ID: 1090229087

View in Genome Browser
Species Human (GRCh38)
Location 11:125088953-125088975
Sequence GTCTACTCCATTCCTAGAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090229087_1090229090 13 Left 1090229087 11:125088953-125088975 CCAGCTCTAGGAATGGAGTAGAC 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1090229090 11:125088989-125089011 AGGACTTACGCCCTGAGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 80
1090229087_1090229091 22 Left 1090229087 11:125088953-125088975 CCAGCTCTAGGAATGGAGTAGAC 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1090229091 11:125088998-125089020 GCCCTGAGCACAGGTGCCAATGG 0: 1
1: 0
2: 4
3: 42
4: 762
1090229087_1090229089 -7 Left 1090229087 11:125088953-125088975 CCAGCTCTAGGAATGGAGTAGAC 0: 1
1: 0
2: 0
3: 14
4: 95
Right 1090229089 11:125088969-125088991 AGTAGACAGTGGACACAAGAAGG 0: 1
1: 0
2: 1
3: 14
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090229087 Original CRISPR GTCTACTCCATTCCTAGAGC TGG (reversed) Exonic
907634427 1:56119088-56119110 CTGTACTCAATTCCTAAAGCTGG + Intergenic
909056316 1:70825393-70825415 GTCTTCTCCATTCCTACACCTGG - Intergenic
909722662 1:78794702-78794724 GTCTTCTCCAGTCCTGGAGATGG + Intergenic
910502168 1:87904974-87904996 ACCTGCTCCATTCCTAAAGCAGG - Intergenic
910896480 1:92075332-92075354 GTCTCCTCCAGTCCCAGAGCAGG + Exonic
912962682 1:114209946-114209968 CTCAACTCCGTTCCTAGGGCAGG + Intergenic
915156537 1:153881217-153881239 GTTGACTCCATTCACAGAGCAGG + Intronic
915953235 1:160204327-160204349 GTCTACACCATTCCTAGAAGAGG - Intergenic
922183248 1:223252776-223252798 GTCTTCTCCATTCCTAGGAAGGG - Intronic
1067163453 10:43846397-43846419 CTCCACCTCATTCCTAGAGCAGG + Intergenic
1069526982 10:69180795-69180817 GTCTAAACCATTCAGAGAGCAGG - Intronic
1074413154 10:113245046-113245068 GTCACCTACGTTCCTAGAGCGGG - Intergenic
1075472855 10:122705950-122705972 GTCAACTTCATTCAGAGAGCCGG - Intergenic
1077084426 11:741611-741633 GTCTACTCCATAGGCAGAGCAGG + Intergenic
1077599685 11:3565779-3565801 GTGTTCTCAATTACTAGAGCAGG + Intergenic
1078025480 11:7691268-7691290 GTCTCCTTCATTCCTAAAGCAGG - Exonic
1079099440 11:17531636-17531658 GTCTACTCCATTCCTAAGCCTGG - Intronic
1081766279 11:45612612-45612634 TTGTCCTCCATTCCTAGAGGTGG + Intergenic
1082934985 11:58647009-58647031 GTTTTCTCCTTTCTTAGAGCAGG + Intronic
1083447912 11:62722330-62722352 GTCTTCTCCATTCTTGGAGAAGG + Exonic
1086835015 11:91610046-91610068 TTCTACTCAATTCCTACAGATGG + Intergenic
1089196574 11:116696916-116696938 GTTTACTCCAGTCCTGAAGCAGG - Intergenic
1090229087 11:125088953-125088975 GTCTACTCCATTCCTAGAGCTGG - Exonic
1090660068 11:128875765-128875787 GGCTCCTGCATTCCAAGAGCTGG - Intergenic
1090903700 11:131055085-131055107 GTCTAGTCCCTTCCTCAAGCAGG - Intergenic
1091195839 11:133730066-133730088 GTCTCCTTTATTCCTACAGCTGG - Intergenic
1093070653 12:14704663-14704685 GCCTACTTCATTCATACAGCAGG + Intergenic
1095251765 12:39987400-39987422 GTCTACTCAATTTCTTCAGCTGG + Intronic
1095476414 12:42590620-42590642 GTCTGCTCAATTCCCAGAGCTGG + Intergenic
1097087410 12:56478591-56478613 CTATACACGATTCCTAGAGCAGG - Exonic
1104041376 12:125133569-125133591 GTGTATTCCATTCCAAGATCTGG + Intronic
1106896853 13:34312504-34312526 ATCAACCCCATTCCTAGAACTGG - Intergenic
1108275414 13:48804428-48804450 GTATACTCAATACCTAGAGCAGG + Intergenic
1114201877 14:20528881-20528903 GTCTCCTCCAGTCTCAGAGCAGG + Intergenic
1115869125 14:37779952-37779974 TTTTACTCTATTCCTAGAGCTGG - Intronic
1120671969 14:87372961-87372983 GTCAACTCTATTGCTAGAGCAGG + Intergenic
1122519357 14:102332522-102332544 GTCCCCTCCATCCCTAGAACAGG - Intronic
1126189617 15:45866082-45866104 GTCTACTTCAGTCTCAGAGCTGG + Intergenic
1126383239 15:48069065-48069087 GTCTACTCCACTGTTTGAGCTGG - Intergenic
1127852895 15:62929578-62929600 GATGACTCCATTACTAGAGCAGG - Intergenic
1127940355 15:63688986-63689008 GTCTCATCCATACCTAAAGCAGG - Intronic
1127979624 15:64024982-64025004 GTCTAATCCATTTCCAGGGCTGG - Intronic
1128116570 15:65111085-65111107 CTCCACTCCATGCCTAGAGCTGG + Intronic
1128733125 15:70034262-70034284 CTCTGCACCATTCCCAGAGCAGG - Intergenic
1130312779 15:82769721-82769743 GGCTACTCATTTCCTATAGCAGG - Intronic
1132407622 15:101553663-101553685 GTCTTTTCCATTTCTAGAGGCGG + Intergenic
1133490451 16:6262949-6262971 GTCTACTCCACATCTAAAGCGGG - Intronic
1135180793 16:20272528-20272550 GTCTACTTCATTCTAAGTGCAGG + Intergenic
1149038794 17:52161985-52162007 GGCTACTACATTTCTAGAGTAGG + Intergenic
1149829659 17:59861097-59861119 CTTCACTCCATTCCTAGAACTGG - Intronic
1151582278 17:74987337-74987359 GGCTACTCACTTCCTAGAACAGG - Intergenic
1153237070 18:2998435-2998457 GTCTATTCTATTCTGAGAGCTGG + Intronic
1155932143 18:31719293-31719315 ACATACTCCATTCCCAGAGCAGG + Intergenic
1159558255 18:69967447-69967469 GTCTAATACATTGCTAGAGAGGG + Intergenic
1162250854 19:9442470-9442492 GTCTACTCCATCACCAAAGCTGG + Intergenic
1163869788 19:19810835-19810857 TCCTACTGCATTTCTAGAGCTGG - Intronic
1165557841 19:36650929-36650951 ATCTACAAAATTCCTAGAGCTGG + Intronic
930778368 2:55197421-55197443 ACCTACTACATTCCCAGAGCTGG + Intronic
935424255 2:102903591-102903613 GTATAATCCTTTCCTAGAGAGGG + Intergenic
939576624 2:143902932-143902954 GTATCCTGCATGCCTAGAGCAGG - Intergenic
944606820 2:201359187-201359209 GTCAACTCAATTGCTCGAGCTGG - Intergenic
944878434 2:203986608-203986630 TTCTACTTCATTCTTAGAGATGG + Intergenic
1176655164 21:9581561-9581583 CTATACTCCATTACTGGAGCAGG + Intergenic
1182857919 22:33534590-33534612 GTCAACTGCAATCCTAGGGCTGG + Intronic
1183299601 22:37052271-37052293 GTCGACTCCTTCCCCAGAGCAGG - Intronic
951040238 3:17981601-17981623 GTCTCCTGCACTCCCAGAGCTGG + Intronic
955313803 3:57917805-57917827 GGCTTCTCCATTCCCCGAGCTGG - Intronic
957070501 3:75564411-75564433 GTGTTCTCAATTACTAGAGCAGG + Intergenic
957496643 3:81000250-81000272 GTCTCCTCCATTCATTGATCTGG + Intergenic
969739862 4:9016340-9016362 GTCTTCTCAATTACTAGAGCAGG - Intergenic
969974160 4:11080985-11081007 TTATATTCCCTTCCTAGAGCAGG + Intergenic
971171781 4:24241034-24241056 GTCTTGACCATTCCTACAGCTGG - Intergenic
976552682 4:86414292-86414314 ATGTACTCCATTCCTGGAGCTGG - Intronic
977437920 4:97023588-97023610 GTCTTCTCCATTCCTAGCACCGG + Intergenic
984954925 4:185035819-185035841 GTCTTCTCTATTCCTGCAGCTGG + Intergenic
985572881 5:659616-659638 GGCTACACCAGTGCTAGAGCAGG + Intronic
986146122 5:5079421-5079443 GGCTACTCCATAGGTAGAGCAGG + Intergenic
987910333 5:24135275-24135297 TACTACTCCAATCCTAAAGCAGG - Intronic
990873598 5:60460660-60460682 GTCTCCTCCGGTCCCAGAGCAGG + Intronic
994207958 5:97057182-97057204 GTCTTCTCCGGTCCCAGAGCAGG + Intergenic
994886416 5:105567545-105567567 ATCTCCTCCCTTCCTGGAGCTGG - Intergenic
1001053417 5:168430487-168430509 CACCACCCCATTCCTAGAGCTGG - Intronic
1001485627 5:172117625-172117647 TTCTCCTCCATTTCCAGAGCTGG - Exonic
1001882909 5:175260028-175260050 GGCTACTTCATTCCAAGACCTGG - Intergenic
1004770140 6:18771970-18771992 GCCTACTCCATCCCCATAGCTGG - Intergenic
1006106808 6:31721739-31721761 GGCCACTCAACTCCTAGAGCTGG - Exonic
1010171018 6:72975543-72975565 GTCTTCTCTATTCCTTGGGCAGG + Intronic
1013271711 6:108551511-108551533 GTTTACTCCATTTCTAGATATGG + Intergenic
1013819604 6:114138699-114138721 ATGTATTCCATTCCAAGAGCAGG - Intronic
1015891692 6:137976360-137976382 GTCTATTCCATTCTTGTAGCGGG + Intergenic
1018743092 6:166744878-166744900 GTAGACTCCATTCCCAGAGCCGG - Intronic
1019442994 7:1056755-1056777 TTCTACTCCACTCCGAGAGTAGG + Intronic
1020950404 7:14668891-14668913 GCCTATTCCATTCATAAAGCTGG + Intronic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1032263797 7:130356491-130356513 GTTTGCTCCATTCCTGGGGCTGG - Intronic
1034753899 7:153596440-153596462 CTCTTCTCCATCCCCAGAGCCGG + Intergenic
1036255849 8:7206201-7206223 ATGTTCTCCATTACTAGAGCAGG + Intergenic
1036361636 8:8081298-8081320 ATGTTCTCCATTACTAGAGCAGG - Intergenic
1044953826 8:97459436-97459458 CTCCACTCCAATCCTTGAGCTGG + Intergenic
1049252894 8:141598666-141598688 GTCTCTTCCATCCCTACAGCAGG + Intergenic
1050428465 9:5536679-5536701 GCCTACTCCTTACCTAGATCAGG + Intronic
1054758029 9:68978607-68978629 GCCTACTTCATTCCAAGTGCTGG - Intronic
1057750771 9:97791011-97791033 GTCCACTCCCTTGCTGGAGCAGG - Intergenic
1061127089 9:128683953-128683975 GTCTCCTCCGGTCCCAGAGCAGG - Exonic
1203632887 Un_KI270750v1:85033-85055 CTATACTCCATTACTGGAGCAGG + Intergenic
1186928771 X:14364053-14364075 GTGTACTCCATTTCTAGCCCTGG - Intergenic
1193448002 X:81628922-81628944 ATTCACTCCATTGCTAGAGCTGG - Intergenic
1193700522 X:84755193-84755215 GTCTCCTCCGGTCCCAGAGCAGG - Intergenic
1195595117 X:106680132-106680154 GTCCACTCCATGCCTAGCACTGG + Intergenic
1201554522 Y:15254694-15254716 GTCTCCTCCCTTACTGGAGCTGG - Intergenic