ID: 1090226379

View in Genome Browser
Species Human (GRCh38)
Location 11:125074553-125074575
Sequence GAACACCTGGGGCCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090226373_1090226379 9 Left 1090226373 11:125074521-125074543 CCAGGCAAAAGGGCCATGGAGCA 0: 1
1: 1
2: 1
3: 22
4: 315
Right 1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG 0: 1
1: 0
2: 3
3: 18
4: 233
1090226375_1090226379 -4 Left 1090226375 11:125074534-125074556 CCATGGAGCAGATAAGGAAGAAC 0: 1
1: 0
2: 1
3: 20
4: 202
Right 1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG 0: 1
1: 0
2: 3
3: 18
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090226379 Original CRISPR GAACACCTGGGGCCACAAGC AGG Intronic
903191283 1:21657741-21657763 GCAGAGCTGGGGCCACAGGCAGG - Intronic
904181034 1:28666908-28666930 GAGTAGCTGGGACCACAAGCAGG - Intergenic
904216957 1:28928758-28928780 GAACACCTGGTGCCTAGAGCAGG + Intronic
904594105 1:31632277-31632299 AAACACCTGGGTCCAGAATCAGG - Intronic
905336047 1:37245276-37245298 GCACACCTGGGACCACACTCAGG - Intergenic
906509622 1:46403504-46403526 GAAGAGCTGGGGACACAAGAGGG - Intronic
909198955 1:72664258-72664280 GAACAGCTGGGACCACAGGCAGG + Intergenic
910067861 1:83174923-83174945 GTTCACCTGGGGCAACAAGATGG + Intergenic
910431150 1:87160864-87160886 GCACACCTGTGGCCACATGGGGG + Intronic
912775714 1:112505188-112505210 GATTACCTGGGGCCTCCAGCAGG - Intronic
912966562 1:114242083-114242105 GATCACCTGAGGCCAGGAGCTGG - Intergenic
913285781 1:117225130-117225152 ACACACCTGGAGCCAGAAGCAGG - Intergenic
915220324 1:154369410-154369432 GAGTAACTGGGACCACAAGCAGG - Intergenic
915245158 1:154551330-154551352 GTACACTTGGGGCCACTAGCAGG - Intronic
915713469 1:157922878-157922900 GAGCACCTGTGGCCAGAACCAGG - Intergenic
916071991 1:161175859-161175881 GACCCCCTGGGGCCCCAGGCAGG + Exonic
918477562 1:184941520-184941542 GAGCAGCTGGGACTACAAGCAGG - Intronic
921149036 1:212385420-212385442 CAATACCTGGGGGCACAAACAGG + Exonic
921159798 1:212464818-212464840 GGACACCTTGGGCCCCAGGCAGG + Intergenic
921523905 1:216193735-216193757 GAACACCAGGAGCCACAGGTAGG + Intronic
922606569 1:226893328-226893350 GGACAGCTGGGGCCAGGAGCAGG + Intronic
922947385 1:229528747-229528769 GATCACTTGAGGCCACAAGTTGG - Intronic
924268704 1:242309593-242309615 GATCACCTGAGGTCAGAAGCTGG - Intronic
1064482144 10:15750387-15750409 GAGTAGCTGGGGCCACAGGCAGG - Intergenic
1064729484 10:18315564-18315586 GAGCAACTGGGACCACAGGCAGG - Intronic
1066716202 10:38289171-38289193 GATCACCTGAGGTCAGAAGCTGG + Intergenic
1067179438 10:43973729-43973751 GAGCACCTGGGGCCACCGGCAGG - Intergenic
1067535473 10:47106633-47106655 TAACCCCTGGGGACAGAAGCAGG - Intergenic
1069609950 10:69766323-69766345 GACCACCAGTGGCCACAACCAGG - Intergenic
1072245964 10:93544291-93544313 GAATAGCTGGGACTACAAGCAGG + Intergenic
1075510446 10:123067955-123067977 TACCAGCTGGGGCCACAGGCTGG + Intergenic
1076439654 10:130472391-130472413 TAACACCAGGAACCACAAGCTGG - Intergenic
1076845747 10:133068728-133068750 GCACAGTTGGGGCCACAGGCCGG - Intergenic
1077541353 11:3147951-3147973 GGACCTCTGGGGCCACTAGCTGG + Intronic
1078614744 11:12854717-12854739 GAGTACCTGGGACCACAGGCAGG + Intronic
1080523444 11:33088732-33088754 GAATAGCTGGGACCACAGGCAGG + Intronic
1080545114 11:33309334-33309356 GATCACTTGAGGCCACAAGTTGG - Intronic
1083378231 11:62243603-62243625 GGTCACCTGGGGCCACAGGGTGG + Intronic
1083464761 11:62837973-62837995 GAGTACCTGGGACCACAGGCAGG - Intronic
1087782664 11:102317749-102317771 AAACACCAGGGCCCAAAAGCAGG + Intronic
1088247180 11:107830038-107830060 GATCACCTAAGGCCACAAGTTGG + Intronic
1090226379 11:125074553-125074575 GAACACCTGGGGCCACAAGCAGG + Intronic
1090647290 11:128776427-128776449 GATCACCTGAGGCCAGAAGTTGG + Intronic
1091849136 12:3681083-3681105 GGACACCAGGGGCCTCCAGCAGG - Intronic
1094708926 12:32941698-32941720 GAGTAGCTGGGGCCACAGGCAGG - Intergenic
1095869688 12:47012697-47012719 GAACGCCTGGAGCCACCAGCAGG - Intergenic
1096163925 12:49404498-49404520 GATCACCTGAGGCCAGGAGCTGG - Intronic
1096483421 12:51958870-51958892 CAACCCCTGGGGCCACAGACCGG - Intronic
1100543572 12:95580434-95580456 GAGTAACTGGGGCCACAGGCAGG - Intergenic
1102794479 12:115676494-115676516 GAACACCTGGAGCTACCAGGTGG - Intergenic
1103081435 12:118027052-118027074 GAACTCCTGGGGCCACCTTCAGG - Intronic
1103346857 12:120256942-120256964 GAACACCTGAGGCCTGAAGTTGG - Intronic
1106060932 13:26290989-26291011 GAATAGCTGGGACTACAAGCAGG - Intronic
1106253885 13:28004431-28004453 GAGTAGCTGGGACCACAAGCAGG + Intronic
1106552996 13:30787752-30787774 AGACACCTGGAGCCACAAGATGG - Intergenic
1108511008 13:51155923-51155945 GAAAACCTGATGGCACAAGCTGG + Intergenic
1108684384 13:52806260-52806282 GGACAGCTGTGGCCACCAGCTGG + Intergenic
1108685768 13:52817693-52817715 GATCACTTGTGGTCACAAGCTGG - Intergenic
1111502378 13:89138668-89138690 GAATAGCTGGGACTACAAGCAGG + Intergenic
1112030869 13:95454963-95454985 GATCACTTGAGGCCACAAGTTGG + Intronic
1112181580 13:97087184-97087206 GAATACCTGGGCCACCAAGCAGG - Intergenic
1113009737 13:105750285-105750307 GGACACCTGGGACCACCAGAAGG + Intergenic
1113671720 13:112180022-112180044 GAGCACCTGGTGCCACATGGAGG + Intergenic
1113772299 13:112917902-112917924 GTTCACCTGGGGACGCAAGCCGG - Intronic
1117603583 14:57400956-57400978 GATCACCTGAGGCCAGGAGCTGG - Intronic
1120962054 14:90134088-90134110 GAGTAACTGGGACCACAAGCAGG - Intronic
1122269995 14:100564753-100564775 GAACACCAGGGGCCAGACCCCGG + Intronic
1125182927 15:36897834-36897856 GTCCACCTGGGGCCACAGGCAGG + Intronic
1126769358 15:52039736-52039758 GAACACCTGAGGCCAGGAGTTGG - Intronic
1126932540 15:53670918-53670940 GAAGCCCTGGGGGCCCAAGCTGG - Intronic
1127340945 15:58043391-58043413 GAACACATGTGGCCACCAGTGGG + Intronic
1129393201 15:75230900-75230922 GAGCACCTGGGGACAGAGGCAGG - Intergenic
1131214873 15:90529059-90529081 GACCAGCTGGGACCACAGGCGGG - Intergenic
1131251009 15:90830029-90830051 GAAGACCTGTGGCCCCCAGCAGG + Intergenic
1132319357 15:100914186-100914208 GAACACCAAGGGCCTGAAGCTGG - Intronic
1132647103 16:1004118-1004140 GAGCTCCCGGGGCCACACGCGGG - Intergenic
1132681267 16:1142991-1143013 GCCCTCCAGGGGCCACAAGCTGG + Intergenic
1132914700 16:2337605-2337627 GATCACTTGAGGCCACAAGTTGG - Intronic
1133189362 16:4122109-4122131 GAGCAGCTGGGACCACAGGCAGG + Intergenic
1135545971 16:23366991-23367013 GAACTCCTGGGCCCACCAGAAGG - Intronic
1136402505 16:30026255-30026277 GAACACCTGGGTGCAGGAGCAGG + Intronic
1136534916 16:30893757-30893779 GAACACCCGGGGCCCAGAGCTGG + Intronic
1138110483 16:54319961-54319983 GAGTAACTGGGGCCACAGGCAGG + Intergenic
1138307139 16:55988666-55988688 GATCACCTGAGGCCAGGAGCTGG - Intergenic
1139417134 16:66821995-66822017 GAGTAGCTGGGACCACAAGCAGG + Intronic
1139636565 16:68261718-68261740 ATACACCAGGGGCCACAAGAGGG + Intergenic
1139690747 16:68640517-68640539 GAGTAGCTGGGGCCACAGGCGGG - Intronic
1139965775 16:70744574-70744596 GATCACCTGGGGAGAGAAGCGGG + Exonic
1140393264 16:74606689-74606711 GCACACCTGGAGCAACAACCTGG - Exonic
1141470165 16:84232769-84232791 GAGCAGCTGGGACCACAGGCAGG - Intronic
1141890736 16:86924906-86924928 GAAAGGCTGGGGCCACAGGCTGG + Intergenic
1142243386 16:88957254-88957276 GAACCTCTGGGGCCATCAGCTGG - Intronic
1142316857 16:89352810-89352832 GACCACATGGGCCCCCAAGCAGG + Intronic
1143628463 17:8123902-8123924 GAACTCCAGGAGCCAGAAGCTGG - Intronic
1145068320 17:19779950-19779972 GAACACCTGAGGCCAGGAGTTGG + Intronic
1145246074 17:21270467-21270489 GAACAGCTGGGACCACATGTTGG + Intergenic
1145944314 17:28761488-28761510 GGCCACCTGAGGCCACAAGCTGG - Intronic
1147331836 17:39703928-39703950 GAGCAGCTGGGGCTGCAAGCTGG + Intronic
1147869920 17:43579873-43579895 GACCAGCTGGGGCCAGAGGCAGG - Intergenic
1148831328 17:50433820-50433842 GACCACCTGGGGCAACAAAGTGG - Intronic
1149858423 17:60106025-60106047 GATCACCTGAGGCCAGGAGCTGG - Intergenic
1151187554 17:72375065-72375087 GAAGGCCTGGTGCCACCAGCTGG - Intergenic
1151933298 17:77246889-77246911 GCACACCTGGGTCCCCGAGCGGG - Intergenic
1152028914 17:77829920-77829942 GCACAGCTGGGGACACAAGCAGG + Intergenic
1152278276 17:79370937-79370959 GAACACCTGGAGCTCCCAGCAGG + Intronic
1152530135 17:80913826-80913848 GAACTGCTGGGGCCACAGGCAGG - Intronic
1154009841 18:10565037-10565059 GAAAAACTGGGGCTAAAAGCAGG - Intergenic
1157760610 18:50261518-50261540 GAACAGCTGGGACTACAGGCAGG + Intronic
1158617795 18:59004145-59004167 GACCACATGGGGACACAAGAAGG + Intergenic
1159609901 18:70513548-70513570 GAACACTTGGGGTCTTAAGCAGG + Intergenic
1160523596 18:79522741-79522763 GGACTCCTGGGGCCAGGAGCTGG + Intronic
1160820066 19:1053771-1053793 GAAGATCTGGGGAGACAAGCAGG - Exonic
1160980331 19:1813682-1813704 GAGTAGCTGGGACCACAAGCAGG + Intergenic
1160982059 19:1820869-1820891 GAGTAGCTGGGACCACAAGCCGG - Intronic
1161491461 19:4564277-4564299 GAGTACCTGGGACCACAGGCGGG + Intergenic
1161614753 19:5263883-5263905 GCACACCTGTGCCCACAGGCGGG + Intronic
1161755905 19:6134167-6134189 GATCACCTGAGGCCACGAGGTGG + Intronic
1162106743 19:8374289-8374311 GGTCCCCTGGGGACACAAGCAGG + Exonic
1163602614 19:18258007-18258029 GGACACCTGGCGCAACAAGGCGG - Exonic
1163908806 19:20170354-20170376 GAACACCTGAGGTCACAGCCTGG + Intronic
1165408172 19:35643136-35643158 GAACACCTGCGCCCTCAAGGTGG + Intronic
1165658305 19:37551916-37551938 GCACACTTGGGACCACAAGAGGG - Intronic
1166835052 19:45662267-45662289 GATCACCTGAGGTCACAAGTTGG - Intergenic
1167295399 19:48646398-48646420 GGACACCTGGGGCCGGGAGCAGG + Intergenic
1168411687 19:56144179-56144201 GAGCAGCTGGGACCACAGGCAGG - Intronic
925975327 2:9138253-9138275 GCACACCTGGGCCCTCAGGCCGG + Intergenic
928428344 2:31197824-31197846 GAACACCTGGAGCCACTGGAAGG + Intronic
929141490 2:38670389-38670411 GAAAACCTGGGTTCAGAAGCAGG + Intronic
932497449 2:72153454-72153476 GAATATCTGGGGCCACAAGCTGG - Intergenic
932595617 2:73091888-73091910 GAACAGATGGTGCCACAGGCAGG + Intronic
933127807 2:78632943-78632965 GAACACCGGAGGCCACCAGACGG - Intergenic
933389997 2:81656373-81656395 GAACAAATGAGGCAACAAGCAGG - Intergenic
933678455 2:85078218-85078240 GCACAGCTGGGGCCTCAAGCTGG + Intergenic
934026245 2:88003551-88003573 GAACACGTGGGGCCTCCAGAAGG + Intergenic
935651145 2:105383105-105383127 GAACACTTGAGGCCAGGAGCTGG - Intronic
936079711 2:109423878-109423900 GCACAGCTGGGACCCCAAGCAGG + Intronic
943125952 2:183793126-183793148 GATCACCTGAGGCCAGGAGCTGG + Intergenic
944161239 2:196662637-196662659 CAACCCCTGGGGCCACAGACTGG - Intronic
946304774 2:218849971-218849993 CATCACTTGGGGCCAGAAGCTGG + Intergenic
946331248 2:219010327-219010349 GAACACCTGTGGGCACTAGGTGG + Intronic
948273261 2:236689701-236689723 GAATAGCTGGGACCACAGGCAGG + Intergenic
948552822 2:238785883-238785905 GAAGAGCAGGGGCCAGAAGCAGG + Intergenic
948571003 2:238917009-238917031 GGACACCTGGGTCCACACACCGG - Intergenic
949047030 2:241876974-241876996 GAACACCTGAGGCCCCAGGCAGG + Intergenic
1170411484 20:16096708-16096730 GAACACCTTGGCCCACAAAGTGG - Intergenic
1172529422 20:35619568-35619590 GAACACGTGGGGCTGCAGGCGGG - Exonic
1174104199 20:48150656-48150678 GAACACCTGGGGCCAGAGAATGG - Intergenic
1174412384 20:50344395-50344417 GGACACCAGGGGCCACCTGCAGG + Intergenic
1175307312 20:57985239-57985261 AAACATCTGGGGCCACATACAGG - Intergenic
1176157607 20:63629770-63629792 GATGACATGGGGCCACCAGCTGG + Intergenic
1176192870 20:63821413-63821435 GAGCAGCTGGGACTACAAGCAGG + Intronic
1176457725 21:6928458-6928480 GCACAGCTGGGGCCACACCCAGG - Intergenic
1176835897 21:13793542-13793564 GCACAGCTGGGGCCACACCCAGG - Intergenic
1178063626 21:28879169-28879191 GATCACCTGAGCCCACAAGGTGG - Intronic
1178161971 21:29928442-29928464 GAAAACCTGTGCCCACAGGCAGG + Intronic
1178242582 21:30919656-30919678 GAATACCTGGGGACAGAAACAGG - Intergenic
1179034836 21:37750681-37750703 GAACACATGGGGACACAGGGAGG + Intronic
1179423360 21:41253549-41253571 GCACACCTGGGTCCTCAAGCTGG - Intronic
1179628115 21:42659982-42660004 GGACACCTCGGGGCATAAGCCGG + Intronic
1179885859 21:44314037-44314059 GGACACCTGCGGCCCCCAGCAGG - Intronic
1179996601 21:44977203-44977225 GCACAGCTGGGGCCACACCCAGG - Intergenic
1181041694 22:20195404-20195426 GAGAACCTGGGGCCAAAATCTGG + Intergenic
1181669689 22:24420365-24420387 CAACGCCTGGAGCCAGAAGCTGG + Intronic
1182536654 22:31008744-31008766 AAACACCTGGGGGCACCAGAAGG + Intergenic
1182550008 22:31095799-31095821 GAATAACTGGGGTCACCAGCGGG - Intronic
1183171455 22:36191282-36191304 GAACACGTGGGGCCCCCACCCGG - Exonic
1184610467 22:45599969-45599991 GAAAACCTGGGCTCAGAAGCTGG + Intronic
1184726666 22:46351238-46351260 GAGGAGCTGGGGCCACAGGCAGG - Intronic
1185106701 22:48874918-48874940 GAGTAGCTGGGGCCACAGGCAGG + Intergenic
1185387990 22:50545202-50545224 GAGCACCTGGGGCCAGAGGGGGG + Intergenic
950752160 3:15138229-15138251 GAGCACCTGGGGCCACCAAGAGG + Intergenic
954107791 3:48418655-48418677 GACCCCATGGGGCCACAAGTTGG + Intronic
954348264 3:50019574-50019596 GATCACCTGGGCCCAAGAGCTGG - Intronic
954453099 3:50582260-50582282 GGGCAGCTGGGGCCACAAGCAGG + Exonic
954710050 3:52501149-52501171 CAGCACCTGGGGCCACAGGCAGG - Exonic
956289038 3:67642381-67642403 GATCACTTGAGGCCACAAGTTGG + Intronic
956864425 3:73355512-73355534 GAACACCTGAGGCTACCAGGTGG + Intergenic
964109622 3:153074922-153074944 GATCACTTGGGGCCAGAAGTTGG + Intergenic
966550097 3:181195215-181195237 GATCACCTGAGGCCAGAAGCTGG - Intergenic
966802648 3:183778575-183778597 GATCACCTGAGGTCACGAGCTGG - Intronic
967096370 3:186180665-186180687 GAACCCCTGAGGCCACATTCTGG + Intronic
968984828 4:3869429-3869451 GAACACCTGGGGCCCCAAGAGGG - Intergenic
970007896 4:11428284-11428306 TACCACCTGGGGCCAGAAACTGG - Intronic
971589100 4:28443945-28443967 GAACACCTGGGGGCAGAAGCTGG + Intergenic
971657496 4:29368724-29368746 GATCACCTGAGGTCACAAGTTGG + Intergenic
972172068 4:36358325-36358347 AAACACCTGAGGAGACAAGCAGG + Intergenic
973871529 4:55171375-55171397 GAATAGCTGGGACCACAGGCTGG - Intergenic
976555713 4:86449144-86449166 CAACCCCTGGGGCCACAGACTGG - Intronic
978527371 4:109679422-109679444 GATCACCTGAGGCCAGGAGCTGG + Intronic
982365059 4:154568774-154568796 GATCACCTGAGCCCACAACCTGG + Intronic
984733599 4:183090318-183090340 GAACTCCTTTGGCCACAAGCTGG - Intergenic
984903789 4:184608672-184608694 GATCACCTGAGGTCAGAAGCTGG - Intergenic
985836719 5:2277216-2277238 GAACAGCAGGGGCCACCAACAGG + Intergenic
988532442 5:32039326-32039348 GATCACCTGAGGCCAGGAGCTGG - Intronic
989378030 5:40785942-40785964 GAACATCAGGAGCCACAAGAAGG + Intronic
992615157 5:78540526-78540548 GAACACATAGGGCCACCAGCAGG + Intronic
999796745 5:154995902-154995924 GACCACATGGGGGCAGAAGCAGG - Intergenic
1000637345 5:163659412-163659434 GAAGACCAGGGGCCTCAAGTAGG - Intergenic
1000805904 5:165791826-165791848 GAACATATGGGACCACAAGTAGG - Intergenic
1002613922 5:180438633-180438655 GAACAGCAGGGGCCACACACTGG - Intergenic
1005217290 6:23545967-23545989 GAAGAGCTGGGGCTACCAGCTGG - Intergenic
1006820567 6:36890758-36890780 GATCACTTGGGGCCAGGAGCTGG - Intronic
1007193460 6:40039347-40039369 GAACACCAGGGGCCAAGAGAGGG + Intergenic
1008038526 6:46772896-46772918 GAACATGTGTGGCCACAGGCTGG - Intergenic
1009869282 6:69433836-69433858 GATCACCTGAGGCCAGGAGCTGG + Intergenic
1010289842 6:74122513-74122535 AAACACATGGGCCCACTAGCAGG - Intergenic
1013431024 6:110054901-110054923 GAACCCCAGGGGCCATCAGCTGG + Intergenic
1014224539 6:118832854-118832876 TAGCACCTGGTGCCACAGGCTGG - Intronic
1016960382 6:149667211-149667233 GATCACTTGAGGCCAGAAGCTGG + Intronic
1017542485 6:155416970-155416992 GAACACCTGAGGCCAGGAGTTGG - Intronic
1018908178 6:168087192-168087214 GAGCAGCTGGGACCACAGGCGGG + Intergenic
1020255058 7:6498259-6498281 GAGACCCTGGGGGCACAAGCGGG - Intronic
1025222869 7:57131339-57131361 GATCACCTGAGGCCAAAAGTTGG + Intronic
1025633663 7:63303012-63303034 GATCACCTGAGGCCAAAAGTTGG + Intergenic
1025649033 7:63445148-63445170 GATCACCTGAGGCCAAAAGTTGG - Intergenic
1027801281 7:82753288-82753310 GAGCATCAGTGGCCACAAGCGGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029730570 7:102435323-102435345 GATCACCTGCGGCCAGGAGCTGG - Intronic
1031374234 7:121004584-121004606 GAACAACTGAGGTCACAAACTGG + Intronic
1031515435 7:122692757-122692779 GAACACTCGGGGCCGTAAGCAGG + Intronic
1034157988 7:148971390-148971412 GATCACATGGGGCCAGGAGCTGG - Intergenic
1034553598 7:151836319-151836341 ACACACCTGGGTCCACAGGCTGG + Intronic
1035165432 7:156986746-156986768 GAATAGCTGGGACCACAGGCAGG - Intergenic
1035519004 8:261440-261462 GATCACTTGAGGCCAGAAGCTGG + Intergenic
1036774491 8:11601037-11601059 GAACACCTGGGGCCAGAGACAGG - Intergenic
1044028455 8:87204001-87204023 GAACACCTGGCTCCACTACCTGG + Intronic
1044399665 8:91756503-91756525 GAACAGCTGTGGCCGTAAGCAGG - Intergenic
1044965619 8:97571169-97571191 GAACACCTGGGGTTAGAAACAGG - Intergenic
1049706761 8:144046635-144046657 GAACCCCAGTGACCACAAGCTGG + Exonic
1050742580 9:8839450-8839472 GAACAGCTGGGACTACAGGCGGG + Intronic
1051052180 9:12947813-12947835 GAACAACTGGGGCATAAAGCAGG - Intergenic
1051837585 9:21358617-21358639 GAGTAACTGGGACCACAAGCAGG + Intergenic
1052824131 9:33163148-33163170 GCACACATGTGGACACAAGCAGG - Intronic
1053250984 9:36573726-36573748 GATCACCTGAGGACACGAGCTGG - Intronic
1057291437 9:93809823-93809845 GGCCACCTGAGGCCACAAGTAGG - Intergenic
1057507419 9:95647314-95647336 GGACAACTGGGGCCAGAAGAAGG - Intergenic
1058669528 9:107348888-107348910 GAACACCTGAGGCAGCGAGCAGG - Intergenic
1058693212 9:107536571-107536593 GAACTCCTGGAGAGACAAGCAGG - Intergenic
1058865410 9:109157512-109157534 GAGCAGCTGGGACCACAGGCAGG + Intronic
1059827768 9:118051251-118051273 GAAAATCTGGGTCCCCAAGCTGG - Intergenic
1060075117 9:120583807-120583829 GAGTAGCTGGGACCACAAGCAGG + Intergenic
1060507284 9:124207651-124207673 GTACACCTGGAGCCAGAAGTTGG - Intergenic
1061885081 9:133587351-133587373 GAAGCCCTGGAGCCATAAGCAGG + Intergenic
1062048867 9:134437111-134437133 GGACAGCTGGGGGCGCAAGCTGG + Intronic
1062462562 9:136668026-136668048 AAACAGCTGGGGCCACAGCCTGG - Intronic
1189260711 X:39676960-39676982 GAAGCCCTGGGACCACAAGGTGG - Intergenic
1190767584 X:53488353-53488375 GAGTAGCTGGGGCCACAGGCAGG + Intergenic
1192238700 X:69313208-69313230 GAGAACCTGGGGCCCCAGGCAGG - Intergenic
1192504808 X:71675406-71675428 GATCACCCGAGGCCAGAAGCTGG - Intergenic
1192886040 X:75336082-75336104 GATCACCTGAGGCCAGGAGCTGG + Intergenic
1199968803 X:152843488-152843510 GAACACCTGGAGCCACTAGAAGG - Intronic
1200113953 X:153761531-153761553 AAACACCTGGGACTACAGGCAGG - Intergenic
1200156713 X:153980450-153980472 GAGCACCTGGGGCCAGGAGGCGG + Intronic
1200157672 X:153985889-153985911 GAGCACCTGGGGCCAGGAGGCGG - Intergenic
1201075034 Y:10180477-10180499 GAGTACCTGGGACCACAGGCAGG + Intergenic