ID: 1090217928

View in Genome Browser
Species Human (GRCh38)
Location 11:124987221-124987243
Sequence GGCTTCTAGAAAATAATCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090217928_1090217931 -7 Left 1090217928 11:124987221-124987243 CCCAGGATTATTTTCTAGAAGCC 0: 1
1: 0
2: 0
3: 11
4: 183
Right 1090217931 11:124987237-124987259 AGAAGCCCAAGGTGATTTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1090217928_1090217934 2 Left 1090217928 11:124987221-124987243 CCCAGGATTATTTTCTAGAAGCC 0: 1
1: 0
2: 0
3: 11
4: 183
Right 1090217934 11:124987246-124987268 AGGTGATTTGCTGGAAACCCAGG 0: 1
1: 0
2: 2
3: 37
4: 418
1090217928_1090217936 15 Left 1090217928 11:124987221-124987243 CCCAGGATTATTTTCTAGAAGCC 0: 1
1: 0
2: 0
3: 11
4: 183
Right 1090217936 11:124987259-124987281 GAAACCCAGGGTGATTTGACAGG 0: 1
1: 0
2: 0
3: 11
4: 106
1090217928_1090217935 3 Left 1090217928 11:124987221-124987243 CCCAGGATTATTTTCTAGAAGCC 0: 1
1: 0
2: 0
3: 11
4: 183
Right 1090217935 11:124987247-124987269 GGTGATTTGCTGGAAACCCAGGG 0: 1
1: 0
2: 0
3: 27
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090217928 Original CRISPR GGCTTCTAGAAAATAATCCT GGG (reversed) Exonic
900778682 1:4602965-4602987 GCCATCTAGAAAATCATTCTCGG - Intergenic
901266947 1:7918319-7918341 GTATTCTAGATAATAATCTTTGG - Exonic
901742405 1:11350845-11350867 TGCTTCTGGAAAATACTGCTGGG + Intergenic
902032231 1:13431204-13431226 CACTTCTAGAAAATCATCCTTGG - Intergenic
903776689 1:25798482-25798504 GGCTTCTGGAAAATAAACAAAGG - Intergenic
904573807 1:31488781-31488803 GGCTCCTTTAAAATAAGCCTGGG - Intergenic
904869820 1:33609532-33609554 CGTTTCTGGAGAATAATCCTGGG + Intronic
906593170 1:47047405-47047427 AGCTTCCAGAAATTAATTCTGGG - Intronic
906919612 1:50049044-50049066 GACTTCTAGAAAACAATTCCAGG + Intronic
909291175 1:73885554-73885576 TGCTTTTACAAAATAGTCCTGGG + Intergenic
909969048 1:81957804-81957826 GGCATCTCTAAAATAATGCTTGG + Intronic
910027635 1:82677186-82677208 GGCTTCTAGATATCTATCCTAGG - Intergenic
915150335 1:153825768-153825790 TGGTTTTAAAAAATAATCCTGGG + Intronic
917837538 1:178953139-178953161 GGCCTCTGGAGAATACTCCTTGG - Intergenic
918000736 1:180492889-180492911 AGCTTCTAGTAACTGATCCTGGG + Intronic
918378114 1:183929323-183929345 ATCTACTAGAAAATAATCCTGGG - Intergenic
918478087 1:184947576-184947598 GGCTTTGACCAAATAATCCTGGG + Intronic
918992335 1:191713308-191713330 GTCTTTTAGAGAAGAATCCTAGG - Intergenic
921047298 1:211486544-211486566 GGATGTTAGAAAATAATCCATGG + Intronic
922215032 1:223513217-223513239 GACTTCTAGAAAATAATTTCAGG + Intergenic
922700993 1:227760586-227760608 GGCTCCTAGCACATAAGCCTCGG - Intronic
1064903585 10:20319428-20319450 GGCTTCTGGAAGATAATAGTTGG + Intergenic
1068585832 10:58797256-58797278 TACTCCTAGAAAATCATCCTGGG + Intronic
1069083463 10:64113278-64113300 GGCTTCAAGAAAAGCATCTTTGG - Intergenic
1069168415 10:65194018-65194040 GGCTTCATGAAAATAAGACTGGG + Intergenic
1074730536 10:116368660-116368682 GGCTTCTTGAAAAAAATAATTGG - Intronic
1075432024 10:122393354-122393376 TGCTTTTAAAAGATAATCCTTGG - Intronic
1075884801 10:125889924-125889946 GGCTTCTAGAAGATCATCTGTGG + Intronic
1076077440 10:127546150-127546172 GACTTCTTAAAAATAACCCTGGG - Intergenic
1076328810 10:129650147-129650169 GGCTTCTAGCGAATAATCCCTGG + Intronic
1077999900 11:7485329-7485351 GACTTCTGGAAAAGGATCCTGGG + Intergenic
1078210580 11:9266245-9266267 GGGCTCTAGAAAAAAATGCTCGG + Intergenic
1078896531 11:15601883-15601905 GGGAACTAGAAAACAATCCTGGG - Intergenic
1079619990 11:22542285-22542307 GGCTTCTTGAATAAAATCCAGGG - Intergenic
1083889211 11:65587625-65587647 GGCTTCTAGAAAGGAATCTAGGG - Intronic
1087576441 11:99995766-99995788 GGCTTCTAAAAATTAATTTTAGG + Intronic
1087642804 11:100773365-100773387 GGATTATAGCAAATACTCCTGGG + Intronic
1088068504 11:105752358-105752380 GGCTGCTAGAAAGTCATTCTTGG - Intronic
1088270917 11:108033525-108033547 GGCTTCTAGTAGATAATCTCTGG - Intronic
1088559875 11:111103363-111103385 AGCTTCTTGAGAAGAATCCTTGG + Intergenic
1088743975 11:112789186-112789208 GGCTTCTTAAAAACAATCGTGGG + Intergenic
1090217928 11:124987221-124987243 GGCTTCTAGAAAATAATCCTGGG - Exonic
1091349018 11:134878015-134878037 TGTTTCTCGAAAATAAACCTGGG - Intergenic
1094701970 12:32878684-32878706 GGCTTTTTGAAAATAAGACTTGG + Intronic
1095145806 12:38724619-38724641 GGCTTCTTGTAGATTATCCTAGG - Intronic
1095631107 12:44378579-44378601 GGTTTTCAGAAAATAATTCTTGG - Intronic
1097377605 12:58858448-58858470 GGCATCTAGACAATAAACCCAGG - Intergenic
1097524686 12:60716843-60716865 GTCATGTAGAAAATATTCCTAGG - Intergenic
1097754366 12:63392296-63392318 CGCTTCCAGAAAATAGTCATTGG + Intergenic
1098925948 12:76349401-76349423 GGGTTATATACAATAATCCTTGG - Intergenic
1099584273 12:84496458-84496480 AACTTCTAGAAGATAATCTTGGG - Intergenic
1099961541 12:89401665-89401687 GGCTTAAAGAAAATAACCTTTGG - Intergenic
1100189531 12:92176056-92176078 GGGTTATAGAAAAAAGTCCTTGG - Intergenic
1100447285 12:94672886-94672908 GAATACTAGAAAATAAACCTAGG - Intergenic
1101729978 12:107418935-107418957 GGATACTTGAAAAAAATCCTAGG - Intronic
1106687675 13:32078340-32078362 GGCTTCTAAAAATTGATTCTTGG + Intronic
1106821433 13:33468746-33468768 TGCTTCTAGAAAAGAATACATGG - Intergenic
1106987826 13:35376624-35376646 GCCTCCTAGAGAATATTCCTTGG - Intronic
1107332848 13:39320191-39320213 GGCTTCTAGGACATACCCCTGGG - Intergenic
1109861154 13:68201037-68201059 TGCTTCTAAAATATAATCGTGGG + Intergenic
1110138379 13:72097516-72097538 GGCTTTTAGCAAATTATTCTTGG + Intergenic
1110341615 13:74398332-74398354 TTCTTCTACAAAATAATACTGGG - Intergenic
1111722883 13:91969413-91969435 ATCTTCTAGAAAAAAATCATAGG + Intronic
1111884809 13:94006679-94006701 GGCGCCTAGAAAATAAAACTAGG - Intronic
1112664526 13:101554330-101554352 GGAGTCAAGACAATAATCCTTGG + Intronic
1113643024 13:111971828-111971850 GGCTTCTAGAAGGTTCTCCTGGG - Intergenic
1113978269 13:114248940-114248962 GGCTTCTACAAAATGGTCCCTGG - Intronic
1116470095 14:45276728-45276750 TGCTTCTTTAAAATAATCATAGG - Intergenic
1117858472 14:60062032-60062054 GGATTCTGACAAATAATCCTCGG + Intronic
1118625124 14:67651825-67651847 GGCTTCTAGTTACTTATCCTAGG - Intronic
1118707485 14:68493650-68493672 GGCTTCTATAAAATAGGTCTGGG - Intronic
1126830268 15:52595625-52595647 AGATTTTAAAAAATAATCCTTGG - Intronic
1127518827 15:59722888-59722910 GGCTTCTTGCAAGTACTCCTTGG + Intergenic
1128887356 15:71301064-71301086 GGCAATTAGAAAATAATCTTAGG - Intronic
1130627070 15:85526589-85526611 TGCTGCTAGAAAGTAATTCTTGG - Intronic
1131858105 15:96621124-96621146 GACTTAAATAAAATAATCCTTGG - Intergenic
1131940927 15:97563978-97564000 AGCTTTGAGAAAATAATACTGGG - Intergenic
1134854797 16:17509447-17509469 GGCTTCCAGAAAGTAATTCTTGG + Intergenic
1135573424 16:23566697-23566719 GACTTTTAAAAAATAATCCCAGG + Intronic
1135676801 16:24422253-24422275 GGCTCCTTGAGAATATTCCTGGG - Intergenic
1140192275 16:72828302-72828324 GCCTTCTAGAAAATAATAAGAGG - Intronic
1142065008 16:88057320-88057342 GCCTTCCAGAAGATAATTCTTGG - Intronic
1144429926 17:15181909-15181931 GGCTTCTGGAAAACAATTCACGG - Intergenic
1146093143 17:29902343-29902365 GGATTCTAGAAAACAATCTAAGG - Intronic
1147326150 17:39670559-39670581 AGCTTCTGGAAAAAAAGCCTAGG - Intergenic
1148009615 17:44466293-44466315 TGCTTTTAGAAAAGTATCCTGGG - Intronic
1150508310 17:65721640-65721662 GGCTTCTTGCAAATAAATCTTGG + Intronic
1150858081 17:68772452-68772474 GGCTTGTTGAAAATAAACTTTGG + Intergenic
1157839744 18:50945605-50945627 GGTTATTAAAAAATAATCCTTGG - Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161986762 19:7659557-7659579 GATTTTTAGAAAATAATTCTTGG + Intergenic
1164401432 19:27904928-27904950 GGGTTCTAGAAAATGCTTCTGGG - Intergenic
1168380190 19:55913795-55913817 GGCTTGCAGAAAAAAATTCTGGG - Intronic
927840335 2:26437664-26437686 CTCTTCTATAAAATAATGCTGGG - Intronic
933213104 2:79594227-79594249 GGGGTTTAGAAAAAAATCCTAGG - Intronic
934142602 2:89062406-89062428 GGCTTATAGAATACAATCATTGG + Intergenic
939951994 2:148486411-148486433 GGCTTTTTAAAAATAATCTTGGG + Intronic
941179375 2:162239806-162239828 GGCTTATAGAAAGAAATCATAGG - Intronic
941283567 2:163581789-163581811 GGGTGGTAGAAATTAATCCTAGG - Intergenic
942153440 2:173102586-173102608 TTCTTCAAGAAAATAATGCTTGG + Intronic
943329453 2:186541848-186541870 GCCTTCTCGCAAATAATCCTGGG + Intergenic
946971157 2:225093237-225093259 GGCATCTAGAGAATAAATCTGGG + Intergenic
947501842 2:230676553-230676575 GCCTTCTTGAAATTAATTCTGGG + Intergenic
947908215 2:233781821-233781843 AACTACTAGAAAATAATCATTGG - Intronic
947960708 2:234234551-234234573 TACTTCTAGAAATTTATCCTAGG + Intergenic
1168859366 20:1035026-1035048 GTCTTCAAGAAAAGAATCCAGGG - Intergenic
1169269600 20:4188832-4188854 GGCATCTAGAAAAGGGTCCTAGG + Intergenic
1171023374 20:21607318-21607340 GGTTTCTAAAAAACAATGCTAGG - Intergenic
1177113333 21:17055395-17055417 GAATTCTAAAAAAAAATCCTAGG - Intergenic
1179177854 21:39021769-39021791 GCCTTCAAAAAAATAATCCCAGG + Intergenic
1183090588 22:35519316-35519338 GGCTTCTCTGGAATAATCCTGGG + Intergenic
1184583394 22:45431589-45431611 GGATTGGAGAAAATATTCCTGGG - Intronic
949743072 3:7258719-7258741 GGATTGTGGAAAATATTCCTAGG - Intronic
950656386 3:14439634-14439656 GGCTGCTGCAAAATAACCCTGGG + Intronic
950767679 3:15285448-15285470 GGCTTCAGGAAATTAAGCCTGGG + Intronic
953374182 3:42414732-42414754 GGTTTCTAGAAAATAAAGCAAGG - Intergenic
956375829 3:68612709-68612731 TCCTTCTAGCAAATTATCCTTGG - Intergenic
956538854 3:70311294-70311316 GCCTTCTAGTAAATAATCACAGG + Intergenic
957222461 3:77401749-77401771 GGCTTCTTTAAAATAATAATTGG + Intronic
957637132 3:82800883-82800905 TGCTTCTGGAAATTACTCCTTGG - Intergenic
958049802 3:88331468-88331490 GGCATCTAGAAATTAGTCATGGG + Intergenic
959477377 3:106827490-106827512 GGCTTCTATAAAATAAAGATAGG - Intergenic
959913682 3:111793322-111793344 GGCTTGCAGAAAATACTGCTTGG + Intronic
960445168 3:117739460-117739482 TGCTTCTTGTATATAATCCTAGG + Intergenic
964535516 3:157716873-157716895 GGGTACTATAAAATAATCTTTGG - Intergenic
964657376 3:159082768-159082790 GGCTTTAAGAAAATGATTCTGGG + Intronic
965374317 3:167903429-167903451 GGATTCTGGAATATCATCCTTGG + Intergenic
965726221 3:171719415-171719437 GGCTGCTAGAAGATAGTTCTAGG - Intronic
966243843 3:177783934-177783956 GCATTCAAGAAAAAAATCCTTGG - Intergenic
966480802 3:180406186-180406208 GGCTTCTCTAATATAATCTTAGG + Intergenic
969890909 4:10259194-10259216 GGCTATGAGAAAATAAACCTTGG + Intergenic
970552070 4:17192197-17192219 TATTTCTAAAAAATAATCCTTGG - Intergenic
972710404 4:41589456-41589478 GGCTTTTAGAAGAGAAACCTGGG + Intronic
973196497 4:47448740-47448762 GGCATCTAGGATAGAATCCTGGG + Intergenic
973344959 4:49045225-49045247 AGCTTCTAATCAATAATCCTGGG + Intronic
974684340 4:65205876-65205898 GGCTTCTAGAATATTGTTCTAGG - Intergenic
975723262 4:77268551-77268573 TGCTTGTAAGAAATAATCCTGGG + Intronic
977897574 4:102381923-102381945 GGCTTCCACAAAATAATAGTGGG - Intronic
978706299 4:111716284-111716306 GGCCTGTAGAAAATAGTTCTTGG - Intergenic
979545065 4:121931292-121931314 AGCATCTAGAAAATAATTCAAGG + Intronic
981196937 4:141932172-141932194 GGCTTCTAAAAATTATTCCATGG + Intergenic
981813737 4:148805007-148805029 ATTTTCTAGAAAAAAATCCTTGG + Intergenic
982953346 4:161729016-161729038 TGCTTCCAGAAAGTAATCATGGG - Intronic
986140517 5:5025752-5025774 GGCTTCTAGGAATGAAGCCTTGG + Intergenic
986649796 5:9951876-9951898 CACTTCTAGAAATCAATCCTAGG + Intergenic
987775986 5:22367061-22367083 TACTTCTAGAAAATAATCGAAGG + Intronic
994668543 5:102737716-102737738 GGCTTCTAAAAAATCTTGCTTGG - Intergenic
994922597 5:106068392-106068414 GGCTTAGAGACAATGATCCTTGG - Intergenic
995653178 5:114395034-114395056 ACCTTCTAGAAAATAATCCAGGG - Intronic
996334368 5:122366873-122366895 TGCTTCTAAAAAATAATTCTAGG - Intronic
996551207 5:124732402-124732424 TACTTCTAGAAAATAATGCTAGG + Intronic
1003305557 6:4923946-4923968 GACTTCTAAAAAATGCTCCTTGG - Intronic
1005508684 6:26492870-26492892 GGAATCTAGAAAATGATTCTAGG + Intergenic
1009435346 6:63611282-63611304 TGCTTCTTTAAAATAACCCTTGG + Intergenic
1011174140 6:84541327-84541349 GGCTTATAGATAAAACTCCTGGG + Intergenic
1012003282 6:93681168-93681190 GGCTTCTAGAAAAGAAGTCTAGG - Intergenic
1012202843 6:96427088-96427110 GAAATCAAGAAAATAATCCTGGG - Intergenic
1014940179 6:127429046-127429068 GAGTCCTAGAAAATAAGCCTGGG + Intergenic
1015478776 6:133683465-133683487 GTGCTCTAGAAAAAAATCCTAGG - Intergenic
1016358473 6:143243134-143243156 TCCTTTTAGAAAAAAATCCTTGG + Intronic
1016562193 6:145408956-145408978 GGTTTCAACAAAATAATCTTGGG + Intergenic
1017240304 6:152160768-152160790 GGCTTCTCCAAAACAATACTGGG - Intronic
1017676403 6:156818800-156818822 GACTTAGAGAAAATAATGCTAGG + Intronic
1018043588 6:159946393-159946415 GGCTACGAGAAAATGAGCCTGGG + Intergenic
1020680528 7:11231623-11231645 GGCATTTAGACAATAATCCCTGG + Intergenic
1023670189 7:42568175-42568197 GGACTCTAGGAAATAATCCCAGG - Intergenic
1024008716 7:45248719-45248741 GGATTCTTGAATAAAATCCTAGG - Intergenic
1024922193 7:54570294-54570316 TGCTTCTAGAAAATTTGCCTAGG + Exonic
1027298647 7:76805752-76805774 GTCTTCTGTAAAATAATTCTGGG - Intergenic
1027857478 7:83531040-83531062 TGTTTCTTAAAAATAATCCTTGG - Intronic
1028353766 7:89881635-89881657 TGCTTTTTGAAAATAATTCTCGG + Intergenic
1028878691 7:95853751-95853773 GGCTGCAATAAAATAATCGTAGG - Intronic
1032534550 7:132651429-132651451 GTGTTCTAGATAATAATCCTTGG - Intronic
1033849061 7:145472209-145472231 GACTTGTTGAAAATAATCATGGG - Intergenic
1035959610 8:4122710-4122732 TACTTCTAGGAAAAAATCCTGGG - Intronic
1038607399 8:29022117-29022139 TACTTCTAGAAAATTATCTTAGG + Intronic
1039563106 8:38528843-38528865 GGGTTCTTGAAAATCATCTTTGG + Intergenic
1044500551 8:92950081-92950103 GGCTTCTACAAAAGTATCTTTGG + Intronic
1044919522 8:97154112-97154134 GGAATATAGAAAATAATACTAGG - Intergenic
1046001342 8:108424227-108424249 TATTTCTAGAAAATAATCCATGG + Intronic
1046259258 8:111745036-111745058 CACTTCTAGAAATTAATGCTAGG + Intergenic
1047387118 8:124420303-124420325 AGTTTCTGTAAAATAATCCTTGG - Intergenic
1049169194 8:141148100-141148122 GGGTTCTAGAAAATATGGCTGGG - Intronic
1052232546 9:26171803-26171825 AGATTTTAGAAAAAAATCCTGGG + Intergenic
1052598106 9:30587840-30587862 AGGTTCTAAAAAATAATCTTGGG - Intergenic
1055433966 9:76273603-76273625 TGCTTCTTGAAATTAATCATGGG + Intronic
1058081284 9:100703376-100703398 TTCTTCTAGAAAATAAGGCTAGG - Intergenic
1058413164 9:104756679-104756701 TACTTCTAGAAAATATGCCTGGG + Intronic
1203491878 Un_GL000224v1:114589-114611 GACTTCCACAAAATAATCATGGG - Intergenic
1203504502 Un_KI270741v1:56460-56482 GACTTCCACAAAATAATCATGGG - Intergenic
1192104050 X:68296076-68296098 GGCTTCGAGAAAAAAATACTGGG - Intronic
1193709813 X:84865616-84865638 GGCTACTATGAAATAGTCCTTGG + Intergenic
1196078766 X:111608169-111608191 CACTTCTAGAAATTTATCCTAGG + Intergenic
1196940885 X:120774653-120774675 GGCTGGCAGAAAATAATGCTTGG + Intergenic
1201747405 Y:17392764-17392786 GGCTTCAGGAAAAAAATCCCAGG + Intergenic