ID: 1090227116

View in Genome Browser
Species Human (GRCh38)
Location 11:125078340-125078362
Sequence CTCAGAAATGCTCATCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090227116_1090227118 3 Left 1090227116 11:125078340-125078362 CCATCCAGATGAGCATTTCTGAG 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1090227118 11:125078366-125078388 TCACTCTGAGAGTGATGCTGAGG 0: 1
1: 0
2: 0
3: 15
4: 164
1090227116_1090227119 6 Left 1090227116 11:125078340-125078362 CCATCCAGATGAGCATTTCTGAG 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1090227119 11:125078369-125078391 CTCTGAGAGTGATGCTGAGGTGG 0: 1
1: 0
2: 2
3: 34
4: 269
1090227116_1090227120 16 Left 1090227116 11:125078340-125078362 CCATCCAGATGAGCATTTCTGAG 0: 1
1: 0
2: 1
3: 17
4: 219
Right 1090227120 11:125078379-125078401 GATGCTGAGGTGGATGAGACTGG 0: 1
1: 0
2: 0
3: 50
4: 1056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090227116 Original CRISPR CTCAGAAATGCTCATCTGGA TGG (reversed) Intronic
901087660 1:6621403-6621425 CCCAGGAATCGTCATCTGGAAGG - Exonic
902598652 1:17526122-17526144 CTCTGAATTGCTCAAATGGATGG + Intergenic
902776595 1:18678881-18678903 CTCAGAAGTGCCCATCGCGATGG + Intronic
905380917 1:37561081-37561103 CCCATAAATGCTGACCTGGAGGG - Intronic
906076891 1:43058548-43058570 CTCAGGATTGCTGAGCTGGAGGG + Intergenic
907638013 1:56156420-56156442 CTCAGAAATGCCCTTCAGGGAGG + Intergenic
908584349 1:65551998-65552020 CTCAGAACTGCACAACTGCATGG - Intronic
908955733 1:69624138-69624160 AGCAGAAATTCTCTTCTGGAGGG - Intronic
910379561 1:86611751-86611773 CTCAGAACTGCTCAACTACATGG - Intergenic
912646425 1:111396584-111396606 CTCAAAACTGCTCAACTGCATGG + Intergenic
913424142 1:118707928-118707950 CTCAAAACTGCTCAACTGCATGG + Intergenic
913467141 1:119154567-119154589 CTCAAAACTGCTCAACTGCATGG - Intergenic
914683207 1:149955334-149955356 CTCAGAACTGCTCAACTACATGG - Intronic
917037078 1:170760141-170760163 CTCAGAAATGCACAACTACATGG - Intergenic
917608909 1:176666496-176666518 CTCAGAAAACCTCATCTTGTGGG + Intronic
920376889 1:205513609-205513631 GTCAGAAAGGGTCATCTGTAGGG + Intronic
920722854 1:208403816-208403838 CTGAGAAATAGTCATCTAGAAGG + Intergenic
922043475 1:221920092-221920114 CTTAGAAATGCTAAATTGGAGGG - Intergenic
922821721 1:228489143-228489165 CTCTGAACTGCTCAGCTGGTTGG + Intronic
924017498 1:239743556-239743578 AACTGAAATACTCATCTGGAAGG - Intronic
1066053554 10:31659876-31659898 TCCAGAAATGCTCTTGTGGAGGG + Intergenic
1066176717 10:32915014-32915036 CTCAAAACTGCTCAACTGCATGG + Intronic
1068724713 10:60288446-60288468 GTCAGAGAAGCTCATCGGGAAGG + Intronic
1073475496 10:103749994-103750016 TTCAGAACTGCTTAACTGGATGG - Intronic
1074745272 10:116525575-116525597 TTGAGAGATGCTGATCTGGATGG - Intergenic
1076106922 10:127830972-127830994 CTCAAAACTGCTGATCTGGTGGG + Intergenic
1076141944 10:128086385-128086407 CTCAGTAATGCTCCTCTGAGTGG - Intergenic
1077359443 11:2134215-2134237 CACAGCAATGCTCAGCTGGAAGG + Intronic
1079469473 11:20764700-20764722 CTGAGAACTGCTCAGCTGGAGGG + Intronic
1080714929 11:34790909-34790931 TGCAGAAATGCTCAGCTGGATGG - Intergenic
1082009323 11:47439632-47439654 CGTAGAAATGCACATCTGGAAGG + Intronic
1082102931 11:48189039-48189061 CTCAGAACTGCTCAACTACATGG - Intergenic
1083083945 11:60123260-60123282 CTCTGAAATGCCCATGTGAAAGG - Intergenic
1083522789 11:63331378-63331400 CTCAAAACTGCTCATCTACATGG - Intronic
1085971923 11:81603286-81603308 CTCACAATTACACATCTGGAGGG + Intergenic
1086080557 11:82899483-82899505 TTCAGAAATGCTGAACTGTAAGG + Intronic
1086329006 11:85734390-85734412 CTCAGAAATTCTCTCATGGATGG + Exonic
1090227116 11:125078340-125078362 CTCAGAAATGCTCATCTGGATGG - Intronic
1091121608 11:133062609-133062631 CTCAGAAGATCTCATCTGTAGGG - Intronic
1091657159 12:2354097-2354119 CTCTGAAATGCTGATGGGGATGG + Intronic
1093053608 12:14532721-14532743 CTCAGAGAAGCTGACCTGGATGG + Intronic
1093571483 12:20670547-20670569 CTCAAAACTGCTCAACTGCATGG + Intronic
1093609329 12:21135126-21135148 CTCAAAACTGCTCAACTGCATGG - Intronic
1093948454 12:25136332-25136354 CTCAGGAAGCCTCATCTGTAGGG + Intronic
1095238835 12:39832959-39832981 CTCAAAAATCCTGATCTAGATGG + Intronic
1097276621 12:57817973-57817995 CTCAGAGATGCCCTTTTGGACGG + Intronic
1098182900 12:67867152-67867174 CTCAAAACTGCACAACTGGATGG - Intergenic
1101177408 12:102168667-102168689 GTCAAGAATGCTTATCTGGATGG + Intronic
1104729000 12:131094833-131094855 CTCAGGAAAACTCATCTGTAAGG - Intronic
1105914977 13:24905986-24906008 TTCAGAAGTGCTCTTTTGGACGG + Exonic
1105930450 13:25047373-25047395 CGCAGAACTGCTCATCTCCAGGG - Intergenic
1106129858 13:26931315-26931337 CTCAGGAATCCTGATGTGGAAGG - Intergenic
1109270360 13:60249190-60249212 CTCAAAACTGCTCATCTACATGG - Intergenic
1110970002 13:81749883-81749905 CTCAGAACTGCTCAACTTCATGG + Intergenic
1111564642 13:89999037-89999059 CTCAGAAATGCTGTTCTGGGTGG + Intergenic
1112487779 13:99835372-99835394 CTCTGACATCCTCATCTGCATGG + Intronic
1116184270 14:41576715-41576737 TACAGCAATGCCCATCTGGATGG + Intergenic
1116914299 14:50507640-50507662 CTCAAAACTGCTCAACTGCATGG - Intronic
1118603853 14:67488839-67488861 CTCAGAAAGGCTCCTTTTGAGGG + Intronic
1119600250 14:75971094-75971116 TTCTGAAATGCTTATCTGAAGGG + Intronic
1120434257 14:84460347-84460369 CTCAGAAATGCTCAGCATTATGG - Intergenic
1120567455 14:86077787-86077809 CTCAAAACTGCTCAACTGCAAGG - Intergenic
1122904035 14:104793842-104793864 CTCAGGAAGGCCCATCTGGAAGG - Exonic
1129456965 15:75681240-75681262 CTCAGATTTGGGCATCTGGAAGG - Intronic
1129494968 15:75970689-75970711 CTCTGAAGTGATCCTCTGGATGG + Intronic
1130297396 15:82656867-82656889 CTCAGGTATGCTCATGTGGTAGG + Intergenic
1130389969 15:83446966-83446988 CTCAGAAATGCGCCTAGGGAGGG - Intergenic
1130563573 15:84977161-84977183 CACAGAAAACCTCATCAGGAAGG + Intergenic
1131439206 15:92446111-92446133 CTGAGAAGGGCTCACCTGGATGG + Intronic
1132212097 15:100031674-100031696 CCCAGAATTGCTCATCTCTATGG - Intronic
1133819415 16:9223264-9223286 GTCAGAAATGCGCATTGGGAGGG + Intergenic
1135929272 16:26722949-26722971 CTCAGAAAGGCCACTCTGGAAGG - Intergenic
1138933753 16:61694252-61694274 CTCAGAAGTGCTTTTCTAGAAGG + Intronic
1138961258 16:62033156-62033178 CCCAGGAATGCTCAGCTGGATGG - Intronic
1140029583 16:71324728-71324750 CTCAAAAATTCTCATCTAGAAGG - Intergenic
1142341195 16:89523912-89523934 CTCAGGAAAGCTCAGCTGGACGG - Intronic
1143763202 17:9119982-9120004 CTTAGAAGTGCTTATCTGGCCGG + Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1146446125 17:32934250-32934272 GTCATCAGTGCTCATCTGGAGGG - Intronic
1147512072 17:41079095-41079117 GTCAGAAATGTTCTTTTGGAAGG - Intergenic
1148025713 17:44586194-44586216 CTCAGAAAAGCCCATGTAGAAGG - Intergenic
1148028621 17:44605123-44605145 CTCAAATATCCTCTTCTGGAGGG + Intergenic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1156133108 18:34002559-34002581 CTCAGAGGTTCTCATCTGGTTGG - Intronic
1157728119 18:49980519-49980541 CTTAAAAATGCTCATCTGATGGG + Exonic
1159315838 18:66772218-66772240 CTCAAAAATGGTCTTCTTGACGG + Intergenic
1161593807 19:5141185-5141207 GTCACAGAGGCTCATCTGGAAGG + Intronic
1161618978 19:5288583-5288605 CCCAGAAATGCACATCTGCTTGG + Intronic
1164639591 19:29814066-29814088 CTCAGAAATGCTTATTTCGGGGG - Intronic
1166412986 19:42569148-42569170 GTCAGAAATGCTCATAAGGCCGG - Intergenic
925196014 2:1926389-1926411 CTCAGAAAAGCATACCTGGAAGG - Intronic
925822220 2:7810939-7810961 CTCAGAAATGCAAGACTGGAGGG - Intergenic
928951317 2:36815583-36815605 AAGAGAAATGCTCAACTGGATGG - Intergenic
930874748 2:56202417-56202439 CTCAAGAATGTTTATCTGGAAGG - Intronic
935398340 2:102634231-102634253 CTCAAATATCCTCATTTGGATGG + Intronic
935421303 2:102871846-102871868 CTCAGAAATGATCATCAACAAGG - Intergenic
935489646 2:103701750-103701772 CTCAGAAAGAATCAACTGGAGGG - Intergenic
937086248 2:119173832-119173854 CTCAGAAGTACACATCTGGTGGG + Intergenic
938137083 2:128768282-128768304 TTCAGAAAGTCCCATCTGGAGGG - Intergenic
938931787 2:136092944-136092966 CTCAAAAAACCTCATATGGAGGG + Intergenic
939962417 2:148577041-148577063 CACGGAAATGCACATTTGGAAGG + Intergenic
939975051 2:148707697-148707719 CTCAAAACTGCTCAACTAGATGG + Intronic
940034885 2:149302770-149302792 CTCAGAAATGCAAACCTGAAAGG + Intergenic
942474885 2:176309184-176309206 CTCAGAACTGCTCAGCTACATGG - Intronic
943432571 2:187823318-187823340 CCCAGAATTTCTCAACTGGATGG + Intergenic
943485551 2:188474569-188474591 CTCAGAAATGCTCCTGCTGAGGG + Intronic
943987517 2:194641626-194641648 CTCAGAAATGCACAACTACATGG + Intergenic
944497340 2:200321126-200321148 CACACAAATGCACATCTGAAAGG - Intronic
944644898 2:201769696-201769718 CTCAGAAATCCACATTTGTAAGG + Intronic
945304997 2:208251378-208251400 CTCAGAAAGGATAATCTGGCTGG - Intronic
945361111 2:208896762-208896784 CTCAAAACTGCTCAACTGCATGG + Intergenic
945507058 2:210654839-210654861 CTCTGAAATGCTAATCTGGAAGG - Intronic
945677984 2:212878539-212878561 CTCAGAACTGCTCAACTAGATGG + Intergenic
946436502 2:219659833-219659855 CTCAGAAAGGCACAACAGGATGG - Intergenic
946722342 2:222623059-222623081 CACAGAAATGCTCAGCAAGAGGG + Intronic
947259285 2:228202428-228202450 CTCAAAACTGCTCAACTGCATGG - Intergenic
947261863 2:228232321-228232343 CTCAAAACTGCTCAACTGCATGG - Intergenic
947963121 2:234256723-234256745 TTCAGGAATGCTCACCTGGTAGG - Intergenic
948384165 2:237571359-237571381 CTCACCTATGCTCACCTGGAAGG + Intergenic
948592472 2:239060176-239060198 CTCAGAAATGCCCCAGTGGATGG - Intronic
1169010717 20:2247837-2247859 CTCAGACAAGCTTCTCTGGAAGG - Intergenic
1169682478 20:8231212-8231234 CTGAGAAATGCTGATCTAAATGG - Intronic
1169870111 20:10240665-10240687 CTAAGAAATGTTCGTTTGGAAGG - Intronic
1170392358 20:15889542-15889564 ATCAGACATGGTCATCTGCAAGG + Intronic
1172819515 20:37718851-37718873 CTCAGAAATTATCATCTTCAAGG - Intronic
1173125154 20:40329913-40329935 CTCAGAATTTCTCAGCAGGAAGG + Intergenic
1175134264 20:56811114-56811136 CTCATACAGCCTCATCTGGAGGG - Intergenic
1175877146 20:62235748-62235770 CTGAGAAATGCTCATCCTGCAGG - Intronic
1179154558 21:38838732-38838754 CTCAGAAACACTCATCTGCGTGG + Intergenic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1185196302 22:49472079-49472101 CACAGAGATGCCCATCAGGATGG - Intronic
949967081 3:9365888-9365910 ATTAGAAATGCTCAACTGGCAGG - Intronic
950648772 3:14394166-14394188 CTCAGAAATTCTCATTTAAATGG - Intergenic
951757752 3:26110773-26110795 CTAAGAAATGCTCTTCTAGAGGG - Intergenic
954836234 3:53471231-53471253 CTCAAAAATGCACATCTACATGG - Intergenic
955689525 3:61577736-61577758 CTGTGAAATGCTCTTCTGGAAGG - Intronic
956719918 3:72108702-72108724 GTCAGAAATGCACATCTGAGGGG - Intergenic
957304437 3:78439441-78439463 CTCAGAAATTCTCAACTGCAAGG - Intergenic
960838835 3:121936057-121936079 CTCAAAACTGCTCAACTGCATGG - Intronic
961424723 3:126836039-126836061 CTCATAAAAGCTGAACTGGAAGG - Intronic
961851150 3:129820020-129820042 CTCAGAATTTCTTATCTAGAAGG + Intronic
962252401 3:133843842-133843864 CTCTGTCATCCTCATCTGGATGG - Intronic
964371740 3:156007352-156007374 CTCAGCAATGATCTTCTGCAAGG + Intergenic
964486849 3:157194304-157194326 CTCAAAACTGCTCATCTACATGG - Intergenic
969541037 4:7788996-7789018 CTCTGACAGGCTCATCTGGCAGG + Intronic
971523891 4:27591116-27591138 CTGAGAAAAGCTCATTTGGCAGG - Intergenic
974182202 4:58398967-58398989 CTCAAAACTGCTCAACTGCATGG - Intergenic
976577398 4:86689970-86689992 CTCAGAATTCCTCATCGGTAGGG + Intronic
977977293 4:103280613-103280635 CTCAAAACTGCTCAACTGCATGG + Intergenic
979432736 4:120650828-120650850 CTCAAAACTGCTCAACTGCATGG + Intergenic
980273645 4:130619866-130619888 CTCAGTAAGGCTCATCTAGCAGG + Intergenic
980294857 4:130899734-130899756 CTCAGATATGCAAATTTGGAAGG + Intergenic
982975160 4:162047459-162047481 CTTAGAAATGCTGCTCTGCATGG - Intronic
983317170 4:166147186-166147208 ACCAGAAATGCTCGTTTGGAAGG + Intergenic
983858977 4:172680689-172680711 CTCAGAAGTGCTCTTCTGTCAGG - Intronic
985078048 4:186237548-186237570 CTCAGAAATGGGCTTTTGGAGGG - Intronic
988908715 5:35817482-35817504 CTCAGAGATTCCCATCTCGAAGG - Intergenic
990007700 5:50963281-50963303 CTCCGAAGAGCTCATCTTGAGGG - Intergenic
990110157 5:52313426-52313448 CTCAGAATTGCTCAACTACATGG + Intergenic
990486767 5:56266955-56266977 TGAAGAAATGCTCATCTGGCTGG - Intergenic
992912459 5:81410066-81410088 CTCAGAAATTGTCATCTTGCCGG - Intergenic
995412525 5:111874677-111874699 CTCAGAACTGATGATTTGGAGGG - Intronic
996012801 5:118500066-118500088 CTCAAAACTGCTCAACTGCATGG - Intergenic
997237383 5:132280738-132280760 CTCAGAAATGTCCATCTTTAAGG - Intronic
999049245 5:148504342-148504364 CTCAAAACTGCTCAACTGCATGG + Intronic
999215882 5:149934703-149934725 CACAGAAATGCTCATCCTAAAGG + Exonic
999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG + Intronic
1000241096 5:159408900-159408922 TTTACAAATGGTCATCTGGAAGG + Intergenic
1003973720 6:11323418-11323440 CTCAGACATGATCCTCTGCAGGG + Intronic
1004147279 6:13079480-13079502 CTCAGAAAAGCTCATTTTCAAGG - Intronic
1004606433 6:17199537-17199559 CTCAGAAGGGCTCATCTGCTAGG + Intergenic
1004912006 6:20294717-20294739 CTTAGAAATGCTTAGCAGGATGG + Intergenic
1006139966 6:31922457-31922479 CTCAGAAATTTTCAGCTGCAAGG + Intronic
1007860474 6:44902879-44902901 CTCAGAACTGCTCAACTACATGG + Intronic
1009307243 6:62106070-62106092 CTCAAAACTGCTCAACTGCATGG - Intronic
1009564505 6:65294937-65294959 CTTAAAAAAGCTAATCTGGATGG + Intronic
1009579407 6:65512638-65512660 CTCAGAACTGCTCAACTACATGG + Intronic
1011188219 6:84702182-84702204 CTCAGAACTGCTCAACTACATGG + Intronic
1011953600 6:92998001-92998023 CTCAGAACTGCTCAACTACATGG + Intergenic
1013406541 6:109848874-109848896 CTCAGATAGGCTCAACTTGATGG - Intergenic
1016009487 6:139124346-139124368 CTCAGAGCTGCTCAACTGCATGG - Intergenic
1017701586 6:157078280-157078302 CTCAGAAATGCTCATGATTATGG - Intronic
1018040289 6:159915847-159915869 CTCAGAACTGCCCTCCTGGAAGG + Exonic
1020248369 7:6448054-6448076 CGCAGAAACGCTGATCCGGAAGG + Intronic
1021156629 7:17218041-17218063 CTCAAAACTGCTCAACTGCATGG + Intergenic
1021289291 7:18823313-18823335 GGTAGAAATGCTCATCTGAAAGG + Intronic
1023076139 7:36484200-36484222 CTCAGGAATGTGCATCTTGAGGG - Intergenic
1024116238 7:46196621-46196643 CTCAGAATGCCTCATCTGTAGGG - Intergenic
1029732094 7:102445216-102445238 CTCAGAGCTGCACACCTGGATGG - Intronic
1030344415 7:108416136-108416158 CTTAGTCATGCTGATCTGGAGGG - Intronic
1030792425 7:113745602-113745624 CTCAGAACTGCTCAACTACATGG + Intergenic
1030851574 7:114492704-114492726 CTCAAAACTGCTCAACTGCATGG - Intronic
1031678681 7:124643740-124643762 CTCAGACATGCTCATTTTGCAGG + Intergenic
1032772123 7:135069574-135069596 TTCAGAACTGCTCAACTGCATGG + Intronic
1034332379 7:150294121-150294143 CCCAGAAATTCTAATCTGGAAGG + Intronic
1034665658 7:152815757-152815779 CCCAGAAATTCTAATCTGGAAGG - Intronic
1035719584 8:1781787-1781809 CTCAGAGATGCTCGACTGCAGGG + Exonic
1036733436 8:11285296-11285318 ACCAGAAATGATCATCAGGATGG - Intronic
1038226472 8:25662837-25662859 CTCAGAAATTGACATGTGGAAGG + Intergenic
1038778887 8:30554317-30554339 TTGAGAAATGCTGGTCTGGAAGG - Intronic
1040364600 8:46702554-46702576 CTCAAAATTGCTCAACTGCATGG - Intergenic
1040764824 8:50894957-50894979 CACAGCAAGGCTTATCTGGATGG + Intergenic
1041286100 8:56263677-56263699 CTCAAAACTGCTCAACTGCATGG - Intergenic
1041889483 8:62852746-62852768 CTCAGAACTGCTCAACTACATGG - Intronic
1042006955 8:64191908-64191930 CTCTGAAGTGCTATTCTGGAAGG - Intergenic
1043960403 8:86411224-86411246 CTCAGAATTGATGATTTGGAGGG + Intronic
1046839915 8:118844785-118844807 CTCAGAAATTCTGATTTGGTTGG - Intergenic
1046962801 8:120127501-120127523 CTCTGAAATCCTCAGCTGGACGG - Intronic
1048678813 8:136815457-136815479 CTCAAAAAATCTCATCTGGATGG - Intergenic
1048795205 8:138143308-138143330 CTCAGGAACGCTCAGCTGGGAGG + Intronic
1050122260 9:2319708-2319730 CTCAGTAACTCTCATCTGTAAGG + Intergenic
1052700771 9:31935512-31935534 CTCAGAACTGCTCAACTACATGG - Intergenic
1055857664 9:80710261-80710283 CCCAGAAATCCCCCTCTGGATGG + Intergenic
1057162886 9:92903218-92903240 CTCAGAACTGCTCAACTACATGG - Intergenic
1057728149 9:97584293-97584315 CTCAAAACTGCTCAACTGCATGG - Intronic
1058066724 9:100556706-100556728 CTCAGAAACTCAGATCTGGAAGG - Intronic
1058250668 9:102691888-102691910 GACATAAATACTCATCTGGAGGG - Intergenic
1059581301 9:115551334-115551356 CTCAGAACTGCTAAACTGAAAGG - Intergenic
1059797483 9:117714559-117714581 CTCAGAAAAGCCCTGCTGGATGG + Exonic
1186227125 X:7411671-7411693 CTGAGAGATGCTGAGCTGGAGGG - Intergenic
1187435475 X:19264853-19264875 CTCACAAATGCCCATTTAGAGGG + Intergenic
1189029791 X:37438835-37438857 CTCAGAGGTTCTGATCTGGATGG + Intronic
1190420884 X:50283176-50283198 CTCAGAAATGCTAAGTTGGCTGG + Intronic
1190492313 X:50994269-50994291 CCTAGAAATCCTCATTTGGAAGG - Intergenic
1191195015 X:57711362-57711384 CTCAGAACTGCTCAACTACATGG + Intergenic
1191683302 X:63863670-63863692 CTCAGAACTGCTCAACTACATGG - Intergenic
1197539966 X:127746571-127746593 GTCAGAATTGCTCTTCTCGATGG + Intergenic
1198078574 X:133217365-133217387 CACAGAAGTGCTGATGTGGATGG - Exonic
1200022841 X:153226301-153226323 TGCAGAAATGCTCCTCTGTAAGG + Intergenic
1201053479 Y:9964897-9964919 CTCAGAACTGCTCAACTACATGG - Intergenic
1201392885 Y:13517709-13517731 CTCAAAACTGCTCAACTGCATGG - Intergenic
1202241613 Y:22776579-22776601 CTCAAAACTGCTCAACTGCACGG - Intergenic
1202331609 Y:23759107-23759129 CTCAGAACTGCTCAACTACATGG + Intergenic
1202361259 Y:24112935-24112957 CTCAAAACTGCTCAACTGCATGG - Intergenic
1202394596 Y:24410323-24410345 CTCAAAACTGCTCAACTGCACGG - Intergenic
1202476188 Y:25259769-25259791 CTCAAAACTGCTCAACTGCACGG + Intergenic
1202509519 Y:25557183-25557205 CTCAAAACTGCTCAACTGCATGG + Intergenic
1202539161 Y:25910953-25910975 CTCAGAACTGCTCAACTACATGG - Intergenic