ID: 1090219989

View in Genome Browser
Species Human (GRCh38)
Location 11:125011691-125011713
Sequence CCCAATCCTGCAAATATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090219989 Original CRISPR CCCAATCCTGCAAATATTAG AGG (reversed) Intronic
901903339 1:12386518-12386540 CAGAATTCTGCATATATTAGAGG + Intronic
906340035 1:44971497-44971519 CTCAAGCCTCCAAGTATTAGAGG + Intronic
906755440 1:48310011-48310033 CACAGTCCTACAAATATGAGTGG + Intronic
911863648 1:102988344-102988366 CCCTATCCTCCAAATTTTTGTGG + Intronic
912190814 1:107338265-107338287 CCCAACCTTGCAAATGTTAGGGG - Intronic
913649470 1:120898255-120898277 TCCAAACCTGCAAGTATTAATGG - Intergenic
914077214 1:144365256-144365278 TCCAAACCTGCAAGTATTAATGG + Intergenic
914101964 1:144601249-144601271 TCCAAACCTGCAAGTATTAATGG - Intergenic
914171665 1:145230840-145230862 TCCAAACCTGCAAGTATTAATGG + Intergenic
914296939 1:146335952-146335974 TCCAAACCTGCAAGTATTAATGG + Intergenic
914526773 1:148474802-148474824 TCCAAACCTGCAAGTATTAATGG + Intergenic
914639628 1:149592333-149592355 TCCAAACCTGCAAGTATTAATGG - Intergenic
918797379 1:188918849-188918871 TACAATCATGCAAATATTAAGGG - Intergenic
920542793 1:206792073-206792095 CCCCATCCTGGTAATATTTGTGG + Intergenic
920647522 1:207814397-207814419 CCCAATTCTGGAAACATCAGAGG + Intergenic
921469212 1:215528681-215528703 ACCAATCCTACAAATTATAGTGG - Intergenic
1064893915 10:20211859-20211881 CCAATGTCTGCAAATATTAGGGG + Intronic
1066695261 10:38071686-38071708 CACAATTGTGGAAATATTAGGGG + Intergenic
1069723544 10:70563940-70563962 CCCAATCCTCCAAGGATCAGAGG - Intronic
1075151666 10:119938307-119938329 CCCATCCCTGCAAATTTTGGGGG - Intronic
1075290283 10:121223774-121223796 CCTAATAATGCAAAGATTAGTGG + Intergenic
1081523469 11:43906056-43906078 CTGAATTCTGCAAATGTTAGGGG + Intronic
1082187719 11:49204817-49204839 GCGAATCCTGCAATCATTAGAGG + Intronic
1086615016 11:88806036-88806058 CCCAATTCTGCATCTACTAGTGG + Intronic
1087379029 11:97381026-97381048 ACCAATCCTGAAAATAATAAAGG - Intergenic
1087502881 11:98981508-98981530 CCCAATCTGGCAAATATATGGGG - Intergenic
1088711957 11:112516327-112516349 CCCACTCCAGAAAAAATTAGTGG + Intergenic
1090219989 11:125011691-125011713 CCCAATCCTGCAAATATTAGAGG - Intronic
1091188738 11:133671343-133671365 CTCAAGACTGCAAATATTTGTGG - Intergenic
1093857769 12:24126698-24126720 CCAAATCCTGCAAATGTTTACGG + Intergenic
1100219047 12:92484054-92484076 ACCATTCCTTCAAATAATAGAGG - Intergenic
1101470723 12:104994462-104994484 CCACATCCTGCAAAAAGTAGTGG - Exonic
1119291429 14:73498338-73498360 CCCAAAGCTGCAGAGATTAGAGG + Exonic
1119838276 14:77770713-77770735 GCCAAGCCTCCATATATTAGTGG + Intergenic
1123815320 15:23972330-23972352 ACCTATCCTGCAAAAATTAGGGG - Intergenic
1124944956 15:34256462-34256484 CAGAATCCTCCAGATATTAGTGG - Intronic
1125405306 15:39346991-39347013 GCCAAACCTGCAAATATGAAGGG - Intergenic
1127621313 15:60737341-60737363 CACCATCCTGCAATTACTAGGGG - Intronic
1135514253 16:23116634-23116656 CCCCAGCCAGCAAATATTAGGGG - Intronic
1135865694 16:26099826-26099848 CCCACACCTGCACATATCAGTGG + Intronic
1136702476 16:32156765-32156787 CGGACTGCTGCAAATATTAGTGG - Intergenic
1136765191 16:32770723-32770745 CGGACTGCTGCAAATATTAGTGG + Intergenic
1136802908 16:33099661-33099683 CGGACTGCTGCAAATATTAGTGG - Intergenic
1139509317 16:67417466-67417488 CCCAAACCTGAAAATCTTTGTGG - Intergenic
1203067580 16_KI270728v1_random:1032956-1032978 CGGACTGCTGCAAATATTAGTGG + Intergenic
1144805032 17:17959431-17959453 CCACAACCTGCAAAAATTAGAGG + Intronic
1147403834 17:40196627-40196649 CCCAATCCTACTAAGATTATAGG + Intergenic
1148912088 17:50948286-50948308 CCCCCTCCTGCAAATATTGGGGG + Intergenic
1149015547 17:51904736-51904758 ACCAAGCCTGCAAATAATAGAGG - Intronic
1150220000 17:63490844-63490866 CCCAGTCCTGCTAATCATAGTGG - Intronic
1150459228 17:65333340-65333362 CCCAATCTGGCAAATCTTACAGG + Intergenic
1150819494 17:68423834-68423856 CCCAATTCTGTAACTATAAGAGG + Intronic
1151054169 17:71012593-71012615 GTCAATCATGCAAATGTTAGGGG - Intergenic
1151249448 17:72822462-72822484 CCCAGCTCTGCAAATATTAGGGG + Intronic
1158420175 18:57286319-57286341 CCCAATTCTGCCATTGTTAGTGG - Intergenic
1162678310 19:12317728-12317750 CACGCTCCTGCAAATATTAGGGG + Exonic
1168700394 19:58435362-58435384 CCCTATCCTGCCAATAGTAATGG - Intronic
930340495 2:50107993-50108015 CCTGATCCTTCAAATGTTAGTGG - Intronic
940473015 2:154123390-154123412 CCCCATCCTGCAAATATTTGAGG - Intronic
945530511 2:210948293-210948315 CCCATTCATGCATAGATTAGAGG - Intergenic
947330457 2:229024270-229024292 TTCAATCCTGGTAATATTAGGGG - Exonic
1169690451 20:8325072-8325094 CCTACTCCTGCGAATAGTAGGGG - Intronic
1173351771 20:42252151-42252173 CCCTATCGTGCAAAGATTTGTGG - Intronic
1174670963 20:52307371-52307393 CCCATTTTTGCAAAGATTAGTGG + Intergenic
1177068161 21:16465672-16465694 ATGAATCCTTCAAATATTAGTGG - Intergenic
1177626602 21:23670307-23670329 CCCAATCATGCAGGTCTTAGAGG + Intergenic
1178697981 21:34810472-34810494 CCAAATCCTGAAAATGTTTGGGG - Intronic
1184131782 22:42520831-42520853 CCTACTACTGCAAATATTTGTGG + Intergenic
949551596 3:5116353-5116375 CCAAATCCTGCAAGGATTACAGG + Intergenic
957738247 3:84229540-84229562 CCCAATCTTGCATATAATTGCGG - Intergenic
978327247 4:107573483-107573505 CTAGATCCTGCAAATATTAGGGG - Intergenic
983089906 4:163490748-163490770 TCCATTCATGTAAATATTAGAGG - Intergenic
984341437 4:178461881-178461903 TCAAACCCTGCAAATATTGGAGG + Intergenic
985131663 4:186744805-186744827 CCCAATTCTGAAAATCTGAGTGG - Intergenic
988621741 5:32830147-32830169 TCCAATCCTGCACATATCTGGGG - Intergenic
989506423 5:42231214-42231236 CCCAATCCTGAGAGTAGTAGGGG + Intergenic
989980755 5:50641551-50641573 CCCAAACCTACAAGTATTAATGG - Intergenic
991932362 5:71766281-71766303 CCAGGTCCTGTAAATATTAGGGG - Intergenic
992936895 5:81717111-81717133 CCCAATCCTGTACATATTGCTGG + Intronic
994113058 5:96030361-96030383 ACCAATCCTACAAATGATAGGGG + Intergenic
994630057 5:102274360-102274382 CACAGACCTGCCAATATTAGTGG - Intronic
1000275713 5:159733086-159733108 CACAGTCCTGCAAAGAATAGAGG - Intergenic
1001563594 5:172685802-172685824 CCCAATTCTGCAACTTTTACTGG - Intronic
1003598148 6:7493307-7493329 CCCAACCCAGTACATATTAGGGG - Intergenic
1003665025 6:8102594-8102616 CCCACTCCTGCAAACTTCAGCGG + Intergenic
1004066393 6:12248963-12248985 TCCAAACTTGCAAAAATTAGAGG - Intergenic
1007293455 6:40803828-40803850 CCCCATCTTCCTAATATTAGAGG + Intergenic
1010417809 6:75634122-75634144 CCCAATCCTACCAATAATGGTGG - Intronic
1011930413 6:92703777-92703799 CTCCATGATGCAAATATTAGAGG - Intergenic
1014057840 6:117037183-117037205 CCCAGACTTGCAAATATTCGAGG + Intergenic
1014582465 6:123155709-123155731 TCCACTCATGCAAATAGTAGAGG + Intergenic
1014682094 6:124443572-124443594 CCCAAACCTGCAAATTATAGGGG + Intronic
1015095736 6:129413063-129413085 ACAAATACTGCAAATCTTAGGGG + Intronic
1016253468 6:142074729-142074751 CACAATCATCCAAATATTCGAGG + Intronic
1017686460 6:156918317-156918339 GCCAATCCTGCAGATTTTGGGGG + Intronic
1020191815 7:6005881-6005903 CCCAAACTTACCAATATTAGTGG + Exonic
1026745646 7:73009572-73009594 CCCAAACTTACCAATATTAGTGG - Intergenic
1026749300 7:73037514-73037536 CCCAAACTTACCAATATTAGTGG - Intergenic
1026752948 7:73065659-73065681 CCCAAACTTACCAATATTAGTGG - Intergenic
1026756598 7:73093785-73093807 CCCAAACTTACCAATATTAGTGG - Intergenic
1027031752 7:74894246-74894268 CCCAAACTTACCAATATTAGTGG - Intergenic
1027090807 7:75299643-75299665 CCCAAACTTACCAATATTAGTGG + Intergenic
1027094452 7:75327613-75327635 CCCAAACTTACCAATATTAGTGG + Intergenic
1027098095 7:75355538-75355560 CCCAAACTTACCAATATTAGCGG + Intergenic
1027120410 7:75514634-75514656 CCCAAACTTACCAATATTAGTGG + Intergenic
1027271488 7:76522066-76522088 CCCAAACTTACCAATATTAGTGG - Intergenic
1027321254 7:77012008-77012030 CCCAAACTTACCAATATTAGTGG - Intergenic
1029399201 7:100332431-100332453 CCCAAACTTACCAATATTAGTGG + Intergenic
1031200029 7:118670596-118670618 ACCAATTCTGCTAATATTAGGGG + Intergenic
1031330423 7:120457116-120457138 CCCAAGGCTGCACACATTAGGGG + Intronic
1033982208 7:147179400-147179422 CCCAGTCTTGCAAATATTGGAGG + Intronic
1034486181 7:151364685-151364707 CCCATTTCTACAAAAATTAGCGG - Intronic
1040517320 8:48145479-48145501 ACCAATCCTACAAACATTTGGGG - Intergenic
1044149683 8:88759950-88759972 CCCCATCCTGAAAATATCTGGGG + Intergenic
1046514436 8:115240276-115240298 CACATTCCTGTCAATATTAGAGG + Intergenic
1047038889 8:120970739-120970761 CTGAGTCCTGCAAATATTATAGG + Intergenic
1049701740 8:144017799-144017821 CACAGCCCTGCAAATGTTAGAGG + Intronic
1050103146 9:2139280-2139302 CCCAAACCTACAAGTCTTAGGGG - Intronic
1055548244 9:77405201-77405223 CCCATTACTGCCAATTTTAGAGG - Intronic
1055906847 9:81304825-81304847 CTCACTCCTGAAAATATTTGAGG + Intergenic
1058206185 9:102111296-102111318 ACCAATTCTACAAATAATAGAGG - Intergenic
1058811189 9:108641091-108641113 CCCAGTCCTGCAAAGATTTAGGG - Intergenic
1185584383 X:1234249-1234271 CCCAATCCTGAAGACATTAGCGG + Intergenic
1186532249 X:10309205-10309227 CCCAATCTTGCAAATCCTAATGG - Intergenic
1186712763 X:12217344-12217366 TCCAAGCCTGCCAATAATAGTGG + Intronic
1187406927 X:19012811-19012833 CCCCATCCTCCAAATTCTAGAGG + Intronic
1187940917 X:24380248-24380270 CCCAATCCTGTACCTATTATAGG + Intergenic
1189240779 X:39522735-39522757 CCCCATTCTGCTCATATTAGTGG - Intergenic
1191041555 X:56086757-56086779 CCCCTTCTTGCAAATACTAGTGG + Intergenic
1196580494 X:117373831-117373853 CACAATCCTGTAAATAATAGTGG + Intergenic