ID: 1090225203

View in Genome Browser
Species Human (GRCh38)
Location 11:125066890-125066912
Sequence CATCTCCAGTTGAAAACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090225203 Original CRISPR CATCTCCAGTTGAAAACCAG TGG Intronic
903505341 1:23830717-23830739 TAGCTCCAGTTGAAGCCCAGGGG - Intronic
910335081 1:86119179-86119201 CATCTCCAGTGAAAAACGAAAGG + Intronic
910447921 1:87317630-87317652 CATCCCCAGTTGAGAACCACGGG + Intergenic
911609875 1:99949066-99949088 AATCCCCAGTTGAAAACCTCTGG + Intergenic
911695136 1:100882181-100882203 CATCTCTAGTTGAAAACCCTTGG - Intronic
912436695 1:109667139-109667161 TACCTCCACTTGAAGACCAGTGG + Intronic
915324935 1:155076869-155076891 TATCTCAACTTCAAAACCAGAGG + Intergenic
915704871 1:157834247-157834269 TATCTCCATTTGAAAAACAAAGG + Intronic
916315200 1:163440937-163440959 CAGCTGAAGTTGAAAACCATTGG - Intergenic
917124697 1:171676681-171676703 CATCTCCGGTTGTGAACCACTGG + Intergenic
917518630 1:175729793-175729815 CATCTTCAGTAGAATTCCAGGGG - Intronic
919112520 1:193238555-193238577 CCATTCCAGTTGATAACCAGAGG - Intronic
919543530 1:198881446-198881468 CATCTCCAGTTAAAAATGAAGGG - Intergenic
919938409 1:202270093-202270115 TATCTCTATTTGGAAACCAGGGG - Intronic
919997557 1:202767316-202767338 CATTTTCAGTGGAAAACAAGTGG - Intronic
921721843 1:218481371-218481393 CATCTCTAGTTGCTAACTAGCGG + Intergenic
922095088 1:222436502-222436524 TCTCCCCAGTTGAAAACCACCGG + Intergenic
1065794223 10:29291557-29291579 CACATCCAGGTGAAAACCACAGG - Intronic
1067986599 10:51154250-51154272 CATCATCAGTTGAAAACCACTGG - Intronic
1068971834 10:62966990-62967012 CATCCCTAGTTGAGAACCACTGG - Intergenic
1072642044 10:97218998-97219020 CATGTACAGTTGAAAAACATGGG + Intronic
1073531853 10:104239582-104239604 ACTCCCCAGTTGAAAACCACTGG + Intronic
1078727734 11:13946637-13946659 CATCTCCAGTTGAGAACCCCAGG + Intergenic
1080904900 11:36533690-36533712 CATCCCCATTTAAAAAACAGAGG - Intronic
1081985501 11:47299911-47299933 CATTTCCAGTTGAATAAAAGTGG + Intronic
1082148735 11:48704862-48704884 TATCTTCAGATAAAAACCAGAGG - Intergenic
1084028806 11:66468655-66468677 CATCCCCATTTGCAAAACAGGGG - Intronic
1084292226 11:68180802-68180824 CCACTCCATTTAAAAACCAGAGG + Intronic
1085849104 11:80099144-80099166 CATCTCCAGTTTAAAATAAGAGG - Intergenic
1086137398 11:83455997-83456019 AATCACCAGCTGAAAAGCAGAGG + Intronic
1087646789 11:100817296-100817318 TATCTCCATTTGAGAACCACTGG + Intronic
1088416293 11:109592670-109592692 CACCACCAGTTGAAAACCCCTGG - Intergenic
1089665494 11:120015417-120015439 CACCTCCAGCTGAAAACCACTGG + Intergenic
1090225203 11:125066890-125066912 CATCTCCAGTTGAAAACCAGTGG + Intronic
1090604053 11:128403144-128403166 CATCTCCTGTTGAAAATTATGGG - Intergenic
1092632510 12:10397545-10397567 CACTTTCAGTTGAAAAGCAGTGG - Intronic
1094857059 12:34408504-34408526 CATCTTCAGATGAAAACTAGAGG - Intergenic
1098856437 12:75657771-75657793 GATTTCCTTTTGAAAACCAGAGG - Intergenic
1099801857 12:87467109-87467131 TATCTCCAGTTTGAAAACAGAGG - Intergenic
1100694038 12:97071654-97071676 CTGCTCCAGTTGAAAAACACTGG + Intergenic
1101377391 12:104182959-104182981 CATTTCCAGTTGCAAACAACAGG - Intergenic
1102264185 12:111467755-111467777 CATGTCCATTTGAAGAGCAGTGG - Intronic
1102687581 12:114736457-114736479 CTTCTCCTGCTGGAAACCAGAGG - Intergenic
1102706723 12:114887526-114887548 CATCCCCAGTTGAGAACCACTGG - Intergenic
1102791200 12:115647272-115647294 CAGTTCAAGTTGAAAACCTGGGG + Intergenic
1103462351 12:121115033-121115055 CATCCCTAGTTGAGAACCACTGG + Intergenic
1106944226 13:34808400-34808422 AATCTCTATTTGAAAACCACGGG - Intergenic
1107395046 13:40006622-40006644 CATCTCCCTTTGGAAACCACAGG - Intergenic
1107583693 13:41820491-41820513 CATCATCATTTGAAAACAAGGGG + Intronic
1108310744 13:49187566-49187588 CATTTTCAGTGGAAAACAAGTGG - Intronic
1108616285 13:52136125-52136147 CACCTCCAGTTTAACAGCAGAGG - Exonic
1109777802 13:67065654-67065676 CTTCTTCATTTCAAAACCAGTGG - Intronic
1110237766 13:73234313-73234335 CATCTCCTGTTGAGAACTACTGG - Intergenic
1111680827 13:91439163-91439185 CATCTCTGGTTGAGAACCACTGG - Intronic
1111869669 13:93814878-93814900 CATCAGCAGTTCAAAAACAGAGG + Intronic
1112187019 13:97137250-97137272 CATCTCCAATTGTAATCCACAGG - Intergenic
1115663501 14:35521667-35521689 TGTCTCCATTTGAAAAACAGAGG + Intergenic
1116971340 14:51069296-51069318 CACCTCCAGATGAGAACCAGTGG - Intronic
1117442587 14:55773806-55773828 CAACTCCAGAGCAAAACCAGAGG - Intergenic
1117446392 14:55807301-55807323 CATCTCTCATTGAAAAACAGTGG + Intergenic
1119498481 14:75101908-75101930 CATCTCCAACAGAAAACAAGAGG + Intronic
1121883570 14:97522544-97522566 CTCCTCCAGATGAAAACTAGTGG - Intergenic
1123898957 15:24857025-24857047 CATCTCTGGTTGAAAAGGAGAGG + Intronic
1124591500 15:31057751-31057773 CATCTCCAGTTGTAATCCCCAGG + Intronic
1127811761 15:62571140-62571162 CATCTACATTTTAAAACCACTGG - Intronic
1128129087 15:65213680-65213702 CATCTCCCGTTGCACACCTGAGG - Intergenic
1129255133 15:74330104-74330126 CATCTACACTTGAAAGTCAGTGG - Intronic
1130536597 15:84789982-84790004 CAGCCCCAGGAGAAAACCAGGGG - Intronic
1130835869 15:87649452-87649474 CACCCCCAGTTGAGAACCACTGG - Intergenic
1131421727 15:92311985-92312007 CATCTCCAGTTAAGAACCACTGG - Intergenic
1133972690 16:10578951-10578973 CATCTCCAGGTGGAAAGAAGGGG + Intronic
1134372795 16:13641117-13641139 CACCCCCAGTTGAGAACCATTGG - Intergenic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1136741125 16:32528227-32528249 TATCTTCAGTTAAAAACTAGAGG - Intergenic
1138138487 16:54545606-54545628 CATCTTGAGTTTAAAAGCAGTGG - Intergenic
1138494462 16:57399206-57399228 CAGGTCCAGGTGAGAACCAGGGG - Intergenic
1138589956 16:57994207-57994229 CAGCCCCAGTGGAAAACCAAGGG - Intergenic
1141359552 16:83382800-83382822 CAGCTCCAGATGAGAACCATTGG - Intronic
1203028478 16_KI270728v1_random:547007-547029 TATCTTCAGTTAAAAACTAGAGG + Intergenic
1203043243 16_KI270728v1_random:787424-787446 TATCTTCAGTTAAAAACTAGAGG - Intergenic
1142587711 17:984330-984352 CATCGCTAGCTGAACACCAGTGG - Intergenic
1144225883 17:13145638-13145660 CATCTCAAATTGTAATCCAGGGG + Intergenic
1147558026 17:41491906-41491928 CACCCCCAGTTGAGAACCATTGG + Intronic
1149247303 17:54725578-54725600 CCTATCTAGTTGAAAATCAGAGG + Intergenic
1153592446 18:6687726-6687748 CATCTCCATTTGAACACCAAAGG - Intergenic
1153642351 18:7167822-7167844 CTTTTCCAGGTGAGAACCAGGGG - Intergenic
1153996410 18:10445842-10445864 ACTCTTCATTTGAAAACCAGTGG - Intergenic
1157679278 18:49591193-49591215 CCTCTCCATTTGGAACCCAGTGG + Exonic
1158133047 18:54174276-54174298 CATGTCTAGTTGAGAACCACTGG + Intronic
1160073138 18:75645721-75645743 CACGTCCAGTTGAGAAGCAGAGG + Intergenic
1161548336 19:4895971-4895993 CAGCCACAGTTGAAAACCACTGG + Intronic
1162504979 19:11078250-11078272 CATCTCCAGATCAGAACCTGGGG + Intergenic
1162879103 19:13644725-13644747 CATCTCCGGTTGTGAACAAGGGG - Intergenic
1164409682 19:27990561-27990583 CATCCCCAGTGGAAAAGCAGGGG - Intergenic
1167811076 19:51830945-51830967 CATTTCCACTTGAAAACCTATGG + Intergenic
926839078 2:17058504-17058526 CACCTCCAGTTGACAACCAATGG - Intergenic
928017624 2:27673042-27673064 CATCTGCAGTAGAAATCCAGAGG - Intronic
928125859 2:28615314-28615336 TTTCTCCACTTGAAATCCAGTGG - Intronic
928556570 2:32432411-32432433 CATCTCAAGAAGAAAAACAGAGG + Intronic
929653719 2:43708130-43708152 CAGCTCCAGTTGAAGCCGAGGGG - Intronic
936864927 2:117066588-117066610 CATCCCCGTTTGAAAACCACTGG - Intergenic
939582836 2:143970876-143970898 AATCTCCACTTGGATACCAGAGG - Intronic
939633554 2:144553863-144553885 CATTTGCACTTGAAAATCAGAGG - Intergenic
939635399 2:144576002-144576024 TACCCCCAGTTGAAAACCACTGG - Intergenic
940052192 2:149476803-149476825 CATCGCCAGGTGCACACCAGTGG - Intergenic
942626904 2:177911146-177911168 CATCCCCAGTTCCAAATCAGTGG - Intronic
942980906 2:182080293-182080315 CATCCCCAAACGAAAACCAGGGG + Intronic
943571104 2:189576486-189576508 CATCTCTAGTTGAGAACTACTGG - Intronic
944184453 2:196931450-196931472 CATCAACAGGAGAAAACCAGTGG - Intergenic
944521910 2:200579098-200579120 CATCCTGAGTTGAAAACCACTGG + Intronic
944689053 2:202143048-202143070 CACCTCCAATTGACAACCACTGG + Intronic
947520206 2:230839743-230839765 CAACTGCATTCGAAAACCAGCGG + Intergenic
948551973 2:238778793-238778815 CATCTCCAGTTGGGAAGCTGGGG + Intergenic
1169047588 20:2547206-2547228 CATCTCCAATAGAAAAGCACTGG + Intronic
1169471475 20:5889448-5889470 TTTCTCCAGTTGAGAACCACTGG - Intergenic
1172675807 20:36670924-36670946 CCTCACCAGTTGAAAAACATGGG + Intronic
1173028376 20:39330947-39330969 CACCCCCAGTTGAGAACCATTGG - Intergenic
1173358682 20:42319862-42319884 TATCTCCAGCTCAAAAACAGTGG + Intronic
1173652974 20:44679130-44679152 CCCCTCCAGTAGAAACCCAGTGG - Intergenic
1174411975 20:50342257-50342279 CACCTCTAGCTGAGAACCAGAGG - Intergenic
1174712178 20:52718761-52718783 GACCTCCAGTTAAAAACCACTGG - Intergenic
1177038141 21:16070941-16070963 CATCTGCAGTAGAACACCATTGG - Intergenic
1180526079 22:16262449-16262471 CATCTTCAGTTGAAATCAAAAGG - Intergenic
1182220631 22:28755938-28755960 CATCCCCAGTTGAAAATCACTGG + Intronic
1183666616 22:39249875-39249897 CCTCTCCAGGTGAAGACCTGTGG - Intergenic
949773544 3:7605662-7605684 CATCCCCAGTTGAAATCTATTGG + Intronic
950713471 3:14830727-14830749 CATCCCCATTTGAAAAGCTGGGG - Intronic
950959338 3:17088633-17088655 TACCCCCAGTTGAAAACCACTGG - Intronic
952031878 3:29152689-29152711 CATCCCCAGTTGAGAATCACTGG + Intergenic
953504806 3:43474915-43474937 CATGTCTAGTTAAAAACCAAAGG - Intronic
953799551 3:46011827-46011849 CACATGCAGATGAAAACCAGAGG + Intergenic
955201104 3:56852986-56853008 AATCTCTAGTTGAAATTCAGGGG + Intronic
955210660 3:56937668-56937690 CATCTTCAGTTGAGCCCCAGAGG + Intronic
956707929 3:72015380-72015402 TATCTCCAGTTGAGAATCACTGG + Intergenic
958148881 3:89663296-89663318 CACCTTCAGATGAAGACCAGAGG - Intergenic
960454132 3:117849487-117849509 TATCACCACTTGAAAATCAGAGG + Intergenic
964692082 3:159461266-159461288 CATTTCCAATTGCCAACCAGGGG + Intronic
966227432 3:177612897-177612919 CATCTCCAGATGAAAACAGCTGG + Intergenic
967358781 3:188605870-188605892 CCTCTCTAGTTGAGAACCATTGG - Intronic
967753822 3:193145829-193145851 CATCTCCAGTTCATAAGCAAAGG - Intergenic
968963230 4:3756241-3756263 CACCCCCAGTTGCAAACCACTGG - Intergenic
969759951 4:9174396-9174418 TATCTCCTGGGGAAAACCAGGGG + Intronic
970061122 4:12035714-12035736 CAGCTCCAGTTTAGAACCACTGG - Intergenic
971046453 4:22810581-22810603 CAACTCCAGCTGAATATCAGTGG - Intergenic
972200595 4:36710017-36710039 CATCTCCAGTTGAAGAAAGGAGG - Intergenic
973563699 4:52162673-52162695 CAACCCCAGCTGAAAATCAGGGG - Intergenic
975288195 4:72645265-72645287 CACCTCCAGATGAGAACCACTGG + Intergenic
976625462 4:87176415-87176437 CATCCTCAGTTGAGAACCACTGG + Intronic
977041005 4:92018451-92018473 AATCCCCAGTTCAAAACCAATGG - Intergenic
977302327 4:95282004-95282026 CACCCCCAGTTGAGAACCACAGG + Intronic
978819046 4:112944304-112944326 CATTTCCAGTTAATAAGCAGAGG + Intronic
980272779 4:130608264-130608286 CATCTCATGTTGAAAGCCAGTGG - Intergenic
980469026 4:133226950-133226972 CATCTACAGTTGAAACTTAGAGG + Intergenic
980685928 4:136228331-136228353 CACCCCCAGTTGAACACCACTGG + Intergenic
981624311 4:146738526-146738548 GATCTGTGGTTGAAAACCAGAGG + Intronic
987317492 5:16737673-16737695 CACCTCCTCTTGAAAACCACTGG - Intronic
988414744 5:30931870-30931892 CAACCCCAGTTGAGAACCACTGG + Intergenic
988518983 5:31929505-31929527 CTTCCCCAGTTGAGAACCACTGG + Intronic
990206700 5:53437522-53437544 TATCTCCAGTTGAAAACTCTTGG - Intergenic
990297964 5:54421740-54421762 CATCCCCAGTTAAAAACCACTGG - Intergenic
991470830 5:66967319-66967341 CATCTCCAGCGGAACTCCAGGGG + Intronic
991632951 5:68675096-68675118 CATTTCCAGTTGAGAACCACTGG - Intergenic
991973604 5:72164415-72164437 CATCTTGAGTTGAAGAGCAGTGG + Intronic
992558526 5:77927637-77927659 CATCTCCAGGTCCAAAGCAGAGG - Intergenic
993332705 5:86619360-86619382 CATTTTCAGTGGAAAACAAGTGG + Exonic
995431257 5:112080433-112080455 CATCTCCACTTAAAATCAAGAGG + Intergenic
997618063 5:135266279-135266301 CATCTCCAGTTCACAACGGGAGG - Intronic
997657433 5:135565936-135565958 AATCTCCATTTGATAAACAGGGG + Intergenic
998874069 5:146581834-146581856 CATTTGGAGTTGAAAACCAATGG + Intronic
999821440 5:155232955-155232977 CACCTCCAGTTGAGGACCACTGG - Intergenic
1000294198 5:159898840-159898862 CAGCTACAATTGAAAACTAGTGG + Intergenic
1000399217 5:160807958-160807980 CATCTCAAGTAAAAGACCAGGGG - Intronic
1002411322 5:179079538-179079560 CATCTCTAGCTGAACATCAGAGG + Exonic
1002478645 5:179484802-179484824 CGTCTGCAGTGGAAAGCCAGAGG - Intergenic
1004773429 6:18813088-18813110 TATTACCAGTTGAAAATCAGTGG - Intergenic
1005333795 6:24773649-24773671 CATCCCCAGTTGAGAACCACTGG - Intergenic
1005573024 6:27165070-27165092 AATCTCCAATTGTAAACCACTGG - Intergenic
1006331480 6:33394181-33394203 CACCCCCAGTTGAGAACCACTGG + Intronic
1007221016 6:40278870-40278892 AATGTCCAGTTGAGAACCACAGG - Intergenic
1007247119 6:40470820-40470842 CACCTCCAGGGGAACACCAGGGG + Intronic
1010442787 6:75917713-75917735 CATCTTAAGTGGAAAATCAGTGG + Intronic
1010911927 6:81569243-81569265 CATCTCTGGTTGAAAACCACTGG - Intronic
1013853557 6:114543813-114543835 CACCTTCAATTGAAAACCACTGG - Intergenic
1014829703 6:126088343-126088365 CATCCAGAGTTGAAAACCACTGG - Intergenic
1016219792 6:141654366-141654388 CATCTTCCTATGAAAACCAGAGG - Intergenic
1016559078 6:145374206-145374228 CATCTTCAGTTGAAAGACAACGG - Intergenic
1016878015 6:148882710-148882732 CATCTCCAGTAAACAAACAGCGG - Intronic
1017629127 6:156379159-156379181 CAACCCCAGTTGAGAACCACTGG + Intergenic
1017811910 6:157989824-157989846 CTTCTCCAGCTCAAACCCAGGGG - Intronic
1018157739 6:161004161-161004183 AATATCCAGTTGAAAACCACTGG + Intronic
1019998309 7:4739624-4739646 CGTCTCCAGTAGAAAAACCGAGG + Intronic
1020366277 7:7384099-7384121 CCTCCCCAGTTCAACACCAGAGG + Intronic
1020991929 7:15208993-15209015 CATTTACATTTTAAAACCAGAGG + Intronic
1021566509 7:22022032-22022054 CTTTTCCAGATGAAATCCAGGGG - Intergenic
1022626577 7:32043019-32043041 CACCTCTAGTTGAGAACCACTGG - Intronic
1022748888 7:33202961-33202983 TAACTCCAGTGGAAAACAAGGGG + Intronic
1025490145 7:61106870-61106892 TATCTTCACATGAAAACCAGAGG + Intergenic
1025530927 7:61882281-61882303 TATCTTCAGTTAAAAACTAGAGG - Intergenic
1025587756 7:62813883-62813905 TATCTCCAGATAAAAACTAGAGG - Intergenic
1027728284 7:81835476-81835498 CACCTCCGGTTGAAATCCACTGG - Intergenic
1029667338 7:102004244-102004266 AATCTCAAGCTAAAAACCAGAGG - Intronic
1030580871 7:111353192-111353214 ACTCTCCAGGTGAAAGCCAGGGG - Intronic
1030684147 7:112466607-112466629 CATCCCCAGTTGATAATCACTGG + Intronic
1031420080 7:121541173-121541195 AATTCCCAGTTGAAAACCATTGG - Intergenic
1032227564 7:130045527-130045549 CATTTTCAGTGGAAAACAAGTGG + Intronic
1033013995 7:137652986-137653008 CATCTCCAGTTGAGGACAACAGG + Intronic
1033437224 7:141343922-141343944 GATCTCCTGTTGCAACCCAGAGG + Intronic
1034080351 7:148271454-148271476 CCACCCCAGTTGAAAACCACAGG + Intronic
1034988245 7:155530924-155530946 CATCCCCAGTTGAGAACCACTGG + Intronic
1035863802 8:3059633-3059655 CATCTCCTGATGGCAACCAGAGG - Intronic
1037985745 8:23289608-23289630 CATCTTCAGTTACACACCAGGGG - Intronic
1040021369 8:42744352-42744374 CATCTCCAGTTGAGAATAACTGG + Intergenic
1040116142 8:43622112-43622134 TATCCCCAGTTAAAAACTAGAGG + Intergenic
1040120516 8:43679713-43679735 TATCCCCAGTTAAAAACCAGAGG + Intergenic
1040364211 8:46698134-46698156 CATCTCAAATTGAAAGACAGAGG + Intergenic
1040553217 8:48455370-48455392 AAGCCCCAGTTGAAAACCACCGG + Intergenic
1047979845 8:130169769-130169791 CATCTCCATTTGTAAAACTGAGG + Intronic
1049630572 8:143653213-143653235 CATGTCCAGATGAAATTCAGAGG - Exonic
1055106949 9:72523037-72523059 TGTCTCCAGTTGAAAACCACTGG + Intronic
1055284255 9:74711647-74711669 TTTCTCAAGTTGAAAACCAAGGG + Intergenic
1056893955 9:90523400-90523422 CATCTCAGGTTTGAAACCAGAGG + Intergenic
1057338108 9:94173415-94173437 CATCTCTAGATGAAAACTGGTGG - Intergenic
1059135493 9:111802888-111802910 CACCTCCAATTGAGAACCACTGG - Intergenic
1059788529 9:117613887-117613909 CACCTCCAGTTGAGAACCACTGG - Intergenic
1060555618 9:124505877-124505899 TTTCTCCAGCTGAAAAACAGTGG - Intronic
1060775843 9:126373744-126373766 CTTCTCAAGTTTAAATCCAGCGG + Intronic
1061917327 9:133762093-133762115 CGTCTCCTGCTGAAAACCATCGG + Exonic
1186762937 X:12742154-12742176 GATTTCCAGTTGAGAACCACTGG - Intergenic
1186979305 X:14941862-14941884 GATCTCCAGTTGAGAATCACTGG - Intergenic
1188260719 X:28019955-28019977 AATCCCCAGTTGACAACCACTGG + Intergenic
1188618476 X:32190031-32190053 CATCCCTAGTTGAAAATCACTGG - Intronic
1189446998 X:41089083-41089105 CATTTGGAGTTGAAAACCACTGG + Intronic
1189986626 X:46559138-46559160 GATTTCCTGTTGAAATCCAGTGG - Intergenic
1190408121 X:50108019-50108041 CATTTCCATTTGAAAAGGAGCGG + Intergenic
1191789930 X:64958962-64958984 CATGCCCAGCTGAAAATCAGAGG - Intronic
1197286380 X:124599905-124599927 CAACTCCAGTTCAACACCACAGG - Intronic
1197494397 X:127159767-127159789 TATCTCCAATTGAAAACCATTGG + Intergenic
1198153947 X:133939245-133939267 CATCTCCAGTTGAAAGTTGGTGG - Intronic
1199322856 X:146461975-146461997 AATCTGAAGTTGAAAGCCAGTGG - Intergenic
1199935479 X:152569380-152569402 CATATCCAGTTGAGAATCAGTGG + Intergenic