ID: 1090211615

View in Genome Browser
Species Human (GRCh38)
Location 11:124924753-124924775
Sequence CTCCCCAGTGAAGGTGTCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 90}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090211607_1090211615 28 Left 1090211607 11:124924702-124924724 CCTCTTTCCCTGCCAGAGCGCTT 0: 1
1: 0
2: 2
3: 25
4: 215
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90
1090211609_1090211615 20 Left 1090211609 11:124924710-124924732 CCTGCCAGAGCGCTTTACCATCT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90
1090211610_1090211615 16 Left 1090211610 11:124924714-124924736 CCAGAGCGCTTTACCATCTACAG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90
1090211613_1090211615 3 Left 1090211613 11:124924727-124924749 CCATCTACAGTAAGGTTGATGGT 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90
1090211608_1090211615 21 Left 1090211608 11:124924709-124924731 CCCTGCCAGAGCGCTTTACCATC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1090211615 11:124924753-124924775 CTCCCCAGTGAAGGTGTCGTCGG 0: 1
1: 0
2: 0
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090211615 Original CRISPR CTCCCCAGTGAAGGTGTCGT CGG Exonic