ID: 1090225939

View in Genome Browser
Species Human (GRCh38)
Location 11:125072411-125072433
Sequence ACAAGGTCTTTGAGGGTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090225933_1090225939 22 Left 1090225933 11:125072366-125072388 CCGGTGGGGGGGAGGTGGGATTC 0: 1
1: 0
2: 1
3: 17
4: 203
Right 1090225939 11:125072411-125072433 ACAAGGTCTTTGAGGGTCATGGG 0: 1
1: 0
2: 0
3: 10
4: 134
1090225930_1090225939 29 Left 1090225930 11:125072359-125072381 CCAGTATCCGGTGGGGGGGAGGT 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1090225939 11:125072411-125072433 ACAAGGTCTTTGAGGGTCATGGG 0: 1
1: 0
2: 0
3: 10
4: 134
1090225935_1090225939 -10 Left 1090225935 11:125072398-125072420 CCATCTCTTGCTAACAAGGTCTT 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1090225939 11:125072411-125072433 ACAAGGTCTTTGAGGGTCATGGG 0: 1
1: 0
2: 0
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090225939 Original CRISPR ACAAGGTCTTTGAGGGTCAT GGG Intronic
908002996 1:59699507-59699529 AAAAAGTATTTGTGGGTCATTGG + Intronic
909703426 1:78552938-78552960 ACAAGGTCTTTGCAGGGGATGGG - Intergenic
912856866 1:113177491-113177513 AAAATGTCTATGGGGGTCATGGG - Intergenic
915466558 1:156101843-156101865 ACAAGGACTTGGGGGCTCATTGG + Intronic
915930803 1:160059746-160059768 ACAGGGGCTCTGAGAGTCATTGG + Intronic
916060856 1:161097921-161097943 ACAATGCCTTTGAGGGTCAGGGG + Intergenic
917667467 1:177239197-177239219 ACAGGGTCTTTGAGGGAAATGGG - Intronic
921503762 1:215940676-215940698 AGAAGGTCTTAGTGGTTCATAGG - Intronic
924641131 1:245834791-245834813 ACAAGGTCTTTTAGGGTATGGGG + Intronic
1063676532 10:8145497-8145519 AGAAGTTCTTTGAGGATAATAGG - Intergenic
1064555745 10:16545690-16545712 AGAAGATCTTTGAAGGTCTTTGG - Intergenic
1065851560 10:29794391-29794413 ACCATGACTGTGAGGGTCATAGG - Intergenic
1067415020 10:46096266-46096288 ACAAGGTCTTAGAGCATCAGTGG - Intergenic
1067435068 10:46270846-46270868 ACAAGGTCTTAGAGCATCAGTGG - Intergenic
1069228135 10:65969747-65969769 ACAAAGTCTTTGAGAGATATGGG + Intronic
1076606900 10:131695147-131695169 ACAAGCCCTTTGCTGGTCATTGG + Intergenic
1077405859 11:2382232-2382254 ACAAGGTCTTTGAGGGCTGCGGG + Intronic
1078415656 11:11162650-11162672 ACAGGGTCACTGAGGGTCCTGGG + Intergenic
1081982278 11:47275211-47275233 AATTGGTCTTTGAGGGGCATAGG + Intronic
1085168347 11:74425034-74425056 AAAAGGCCTTAGAGGATCATAGG + Intergenic
1086252713 11:84836492-84836514 ACAAGGGCTTTGATGTCCATGGG - Intronic
1087318460 11:96632164-96632186 ACAAGGGTTTTGAGGGTGTTTGG + Intergenic
1088140855 11:106614286-106614308 ACAAGGTGGTTGATCGTCATGGG + Intergenic
1090081448 11:123615869-123615891 ACAAGGTCTAGGACGGTCCTGGG + Intronic
1090225939 11:125072411-125072433 ACAAGGTCTTTGAGGGTCATGGG + Intronic
1093615471 12:21217584-21217606 ACAAGTTCTTTTAGGATCCTAGG - Intronic
1093773775 12:23048469-23048491 ACAGGCTCTTAGAGGGTCAGCGG + Intergenic
1094475017 12:30834087-30834109 ACTGGGACTTTGAGAGTCATAGG + Intergenic
1099182918 12:79488262-79488284 TTAAGGTCTTTAAGGGCCATAGG - Intergenic
1099672121 12:85707530-85707552 AGAAAATCTTTGAGGATCATTGG + Intergenic
1101352092 12:103939864-103939886 AGATGGTCTTTGAGAGTAATTGG + Intronic
1108322056 13:49299354-49299376 ACAAGGTCTGAGGGGGTGATGGG - Intergenic
1109532740 13:63672867-63672889 TTAAGGTCTTTGAAGATCATTGG + Intergenic
1110152866 13:72276092-72276114 ACATGGTCTTAGAGGATAATAGG + Intergenic
1116472945 14:45306399-45306421 CAGAGGTCTATGAGGGTCATGGG + Intergenic
1117369528 14:55063541-55063563 ACAAAGTCTTTGGGGATCTTTGG - Intronic
1118407175 14:65436681-65436703 ACAAGGTCTTTGACAAGCATTGG + Intronic
1119651056 14:76383395-76383417 AAAGGGTCTTTGAGAATCATTGG + Intronic
1120519217 14:85507178-85507200 ACAAGGTGCTTGAAAGTCATAGG - Intergenic
1122641736 14:103164074-103164096 TCAGGGACTTTGGGGGTCATGGG + Intergenic
1124258945 15:28169327-28169349 ACAAGTTCTTTGATGGTGATTGG - Intronic
1129066600 15:72909935-72909957 ACAAGGGGTTTAAGGGTCAGGGG - Intergenic
1130300412 15:82676281-82676303 ACAAGGTCTTTGTGGGCACTGGG + Intronic
1131601701 15:93855761-93855783 ACAAGTCCTTTGAGGGTAAGAGG + Intergenic
1134315630 16:13116352-13116374 ACATGGTCTTTAATGGTCTTTGG + Intronic
1138556095 16:57772050-57772072 ACAAGGCCTCTGAGGGTACTAGG + Intronic
1146285289 17:31570453-31570475 GGAAGGCCTCTGAGGGTCATGGG - Intergenic
1149102907 17:52927801-52927823 ACGTGGGCTTTGGGGGTCATGGG - Intergenic
1149963021 17:61132806-61132828 ACCAGGTCTGTGTGGGTCACGGG + Intronic
1153980443 18:10304367-10304389 ACAAGGTCCTTTAAGGTCATAGG + Intergenic
1156404295 18:36769896-36769918 GCAAGGGATTTGATGGTCATTGG + Intronic
1159213338 18:65358757-65358779 ACAGGGTCTTTTGGGGGCATGGG + Intergenic
1159382478 18:67679395-67679417 ACAAAGCCTTTGAGGATTATGGG - Intergenic
1160032825 18:75277857-75277879 ACAATGTCTTTTGGGGTTATAGG - Intronic
1160266318 18:77342916-77342938 ACAAGCTCTGTGAGGGTCCCGGG + Intergenic
1164486228 19:28657937-28657959 ACAAGGTCTTTGCAGGGGATGGG - Intergenic
1164517789 19:28950597-28950619 ACAAAGTCTGTGAGGGCCAATGG + Intergenic
1166614424 19:44230381-44230403 ACAAGGACTTTGAGTGAAATGGG - Intronic
929208774 2:39329487-39329509 CCAGGGTATTTGAGGCTCATTGG - Intronic
929457062 2:42073485-42073507 ACAAAGTCTTCTGGGGTCATTGG - Intergenic
930306971 2:49686663-49686685 TCAAGGTCACTGAGGGTCCTGGG - Intergenic
931862094 2:66366062-66366084 ACATGGGTTTTCAGGGTCATAGG - Intergenic
932226323 2:70043886-70043908 ACAACCTCTTTTGGGGTCATGGG + Intergenic
933620080 2:84528596-84528618 ACCAGGTCTTTGATGTCCATGGG - Intronic
938086399 2:128404985-128405007 ACCAGGTATTTGAAGGTGATGGG + Intergenic
940441041 2:153716658-153716680 GAAAGGTCTTTGGTGGTCATTGG - Intergenic
942884145 2:180901955-180901977 ATAAGCCCTTTGAGAGTCATGGG + Intergenic
943565839 2:189515289-189515311 ACAATGTTTTTGAGAGTCAGTGG + Intergenic
943715211 2:191144164-191144186 ACAAGGTCCTTGAGGGTAAAAGG - Intronic
944384911 2:199153293-199153315 TCAAGCTCTTTGATGGTCAAAGG - Intergenic
947092048 2:226522746-226522768 ACAAGTTCTCTGAGGTTCATTGG + Intergenic
1170464779 20:16612663-16612685 CCCAGGTCTTTGTGGGCCATTGG - Intergenic
1170770478 20:19328261-19328283 ACCAGGTCTCTTAGGGTCTTGGG + Intronic
1171939702 20:31314342-31314364 ACAAGATCTTTGTTGGTTATAGG + Intergenic
1175717341 20:61263905-61263927 CCAGGGTCATTGAGGGTCACTGG + Intronic
1177619285 21:23566011-23566033 ACAATGTCACTGAAGGTCATCGG - Intergenic
1178068291 21:28932087-28932109 CAAAGGTCTTTGAGGGTCCTGGG + Intronic
1181462477 22:23093944-23093966 TCAAGGTCTGTGAGGGGCAAGGG + Intronic
1184124581 22:42478123-42478145 GCAAGGTCCTTGGGGGTCCTAGG - Intergenic
952164919 3:30737366-30737388 ACAACTTCTTTGAAGGTCACTGG - Intronic
952993001 3:38848419-38848441 TCAAGGTCATTAGGGGTCATGGG - Intronic
955383517 3:58460393-58460415 ACAGGGCCTTTGAGGGGCAGAGG + Intergenic
955601924 3:60654689-60654711 ACAATGTCTTTGAGTATCACAGG + Intronic
955925871 3:64004562-64004584 TCAAGGACTTTGAATGTCATGGG + Intergenic
955966710 3:64396419-64396441 ACAAGGCCTTTGAAGTTCATGGG + Intronic
959257196 3:104030856-104030878 CAAAGGTCTTTGGAGGTCATAGG - Intergenic
960551152 3:118977721-118977743 TCAAGGCCTCTGAGGGTCAAAGG - Intronic
963068251 3:141280933-141280955 ACAAAGGCTTTGAGAGTCACAGG - Intronic
965771300 3:172184168-172184190 AAAAGGGCTTTGAGGGGAATGGG - Intronic
970486765 4:16532678-16532700 ACATGGTCTATTAGGGTAATGGG - Intronic
972304989 4:37822291-37822313 ACAAGGTATTTGAGGGCATTGGG + Intergenic
973228633 4:47816662-47816684 ACATGTGCTTTGAGGCTCATTGG - Intronic
975020565 4:69482050-69482072 ACTAGGTCTTCTAGGGACATTGG + Intronic
975745734 4:77472600-77472622 ACAAGGTCTTTGCAGGGGATGGG - Intergenic
975753745 4:77551754-77551776 ACAAAGTCTTTGAGAAACATGGG - Intronic
977386095 4:96341105-96341127 TCAATGTCTTTAAAGGTCATGGG - Intergenic
977703784 4:100049572-100049594 ACAAGGTCCTTCTGGGTCACTGG - Intergenic
979832909 4:125322537-125322559 AGAATGTCTTTGAGGGGCCTGGG - Intronic
981463744 4:145041052-145041074 GCAAAGTGTTTGTGGGTCATTGG - Intronic
981545627 4:145890370-145890392 GCAAGGGCTTTGTGGGTCGTGGG - Intronic
984679566 4:182591890-182591912 ACAAAGTCTGTGAAGCTCATCGG - Intronic
984838635 4:184047523-184047545 ACAAGTAATTTGAAGGTCATGGG + Intergenic
989100903 5:37822157-37822179 GGAAGGTCTTTGAGGCTCAGAGG + Intronic
991286138 5:64978307-64978329 ACAAGTGCTTTCAGGGTCCTAGG - Intronic
993212540 5:84971425-84971447 ATAAGGTTTTTGAGATTCATTGG + Intergenic
994384496 5:99113636-99113658 ACAAGGTCCTTCAGGCTCATAGG - Intergenic
1001057914 5:168464641-168464663 AGAGGGTATTTGAGGGTCAGAGG + Intronic
1002574379 5:180163899-180163921 TCAAGGTCTTTAACGGTTATAGG + Intronic
1003844761 6:10161589-10161611 ACATGTTCTTTGAGTGTCTTTGG - Intronic
1004310608 6:14541647-14541669 ACAAGTCCCTTGAGGGTCAGAGG + Intergenic
1004447882 6:15717523-15717545 ACAAGCACTTTGAGCATCATTGG - Intergenic
1005400249 6:25424548-25424570 AGATGCTCATTGAGGGTCATGGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007132063 6:39484573-39484595 TCAAAGTCTTTAAGGGGCATTGG - Intronic
1009627901 6:66160577-66160599 TCTAGGACTTTGAGGATCATGGG - Intergenic
1010020166 6:71150211-71150233 AACAGGGCTTTGAGCGTCATGGG - Intergenic
1010046276 6:71447627-71447649 ACAAGGTGTTTGCTTGTCATGGG - Intergenic
1014255451 6:119156559-119156581 AGAAGTTCTTTGAGGGACAGGGG + Intergenic
1014466979 6:121767676-121767698 ACAAGGTCTTTGACTGTCCAAGG - Intergenic
1017522869 6:155217099-155217121 ACAAGGGCTTTGATTTTCATGGG + Intronic
1018466440 6:164050765-164050787 ACAAGTTCTTTCATGCTCATGGG - Intergenic
1019430557 7:997099-997121 ACAGCGTCATTGCGGGTCATGGG - Exonic
1020024012 7:4885797-4885819 AAAAGGTGTTTGAAGGTCAAGGG - Intergenic
1021324447 7:19248457-19248479 AAAAGGCCTTTGTGGGTGATTGG - Intergenic
1022925555 7:35052846-35052868 TCAATGTCTTGGAGGGTCAAGGG - Intergenic
1028370477 7:90086829-90086851 AAAATGTCTATGGGGGTCATGGG - Intergenic
1029823562 7:103167543-103167565 TCAATGTCTTGGAGGGTCAAGGG - Intergenic
1030063435 7:105641056-105641078 TCAAAAGCTTTGAGGGTCATGGG + Intronic
1037521051 8:19681135-19681157 ACAAGGTCATAGAAGCTCATTGG + Intronic
1038707617 8:29909709-29909731 ACAAGGGCTTAGTGGGTCAAGGG - Intergenic
1042792773 8:72626839-72626861 AAAAGGTATTTGGGGGTCATGGG + Intronic
1052125740 9:24772596-24772618 ACAGGGTCTTATATGGTCATTGG - Intergenic
1052911098 9:33882602-33882624 TCAAGATCTTTGAGGGACCTGGG + Intronic
1055111288 9:72562250-72562272 ACAATTTTTTTGAGGGTCACTGG + Intronic
1055214934 9:73847896-73847918 AAAAAGTCTTTGAGGCTCAGGGG + Intergenic
1055817942 9:80230112-80230134 ACAAAGTCTTTGAGAGATATGGG - Intergenic
1060550593 9:124483099-124483121 CCCATGTCTTTGATGGTCATAGG - Intronic
1062249466 9:135587082-135587104 ACAAGGTTTATGTGGGTCAGGGG - Intergenic
1187279102 X:17843626-17843648 ACAGGGTCTGTGAGGGGCTTAGG + Intronic
1188091207 X:25967860-25967882 ACAAGGCCCTTGTGGGTCAAGGG - Intergenic
1190439766 X:50465570-50465592 AAAAGGTCTTTGTGAGTAATCGG + Intronic
1194768451 X:97870913-97870935 ACAAGGTCATTCAGGGACACAGG + Intergenic
1197019414 X:121668735-121668757 ACACAGTCTTTGAGAGTCAGAGG + Intergenic
1198214109 X:134541471-134541493 AAAAAGTCTTTAGGGGTCATGGG - Intergenic
1199407025 X:147474342-147474364 AACAGGTCTTTGTGGCTCATGGG + Intergenic