
1007823205 6:44577569-44577591 TTCCCCAGTGAGGATGTCCTGGG + Intergenic
1009405791 6:63310883-63310905 CTCTCTAGTGAAGGTTTCCTGGG + Intronic
1014075823 6:117233099-117233121 CTGCTCAGTGAAGGTGCCCTAGG - Intergenic
1015769839 6:136757111-136757133 TAGCCCAGGGAAGGTGTCGTAGG + Intronic
1019832882 7:3350435-3350457 CTCCCCAGTGTAGTTGTAGTGGG + Intronic
1020726401 7:11820395-11820417 CTCCCCACTGAACTTGTCATGGG + Intronic
1021891789 7:25193683-25193705 CTCACCAGTGAAGCTGCCTTAGG - Intergenic
1025176582 7:56805266-56805288 CTCCTCAGCCAAGGTGTCTTGGG - Intergenic
1025695210 7:63771120-63771142 CTCCTCAGCCAAGGTGTCTTGGG + Intergenic
1035231466 7:157468496-157468518 CTCTCCCGTGAAGGTGACGGTGG - Intergenic
1042499014 8:69488897-69488919 CTCCCCGGGGAAGGTGTAATTGG + Intronic
1051328455 9:15998373-15998395 CTTCCCAGTGAAGGAGAGGTGGG - Intronic
1051613322 9:18982359-18982381 CTCCCCAGGGAAGGTGTCCGAGG + Intronic
1052883102 9:33617809-33617831 CTCCCCAGAGAAGGTGGTGTGGG + Intergenic
1055260954 9:74433009-74433031 CTCCCTAGTGAGGGAGACGTGGG + Intergenic
1057020101 9:91690755-91690777 CTCCACTGTGAAGCTGTCCTGGG - Intronic
1057509923 9:95669651-95669673 CTCCCCCTTGTAGGTGTCGGGGG - Intergenic
1058866571 9:109166932-109166954 CTCCCCCGCGAAGGTGCCGTAGG + Exonic
1191127872 X:56976795-56976817 CTCCCCAGTGAAACAGTCATGGG - Intronic
1195216226 X:102705949-102705971 CTCCTTAGTGAAGGTGTGCTCGG - Intergenic
1197560043 X:128009706-128009728 CTCCACAGTGGATGTGTGGTAGG - Intergenic
1198312420 X:135435487-135435509 CTCCCCAGTCAGGGTCTCCTTGG - Intergenic