ID: 1090225831

View in Genome Browser
Species Human (GRCh38)
Location 11:125071777-125071799
Sequence GCACCTGTGGTATCTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090225824_1090225831 29 Left 1090225824 11:125071725-125071747 CCAAAGAGGGTCTTGTCCTGTCT 0: 1
1: 0
2: 0
3: 3
4: 143
Right 1090225831 11:125071777-125071799 GCACCTGTGGTATCTGTTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 183
1090225829_1090225831 -7 Left 1090225829 11:125071761-125071783 CCTGGCTCAGGGCTCTGCACCTG 0: 1
1: 0
2: 8
3: 82
4: 787
Right 1090225831 11:125071777-125071799 GCACCTGTGGTATCTGTTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 183
1090225825_1090225831 13 Left 1090225825 11:125071741-125071763 CCTGTCTTGTGTGCTAAAGACCT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1090225831 11:125071777-125071799 GCACCTGTGGTATCTGTTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 183
1090225823_1090225831 30 Left 1090225823 11:125071724-125071746 CCCAAAGAGGGTCTTGTCCTGTC 0: 1
1: 0
2: 1
3: 17
4: 214
Right 1090225831 11:125071777-125071799 GCACCTGTGGTATCTGTTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090225831 Original CRISPR GCACCTGTGGTATCTGTTCC TGG Intronic
900212609 1:1463556-1463578 TCAGCTGAGGTCTCTGTTCCAGG + Intronic
900217970 1:1491831-1491853 TCAGCTGAGGTCTCTGTTCCAGG + Intronic
900225289 1:1530183-1530205 TCAGCTGAGGTCTCTGTTCCAGG + Intronic
900624441 1:3601776-3601798 GCACCTGCTGTACCTGCTCCAGG - Intronic
904401669 1:30260652-30260674 GAACCTGTGGTGTCTGTCTCAGG - Intergenic
905320231 1:37110948-37110970 GCACCTCAGGTATGTGGTCCTGG + Intergenic
907223996 1:52927809-52927831 GCTCCTGTGGGGGCTGTTCCTGG - Intronic
909282310 1:73770855-73770877 GCACTTGTGGTTCCTTTTCCAGG + Intergenic
912314665 1:108656963-108656985 CCACCTGTGCTTTGTGTTCCAGG + Intronic
914433956 1:147643550-147643572 GCACCTGTTGTTCCTGTGCCTGG - Exonic
917879787 1:179323142-179323164 TCAACTGTGGAATCTGTTCAGGG + Intronic
921502450 1:215922346-215922368 TTATCTTTGGTATCTGTTCCTGG + Intronic
921527738 1:216238911-216238933 GCCCCTGTGGTATATGATCTAGG + Intronic
1065711820 10:28525415-28525437 GCATTTCTGATATCTGTTCCTGG - Intergenic
1066341635 10:34540051-34540073 GCTCCTGAGGCTTCTGTTCCAGG - Intronic
1066350512 10:34632580-34632602 GCTCCTCTGGCATCTGTACCAGG + Intronic
1068682657 10:59837252-59837274 GCACCTGTGGTACCTATTGGAGG - Intronic
1070613778 10:77953200-77953222 GCACCTGTAGTGCCAGTTCCTGG + Intergenic
1073556355 10:104456029-104456051 GCACCTGTGGTCTCTGTCTGAGG - Intergenic
1075799876 10:125146985-125147007 GCAGCTGTGGTAACTGGACCAGG - Intronic
1077237559 11:1489024-1489046 GCTCCTGTGCTCTCTGTTCCTGG - Intronic
1077517151 11:3008891-3008913 GCACCTGTGGTCACTGTCACGGG + Intronic
1077721440 11:4633803-4633825 GCATATGTGGTATTTGTTCAGGG - Intergenic
1078604517 11:12763376-12763398 GCACTTGTGGTAGATGTTGCAGG + Intronic
1083288532 11:61676678-61676700 GCACCTCTGGTAGCTGGACCAGG + Intergenic
1083982643 11:66185869-66185891 ACACCTTGGGAATCTGTTCCTGG + Intronic
1084719775 11:70897234-70897256 GCCCGTGTGGTCTCTGGTCCTGG - Intronic
1085195983 11:74672048-74672070 GCACATGTGGACACTGTTCCAGG + Intergenic
1089823176 11:121246664-121246686 GGACCTGTGGTGCCTCTTCCAGG + Intergenic
1089876858 11:121730920-121730942 GCACCTGTAGTCTCAGTTACTGG - Intergenic
1090225831 11:125071777-125071799 GCACCTGTGGTATCTGTTCCTGG + Intronic
1093516116 12:19988866-19988888 GCACCTGTGGATCCTGTTGCTGG + Intergenic
1094393435 12:29978416-29978438 ATACCTGTGGTATGAGTTCCAGG + Intergenic
1095212536 12:39510336-39510358 GCACCTGTTGTAAGTTTTCCTGG - Intergenic
1096732756 12:53627484-53627506 GCACCTGTAGTAGCTATTCGGGG + Intergenic
1097076262 12:56397158-56397180 GGACTTGTGGTATCTCTTCCAGG - Intergenic
1098096312 12:66960505-66960527 GCACCAGTGGTATGTCTTCTTGG - Intergenic
1101260047 12:103019648-103019670 GCACCTGTGGTCTCAGCTACTGG + Intergenic
1102443926 12:112986765-112986787 GCACCTGTGCTTACTGTCCCAGG - Intronic
1106659574 13:31784578-31784600 GCACCTGTGGTCTCCCTTCTGGG + Intronic
1106946571 13:34834001-34834023 GCACCTGGGGCATCTGCTGCTGG - Intergenic
1106988855 13:35391146-35391168 GCACCTGTGATCCCTGCTCCTGG + Intronic
1108493603 13:51004131-51004153 CCACCTGTGCTATCCCTTCCCGG + Intergenic
1110914808 13:81008607-81008629 GCAGCTGTGGAGTCTGTACCCGG + Intergenic
1111232371 13:85360901-85360923 GCACCTGTGATATCAGCTACTGG + Intergenic
1111420522 13:88005136-88005158 GCACCTGAGGTGGCAGTTCCAGG + Intergenic
1113596847 13:111539724-111539746 GCACCTGTAGTTTCTCTCCCCGG + Intergenic
1113800971 13:113086048-113086070 GCTCCTGAGGGGTCTGTTCCAGG + Intronic
1121965412 14:98299074-98299096 GCACCTGAGGCACCTCTTCCTGG - Intergenic
1124016985 15:25885895-25885917 GCACCTGTGGTCTCAGCTGCTGG - Intergenic
1124809476 15:32920687-32920709 GCACCTGTGTTTTCAGTTTCTGG + Intronic
1125579647 15:40776214-40776236 GCTCCTGGCGTATCTGCTCCCGG + Exonic
1125752377 15:42037265-42037287 GAACTTGTGGTACCTTTTCCAGG + Intronic
1125835004 15:42741335-42741357 GCACCTGTGGTTTCTGAACTTGG + Exonic
1126574806 15:50186115-50186137 GCACCTGTGGTCCCAGTTACTGG + Intronic
1128690905 15:69724144-69724166 TGCCCTGTGATATCTGTTCCAGG - Intergenic
1129219154 15:74121441-74121463 GCACCTGAGCAATCTTTTCCTGG + Intronic
1129914152 15:79253793-79253815 GCAGATGTGGTCTCTGTTCACGG + Intergenic
1130395724 15:83499631-83499653 GCATGTGTGGTAACTGCTCCAGG + Intronic
1131784562 15:95898124-95898146 GTACCTGTAGTACCTGTACCAGG + Intergenic
1135416884 16:22275182-22275204 GCATCTGTGCTTTCTCTTCCTGG + Intronic
1135920623 16:26645892-26645914 GCACCTGCTGTATGTGGTCCAGG + Intergenic
1138407552 16:56809695-56809717 GCACATCCGGTATCTATTCCTGG + Intronic
1138542585 16:57697439-57697461 GCACCTGTGGTCTCAGCTACTGG + Intronic
1138911485 16:61405029-61405051 GCTCGTGTGGTCACTGTTCCTGG + Intergenic
1139782528 16:69363838-69363860 GCACCTGTGGTCCCAGTTACTGG + Intronic
1139947677 16:70652330-70652352 GCACCTGTAGTACCAGTTACTGG + Intronic
1140275078 16:73501813-73501835 CCACCTTTGGAAGCTGTTCCTGG + Intergenic
1142314487 16:89334972-89334994 GTACCTGTGGGATCTCCTCCTGG - Intronic
1142386446 16:89768150-89768172 GCACCTGTGGTCTCAGCTACTGG + Intronic
1142985047 17:3690456-3690478 GCACCTGTGAGATCTTTGCCTGG - Exonic
1144430359 17:15185619-15185641 GCAGCTGCGATATTTGTTCCTGG - Intergenic
1144503422 17:15808800-15808822 GCACCTGTGGCATCTTTAGCAGG - Intergenic
1145166468 17:20616513-20616535 GCACCTGTGGCATCTTTAGCAGG - Intergenic
1146330352 17:31921881-31921903 GCACCTGTGGTCCCAGTTACTGG - Intergenic
1147746395 17:42697400-42697422 GGAGCTGTGGCATATGTTCCTGG + Intronic
1148196530 17:45717254-45717276 GTAACTGTGTTACCTGTTCCAGG - Intergenic
1151869639 17:76827596-76827618 GCACCTGTGGTCTCAGCTACTGG - Intergenic
1152196611 17:78922261-78922283 GTCCCTGTGGGATTTGTTCCGGG + Intronic
1152913275 17:83017813-83017835 GCACATGTGGTACCTGATACAGG - Intronic
1152913285 17:83017893-83017915 GCACGTGTGGTACCTGATGCAGG - Intronic
1152913290 17:83017933-83017955 GCACGTGTGGTACCTGATACAGG - Intronic
1152913295 17:83017973-83017995 GCACGTGTGGTACCTGATACAGG - Intronic
1152913300 17:83018013-83018035 GCACGTGTGGTACCTGATACAGG - Intronic
1152913305 17:83018053-83018075 GCACGTGTGGTACCTGATACAGG - Intronic
1152913310 17:83018093-83018115 GCACGTGTGGTACCTGATACAGG - Intronic
1152913325 17:83018213-83018235 GCACGTGTGGTACCTGATACAGG - Intronic
1152913329 17:83018253-83018275 GCACGTGTGGTATCTGATACAGG - Intronic
1153677792 18:7470832-7470854 GTCCCTATGGTACCTGTTCCTGG + Intergenic
1154268547 18:12899570-12899592 GGATCTGTGGGCTCTGTTCCAGG + Intronic
1154450579 18:14472907-14472929 GCTGCTTTGGTTTCTGTTCCTGG - Intergenic
1157088128 18:44603465-44603487 GCACCTGTGGTATCAGCTATTGG - Intergenic
1160555892 18:79724927-79724949 GCACCTGTGTGGTCTGTTTCTGG + Intronic
1161560944 19:4972104-4972126 GCCCCAGGGGTCTCTGTTCCTGG + Intronic
1163227275 19:15972964-15972986 GCACCTGTGGTCCCAGTTACTGG + Intergenic
1166851431 19:45763345-45763367 GCAGCTGTGGAAGCGGTTCCAGG - Exonic
925982420 2:9187756-9187778 GCATCTCTGGTTTCTATTCCTGG - Intergenic
926159791 2:10479289-10479311 GCACCTGTGGAATATTCTCCTGG + Intergenic
928759759 2:34568434-34568456 TCACCTGTTATATCTGGTCCAGG - Intergenic
930516530 2:52414343-52414365 ACACCAGTGGTTTCTGTTCCAGG + Intergenic
931209952 2:60183291-60183313 GCTCCAGTGGTTTCTGTTCCAGG - Intergenic
932579263 2:72982999-72983021 GCACCTGTGGCAGCTTGTCCTGG - Intronic
933620799 2:84538892-84538914 GCATCTGTGTTTTCTGTTCTTGG - Intronic
933746559 2:85576047-85576069 GCACCTGTAGTTTCAGTTACTGG + Intronic
936225233 2:110643254-110643276 CCAGCAGTGGTTTCTGTTCCTGG - Intronic
937103531 2:119289868-119289890 GCCTCTGTGGTCTCTCTTCCTGG - Intergenic
940093943 2:149952499-149952521 GCAGCTCTGGCCTCTGTTCCAGG - Intergenic
944191292 2:197006976-197006998 GCACCTGTGGTCCCAGTTACTGG + Intronic
945494716 2:210496165-210496187 GCTTCTGTGGCATCTGTCCCTGG + Intronic
948306613 2:236952885-236952907 GCACCTGTGCAATCAGTGCCAGG - Intergenic
948847022 2:240688018-240688040 GCTCCTGTGGAAGCTGTTGCGGG + Intergenic
1173231186 20:41200061-41200083 GCAACTGTGGAAAATGTTCCTGG - Intronic
1174484451 20:50852320-50852342 GCCACTCTGGTCTCTGTTCCAGG - Intronic
1176305137 21:5119253-5119275 GCAGCTGTGTTATCTATTGCTGG - Intronic
1178501254 21:33127427-33127449 GCAGATGTGGTCTGTGTTCCTGG - Intergenic
1179851918 21:44142777-44142799 GCAGCTGTGTTATCTATTGCTGG + Intronic
1180139238 21:45881415-45881437 GCACCTGTGGTCTCAACTCCTGG - Intronic
1182756378 22:32682971-32682993 GCACCTGTGGCCACTTTTCCTGG + Intronic
1184160260 22:42693498-42693520 GGACCTGCGGGAGCTGTTCCGGG - Exonic
1184173873 22:42775017-42775039 GGACCTGTGGTACCTCTTCTGGG + Intergenic
1184869428 22:47225930-47225952 GGACCTGTGGCACCTTTTCCAGG - Intergenic
950080220 3:10216601-10216623 GCAGGTGTGGGATCTGGTCCTGG + Intronic
950230963 3:11275473-11275495 GCACCTGTAGTCCCAGTTCCTGG - Intronic
950548421 3:13652670-13652692 ACACCTGAGGTATCTGCTCCAGG + Intergenic
951987589 3:28638190-28638212 GCTCCTGTTGAATCTGTTGCAGG + Intergenic
953171929 3:40514643-40514665 GCACCTGTAGTACCAGCTCCTGG + Intronic
953491799 3:43359291-43359313 GCACCTGTGGGTTCTGCACCTGG + Intronic
954387522 3:50252078-50252100 CCACCTGTGCCCTCTGTTCCAGG + Exonic
954971293 3:54653772-54653794 GAAACTGTGGTTTCTCTTCCTGG + Intronic
954972264 3:54661147-54661169 GCACCTTGGAAATCTGTTCCAGG - Intronic
957616193 3:82530544-82530566 GAATCTGTGGAATATGTTCCAGG - Intergenic
961099419 3:124185946-124185968 AGACCTGTGGTATCTGCCCCTGG + Intronic
961988891 3:131166671-131166693 CCCCCTGTGGGATCTGTTGCAGG + Intronic
971520780 4:27547577-27547599 GCACCAGTGGGTTCTGTGCCTGG + Intergenic
972312410 4:37893112-37893134 GCAGCTGTGGTGCCTGCTCCAGG - Intronic
974794634 4:66732420-66732442 GCACCTGTAGTCCCAGTTCCTGG - Intergenic
975665793 4:76733591-76733613 CCACCTGTGGGATCTGATCTTGG + Intronic
977898538 4:102392583-102392605 GCTGCTGTGGCTTCTGTTCCAGG - Intronic
978352164 4:107831400-107831422 TCACCTGTGGAAGCTGCTCCAGG - Intronic
978666837 4:111194298-111194320 AAACCTGTGGTATGTGTTGCAGG + Intergenic
979130976 4:117044415-117044437 TTACCTGTTGTAACTGTTCCGGG - Intergenic
980457573 4:133065573-133065595 GCTCTAGTGGTTTCTGTTCCAGG - Intergenic
981475473 4:145182426-145182448 GCACCTGTTATATCTGACCCTGG + Intergenic
982752111 4:159174881-159174903 GCACCTGTGGTCCCAGTTACTGG - Intronic
984234182 4:177136436-177136458 GCACCTGTGGTTCCAGCTCCTGG + Intergenic
985664690 5:1175915-1175937 GCACCTCTGGGTTCTGTACCTGG + Intergenic
985876494 5:2602593-2602615 GCAGCTGTGCTAGCAGTTCCTGG - Intergenic
991457245 5:66817052-66817074 GCACCTGGAGTATCTTGTCCTGG + Intronic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
993749755 5:91651815-91651837 GGAGCTGTGGCTTCTGTTCCAGG + Intergenic
1001093946 5:168761863-168761885 GCACCTGTGGTCTCAGCTACCGG - Intronic
1002062624 5:176635118-176635140 GCACCTCAGGAGTCTGTTCCGGG - Intronic
1003584087 6:7370418-7370440 GCACCTGTGGTTTCAGCTACTGG - Intronic
1004426981 6:15513401-15513423 GCACCTGTGCTACCTGTCCATGG + Exonic
1010613582 6:77985494-77985516 GCACCTGTGGTAGTGGTTACTGG - Intergenic
1014261853 6:119227594-119227616 GCACCTGTGGTCTCAGCTACTGG - Intronic
1018692874 6:166363206-166363228 TCACCTGCAGTATCTGCTCCTGG + Intergenic
1019385827 7:755603-755625 GCACCTGTGGTTCCAGCTCCCGG + Intronic
1021724315 7:23534612-23534634 GCACCTGTGGTCTCAGCTACTGG - Intergenic
1023557841 7:41441734-41441756 GCCCTTGTGGTATCTGATACAGG + Intergenic
1023980434 7:45066703-45066725 GCACCCGTGGTAGCACTTCCTGG + Intronic
1026558131 7:71425751-71425773 GCACCTGTGGTATGTATTGTGGG + Intronic
1026905118 7:74058478-74058500 GCACCTGTGGTCTCAGCTCTTGG - Intronic
1027835107 7:83231697-83231719 ACACCAGTGGTTTCTGATCCAGG - Intergenic
1031743722 7:125468149-125468171 GGACTTGTGGTGTCTCTTCCAGG - Intergenic
1032322220 7:130895825-130895847 CCAGCTGGGCTATCTGTTCCTGG + Intergenic
1033546025 7:142400764-142400786 GCCCATGTGGTCTCTGCTCCTGG + Intergenic
1034026235 7:147707812-147707834 CCACCTGTGGTATGTGTACGTGG + Intronic
1035441660 7:158906986-158907008 GCACCTGTGGTCCCAGCTCCTGG + Intronic
1035543318 8:459101-459123 GACCCTGTGGTCCCTGTTCCTGG + Intronic
1038084122 8:24174615-24174637 ACCCCTTTGGTACCTGTTCCTGG - Intergenic
1038953266 8:32439901-32439923 GCACCTGTGGTCTCAGCTACTGG - Intronic
1040829915 8:51664906-51664928 GCACATGTGGTTCCTCTTCCTGG + Intronic
1043568112 8:81570840-81570862 GGACCTGTGGTACCTTTTCTAGG - Intergenic
1045976309 8:108133657-108133679 GCACCTGAGGTCTCTGTTTCTGG - Intergenic
1046290097 8:112147978-112148000 TCACCTGTGGCATCTTTTCTGGG - Intergenic
1047135815 8:122077009-122077031 GCACCTGTCGTATTTATTGCGGG - Intergenic
1048681028 8:136842207-136842229 GCACCTGTGCCATCTGTCCTTGG + Intergenic
1049557987 8:143293008-143293030 GCACCTGTGGGCTCTCCTCCTGG - Exonic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1052552239 9:29967009-29967031 GGTTCTGTGGCATCTGTTCCAGG - Intergenic
1059387927 9:113979618-113979640 GCACCTGTAGCCTCTGATCCAGG - Intronic
1061363468 9:130158099-130158121 CCACCTTTGGTCTCTGTTGCAGG + Intergenic
1185664513 X:1754775-1754797 GCACATGTGGTCTCTGTGGCCGG + Intergenic
1188429731 X:30092786-30092808 GCACCTGTGGTCTCTTCTCTTGG + Intergenic
1189011031 X:37045852-37045874 GCCCCTGTGCTTTGTGTTCCTGG - Intergenic
1189035371 X:37489693-37489715 GCCCCTGTGCTTTGTGTTCCTGG + Intronic
1189889526 X:45584712-45584734 GAACCTGAGATATCAGTTCCTGG - Intergenic
1191820313 X:65299434-65299456 GCACAAGTGGTATTTATTCCAGG + Intergenic
1192025182 X:67442561-67442583 GCACGTGTGGTACATTTTCCTGG - Intergenic
1197506743 X:127314702-127314724 GCACATGTGGTATCTGGTGAGGG - Intergenic