ID: 1090213016

View in Genome Browser
Species Human (GRCh38)
Location 11:124936114-124936136
Sequence CTGTGTATTCAGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 250}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090213016_1090213020 24 Left 1090213016 11:124936114-124936136 CCAACTTCCCTCTGAATACACAG 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1090213020 11:124936161-124936183 TCTTTCCTCTCCCTCAGACCTGG 0: 1
1: 0
2: 7
3: 32
4: 404
1090213016_1090213019 -5 Left 1090213016 11:124936114-124936136 CCAACTTCCCTCTGAATACACAG 0: 1
1: 0
2: 2
3: 15
4: 250
Right 1090213019 11:124936132-124936154 CACAGAGCTCTGTGTATTGCTGG 0: 1
1: 0
2: 1
3: 29
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090213016 Original CRISPR CTGTGTATTCAGAGGGAAGT TGG (reversed) Exonic
900598142 1:3491714-3491736 TTGTCTCTGCAGAGGGAAGTGGG - Intronic
901775951 1:11560568-11560590 CTGTGTGCTCAGATAGAAGTAGG - Intergenic
903770129 1:25758580-25758602 CTGTCTTTTCAGTGGGAACTGGG + Exonic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
906856385 1:49310234-49310256 CTTTTGATTCTGAGGGAAGTAGG + Intronic
907661047 1:56392711-56392733 CTTTTTATTCTGAAGGAAGTGGG - Intergenic
908828089 1:68152730-68152752 ATGTGGCTTCAGGGGGAAGTGGG + Intronic
909309490 1:74128943-74128965 CTGTTTATCCAGGGGAAAGTAGG - Intronic
909318111 1:74248559-74248581 TTGTATATTCACAGTGAAGTTGG - Intronic
909417223 1:75420101-75420123 CTGTGTTTTCATAGGGTAGAAGG - Intronic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
911118542 1:94271902-94271924 CTTTGTGTCCAGAGGCAAGTAGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
915027475 1:152844228-152844250 CTGTGTTTACAGATGTAAGTGGG + Intergenic
915168129 1:153959922-153959944 CTGACTAATGAGAGGGAAGTGGG - Exonic
916193553 1:162201962-162201984 CAGTGTGTTCAGAGGAGAGTTGG + Intronic
916291051 1:163166574-163166596 CTGTGGATTCAGAAGAGAGTGGG + Intronic
916785338 1:168083047-168083069 GTGTGGCTTCAGAGGGAGGTGGG - Exonic
919652205 1:200161472-200161494 ATGTGTATACAGAGGGAAAATGG + Intronic
919894818 1:202002983-202003005 CTGTGTTGTCAGAGCCAAGTTGG - Intronic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
921009350 1:211125550-211125572 ATTTGTATTAAGAGTGAAGTTGG - Intronic
922227644 1:223659464-223659486 AAGTGTATTCAGAGGAAGGTGGG - Intronic
922610748 1:226925229-226925251 CTGTATACTCACAAGGAAGTGGG + Intronic
923999636 1:239536094-239536116 CTCTGAATTCAGATGGAATTTGG - Intronic
1063457518 10:6194696-6194718 TTGTGGATTCAGTGGGAAGCTGG + Intronic
1063936352 10:11082521-11082543 CTCTCTATTCAGAGCAAAGTAGG - Intronic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1067405440 10:46018969-46018991 TAATGTATTCTGAGGGAAGTGGG + Intronic
1067414506 10:46093242-46093264 GTGTGCATTCAGTGGGAGGTGGG - Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068742544 10:60490458-60490480 CTGATTTTTCACAGGGAAGTAGG - Intronic
1069945223 10:71981084-71981106 CTGTTTTTTCAAAGGGAAGAAGG + Intronic
1072299326 10:94043889-94043911 CTTTTTATTCAGAGGAAAGAGGG + Intronic
1075256865 10:120932281-120932303 CTGTGTGTTCAGATGGGAGCTGG - Intergenic
1076270059 10:129144567-129144589 ATGTGAGTTCAAAGGGAAGTAGG - Intergenic
1077510366 11:2957201-2957223 CTGTGAATTCAGCGTGAAGAAGG - Intronic
1078384760 11:10879920-10879942 CTGCTTATTCAGAGGGACCTGGG - Intergenic
1079193765 11:18305701-18305723 CTATCTTTTCAGAGTGAAGTTGG - Intronic
1079457311 11:20648047-20648069 CTGTGTTTGCAGTGTGAAGTGGG - Intronic
1082742810 11:56929557-56929579 CTGTGTAATCTGAAGAAAGTTGG + Intergenic
1082874364 11:57972825-57972847 CTGTGTATGCTGAGGGGAGTGGG + Intergenic
1083276136 11:61598097-61598119 CTGGGTCTGCAGGGGGAAGTGGG - Intergenic
1083330688 11:61897090-61897112 CTTAGTATTCAGAGGGCTGTGGG - Intergenic
1083603368 11:63962271-63962293 CTGTGCTTTCAGAGGGCAGCTGG - Intergenic
1086039779 11:82462338-82462360 CTGAGTCTTCAAAGAGAAGTAGG + Intergenic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1089235674 11:117022886-117022908 CTGTGTGGTAAGATGGAAGTGGG - Intronic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1091001575 11:131914110-131914132 CTGTGTACAGAGAGGCAAGTAGG + Intronic
1091679942 12:2519962-2519984 TTGTGTATACAGTGCGAAGTAGG + Intronic
1093179367 12:15949996-15950018 CAGTGTAATCAGGGGAAAGTAGG - Intronic
1093232241 12:16560404-16560426 CTTTGTAATCAGAGGTAAGCAGG - Exonic
1094233452 12:28135873-28135895 CTGTGAATTCAGACAGATGTGGG - Intronic
1094408493 12:30145144-30145166 CTCTGTATTGAGGGGGAAGGGGG - Intergenic
1094771252 12:33662762-33662784 CAGTGAATCCAGAGGGAAGCAGG + Intergenic
1094879489 12:34702571-34702593 CTGTGTATTTAGAGGGCTTTGGG + Intergenic
1096746606 12:53732285-53732307 CTGTGGACTCTGTGGGAAGTAGG + Intergenic
1097457474 12:59817456-59817478 CTGTGTATTCATATAGCAGTGGG - Intergenic
1097763739 12:63499355-63499377 TTGTGTATTCATAGGGCAATAGG - Intergenic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1102856819 12:116301396-116301418 CTTTGTAGTCAGAGGGATCTGGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1103187963 12:118977950-118977972 CTGTGGATTTAGAGAGAACTAGG - Intergenic
1106685011 13:32049337-32049359 TTGTGTATACAAAGGCAAGTTGG + Intronic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1107942747 13:45389062-45389084 CCAAGTATTCAGATGGAAGTTGG + Intergenic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112669064 13:101613924-101613946 CTGTTTGCTCAGTGGGAAGTAGG - Intronic
1112899355 13:104340042-104340064 TTGTGTATACAGAGGCAAGCAGG - Intergenic
1115079668 14:29435736-29435758 CTGTATACTCATAGGGAAGCTGG - Intergenic
1116689709 14:48089693-48089715 ATGTGTAGTCAGAAAGAAGTGGG - Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117842882 14:59879842-59879864 CCAGGTATTCAGAGGGAATTAGG + Intergenic
1121452063 14:94014986-94015008 CACTGAATTCAGAGGGAGGTTGG + Intergenic
1121991178 14:98559196-98559218 CTGTGTGCTCAGAGAAAAGTGGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1123810249 15:23917745-23917767 CTGTTTATTCAAAGTTAAGTTGG - Intergenic
1124220388 15:27845949-27845971 CTGTGTCTTCATGGGGACGTGGG - Intronic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1131824387 15:96306321-96306343 CTCTGGGTTCAGTGGGAAGTTGG + Intergenic
1132012341 15:98287106-98287128 CTGAGAATCCAGAGGGAACTGGG - Intergenic
1132078526 15:98844634-98844656 GTGTGTATTTAGAGAGAAGGAGG + Intronic
1132152746 15:99474252-99474274 CTTTGTATCCACAGGGAAATGGG - Intergenic
1132723921 16:1330656-1330678 TTGGGTCCTCAGAGGGAAGTTGG + Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133895997 16:9929499-9929521 CTGTGGATTCAGAGAGAAGTGGG - Intronic
1136318646 16:29468293-29468315 GTGTGAATTCAGAGGCAAGCGGG - Intergenic
1136433218 16:30207639-30207661 GTGTGAATTCAGAGGCAAGCGGG - Intronic
1138385613 16:56633797-56633819 CTGTGTCTGCAAAGGGACGTTGG + Exonic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1141684608 16:85563105-85563127 CCGTGTATTCGAAGGGAAGAGGG + Intergenic
1142067518 16:88071352-88071374 CAGTGGATTGAGTGGGAAGTGGG + Intronic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1147222141 17:38941678-38941700 GTGTGTATTGAGAGGGGAGAGGG + Intronic
1147987328 17:44314220-44314242 CTGTGGGTTCACAGGGAGGTTGG + Intronic
1148350308 17:46936719-46936741 CTGTGTGTTCAGAGCCAAGCAGG + Intronic
1149664648 17:58357445-58357467 GTGAGTTTTCAGAGGGAAGTGGG - Intronic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152330549 17:79670181-79670203 CAGTGAATGCAGAGGGAAGTGGG - Intergenic
1156147288 18:34199510-34199532 CTGTGGATTCAGAGTTAAGTTGG - Intronic
1157505056 18:48220165-48220187 CTCTGCCTTCAGAGGGAACTGGG - Intronic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158231862 18:55265463-55265485 CTAGGAATTCAGGGGGAAGTTGG + Intronic
1161068233 19:2248492-2248514 CTGGGCCTTCGGAGGGAAGTGGG - Exonic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1165237811 19:34437307-34437329 CTGTGTATTAAGACTGAAGGTGG + Intronic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
929920920 2:46171072-46171094 CTGTGTCTCCAGCTGGAAGTGGG - Intronic
931901317 2:66791540-66791562 CACTGAATGCAGAGGGAAGTTGG + Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932284265 2:70519143-70519165 GTGGGTATTCAGAGGGCAGCAGG + Intronic
932693098 2:73930188-73930210 GTCTGTTTTCAGAGTGAAGTAGG + Intronic
932693774 2:73936494-73936516 CTGCCTATTCAGAGAGGAGTTGG + Intronic
933468140 2:82682708-82682730 CTGTTTTCTCAGAGGGAAATTGG - Intergenic
934652083 2:96098575-96098597 CTGTTTTCTCTGAGGGAAGTAGG - Intergenic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
935293772 2:101630752-101630774 ATGTGGAGTCAGAGTGAAGTAGG - Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
938602198 2:132853893-132853915 CTGTGTATTTAAAGTGAAGAAGG - Intronic
940087377 2:149876048-149876070 CTGTGTATCCATTGGCAAGTTGG - Intergenic
941446088 2:165601697-165601719 TTGTGTATTCAGAGAGAAAAGGG - Intronic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
942996202 2:182263570-182263592 CTGTGAATTCAGAGCTAAGAGGG - Intronic
943181836 2:184554372-184554394 CTGAATATTCAGAGTGAAATTGG + Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
946044353 2:216809450-216809472 CTGTGGAGTCAGAGTGAAATGGG + Intergenic
946265552 2:218538282-218538304 CTTTGTATGGAGAGAGAAGTGGG + Intronic
947106892 2:226676870-226676892 CTGTGTGTTCAGCAGGAACTTGG - Intergenic
948586760 2:239024635-239024657 CTGTTTGTTCACAGGGATGTGGG - Intergenic
1168761871 20:354830-354852 CTGTTTATTGAAAGGGAAGGTGG - Exonic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169479846 20:5969747-5969769 GCTTTTATTCAGAGGGAAGTAGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1171157469 20:22889639-22889661 CTGTGACTTCAGTGGGAAGGTGG - Intergenic
1172782607 20:37446177-37446199 CTGTGCATGCAGAGGGATGGGGG - Intergenic
1173257626 20:41406141-41406163 CATTGTATTCAGAGAGGAGTGGG - Intronic
1173545526 20:43894822-43894844 CCGGGCATCCAGAGGGAAGTGGG + Intergenic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173879345 20:46399831-46399853 CTGTGTAGTTAGAGGGTATTGGG - Intronic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1179567216 21:42256691-42256713 CTCTGCATTCAGAGGGATCTGGG + Intronic
1181313692 22:21958959-21958981 CTGTGTATTCTAGGGGACGTGGG + Intronic
1183000817 22:34857168-34857190 CTGTTTACACAGAGAGAAGTAGG + Intergenic
1183334351 22:37238073-37238095 CTGTGTACTTGGAGTGAAGTGGG + Intronic
1184575354 22:45359950-45359972 CTGTGTAATTACAGGGAAGTGGG - Exonic
1185046699 22:48532027-48532049 CTGTGCATCCAGAGGAAGGTGGG + Intronic
1185174406 22:49313038-49313060 CTGTGTATTCAGGGTGAAGGTGG - Intergenic
1185391454 22:50563530-50563552 CTTTTTTTTCAGAGGGACGTGGG + Intergenic
950194035 3:10996348-10996370 CTATGGAGTCAGTGGGAAGTGGG + Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952342414 3:32457283-32457305 CTGTGGATCCAGTGAGAAGTAGG - Intronic
953362292 3:42308782-42308804 CTATGTATTCAAAGGGACTTGGG + Intergenic
953758866 3:45671215-45671237 CTGAGCATTCAGAGGAAAGCTGG + Intronic
955917914 3:63925167-63925189 CTGTGAAGGAAGAGGGAAGTTGG + Intronic
957226840 3:77460088-77460110 CTGTGTACTCTGAGAGATGTTGG + Intronic
958962358 3:100522409-100522431 CTGTGAATTCAGAAGGAGGATGG - Intronic
960164051 3:114381792-114381814 CTGTTTCTTCAGAGGGCAGGAGG + Intronic
960643873 3:119856236-119856258 CTGTGTAGTTAAAGGGAACTAGG + Intronic
960727020 3:120680864-120680886 CTGAGTCTTCAGAGAGAAGTTGG - Intronic
962949914 3:140208816-140208838 CTCTGTACTCAGGGGGTAGTTGG + Intronic
964447401 3:156774460-156774482 CTGTGTACTCAAAGAGAAGCTGG + Intergenic
964950210 3:162282071-162282093 CTGTCTATTCAGTGTGATGTTGG + Intergenic
971155296 4:24075262-24075284 CTGTGTTTTCACAGGGAGGAAGG - Intergenic
971256030 4:25014191-25014213 CTGAGAATTCAGAGTGCAGTAGG - Intronic
973658731 4:53079587-53079609 ATGTGTAGGCAGAGGGAACTAGG + Intronic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978750007 4:112235695-112235717 CTCTGAATTCAGAGGGACCTGGG - Intronic
981050122 4:140301329-140301351 CTGTGGATTTAGGGGGAATTAGG + Intronic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
984998173 4:185456975-185456997 TTCTGTATTCAGAAGGATGTTGG - Intronic
986333940 5:6738855-6738877 CTGTGGTTACAGAGGGAAATTGG + Intronic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
989723315 5:44554991-44555013 CTGTGAAAACAGAGGGAATTAGG + Intergenic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990674835 5:58171963-58171985 CTGCTTATTAAGAAGGAAGTCGG - Intergenic
991362035 5:65830946-65830968 CTTTGTATTCAGGGCAAAGTGGG + Intronic
991441055 5:66649776-66649798 CTGTGGATTCAGAGTGAAACAGG - Intronic
991988197 5:72311314-72311336 GTGTGTATACAGGGGGAAGGAGG + Intronic
993453863 5:88105088-88105110 CTGTGTATTCACATGGTAGAAGG - Intergenic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994084959 5:95748177-95748199 CTTTGTATTCAGAGTTTAGTGGG + Intronic
995073875 5:107958462-107958484 CTTTCTTTTCAGAAGGAAGTAGG - Intronic
996428206 5:123338217-123338239 TTGTGTATACAGAGTGTAGTTGG + Intergenic
996714120 5:126572868-126572890 CTGTGTATTCAGAAGGATATAGG - Intronic
997612538 5:135225155-135225177 TTGTGGAGTCAGAGAGAAGTTGG + Intronic
999250602 5:150180152-150180174 CTGTGGATTCAGAGCCATGTTGG + Intronic
999961726 5:156763150-156763172 TTGTGTAATGAGAGTGAAGTAGG + Intronic
1000211042 5:159106020-159106042 CTGTTTATTCAGGGGAAAGTTGG + Intergenic
1000307813 5:160011718-160011740 TTGTGCAATCAGAAGGAAGTAGG - Intronic
1000763918 5:165261389-165261411 CTGAGTTTTCAGAGGAAACTTGG + Intergenic
1002148189 5:177203035-177203057 TTTTGCATTCTGAGGGAAGTAGG + Intronic
1002945876 6:1760329-1760351 CTCTGTATTCAGTGGTAAGAAGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006541685 6:34745095-34745117 CAGTGTATTCAATGGAAAGTGGG + Intergenic
1006646968 6:35521528-35521550 CTGTTAACACAGAGGGAAGTAGG - Intergenic
1007272597 6:40649818-40649840 CTGTGGAGTTAGAGGAAAGTAGG - Intergenic
1007497392 6:42269405-42269427 CCGTGTATCTTGAGGGAAGTGGG + Exonic
1008327976 6:50208582-50208604 AGTTGTATTTAGAGGGAAGTAGG - Intergenic
1011133501 6:84075286-84075308 CTGTGTATCCAGAAGGAAAGAGG + Intronic
1012807685 6:103915784-103915806 CTGTATATTCAGAAGGGAGCTGG - Intergenic
1014038745 6:116799115-116799137 CTGTTTATTGAGAGGTGAGTAGG + Intronic
1014808608 6:125859962-125859984 TTGTTTTTTGAGAGGGAAGTAGG + Intronic
1014900567 6:126959190-126959212 CACTGTATTCAGAGTGGAGTAGG - Intergenic
1015532920 6:134239257-134239279 GTGTATTATCAGAGGGAAGTGGG - Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1018013222 6:159690536-159690558 CTGTGTATTCAGATATCAGTTGG - Intronic
1018641873 6:165911478-165911500 CTGTGTAACCAGATGAAAGTTGG - Intronic
1019050942 6:169183161-169183183 CGGTGTAGGCAGAGGGAACTCGG - Intergenic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1021207702 7:17805855-17805877 ATTTGTATTAGGAGGGAAGTGGG + Intronic
1021996246 7:26180550-26180572 CTGTGAATACTCAGGGAAGTGGG - Intronic
1026980538 7:74524057-74524079 CTGTGTTTTGATAGAGAAGTGGG + Exonic
1030791295 7:113732312-113732334 CTGTGGTATCAGAGTGAAGTGGG - Intergenic
1032765923 7:134993511-134993533 CTGTGTAGTCCGGGGGAAGAAGG - Exonic
1033486976 7:141800151-141800173 CTGTCTATCCACAAGGAAGTGGG + Intergenic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1035136265 7:156706038-156706060 CTGTGTCTTCATAGGTAAGGTGG - Intronic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035251335 7:157599422-157599444 CTGTGTATTCAGAGAGACAGAGG - Intronic
1038092757 8:24272359-24272381 CAGTGTAGTCAGAAGGAAGGTGG - Intergenic
1041389509 8:57336379-57336401 GTGTTTCTTCAGAGGGAACTGGG - Intergenic
1042153175 8:65811725-65811747 GTGTGTAGTTAGAGGGAAGAAGG + Intronic
1042878706 8:73463904-73463926 GTGTGTACTGAGAAGGAAGTGGG + Intronic
1043387049 8:79758849-79758871 CTATGTCTTCAGAGGAGAGTGGG + Intergenic
1044359002 8:91259501-91259523 CTGTGCAATGAGAGGAAAGTTGG - Intronic
1044489317 8:92793311-92793333 CTGAAGAGTCAGAGGGAAGTAGG + Intergenic
1044515266 8:93130287-93130309 CAGTGTGTTCAGAGTGAAGTTGG - Intergenic
1047830294 8:128622216-128622238 ATGTGTATTGCTAGGGAAGTAGG + Intergenic
1048048702 8:130796939-130796961 GGGTGTTTGCAGAGGGAAGTTGG - Intronic
1048774848 8:137934555-137934577 CTGTGTATTCAGAGAAATGAAGG - Intergenic
1049910451 9:261119-261141 TTGTCTATGCAGAGGGAACTGGG + Intronic
1052510195 9:29408028-29408050 CTGTTTATTTAGTGGGAAATAGG - Intergenic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053785583 9:41650452-41650474 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054174302 9:61864418-61864440 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054449160 9:65393463-65393485 CTCTGTACCCAGAGGGAATTAGG + Intergenic
1054663236 9:67716373-67716395 CTCTGTACCCAGAGGGAATTAGG - Intergenic
1057157492 9:92856091-92856113 CTGTGTTTTCTGAGGTATGTGGG - Intronic
1057493185 9:95538881-95538903 CTGTGTATTCAGAATGAATTTGG - Intergenic
1059011310 9:110464623-110464645 CTGTGTAGCCTGAGAGAAGTAGG + Intronic
1059243747 9:112831741-112831763 CTGTGTATTCAAACTCAAGTTGG + Intronic
1061113593 9:128593260-128593282 CTGTGTGTTCAGAGTGGTGTTGG + Intronic
1061295311 9:129673861-129673883 CTGTTTAGACAGAGGGAGGTTGG + Intronic
1189225210 X:39407050-39407072 CTGTGAATTCAGAGATTAGTAGG - Intergenic
1194979097 X:100422489-100422511 CTGTGTATTCACATGGTAGAAGG - Intergenic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic
1198885736 X:141334109-141334131 ATGTGGCTTCAGATGGAAGTGGG + Intergenic
1198911825 X:141623511-141623533 CTGTGTCTTCACATGGAAGGTGG - Intronic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic
1200945186 Y:8828452-8828474 CTTTTTATTCAGAAGCAAGTCGG + Intergenic
1201961107 Y:19681691-19681713 CTGTGTATCCATGGAGAAGTTGG + Intergenic