ID: 1090230571

View in Genome Browser
Species Human (GRCh38)
Location 11:125100191-125100213
Sequence GGGCAGTCCCAGAGAGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090230571_1090230574 21 Left 1090230571 11:125100191-125100213 CCATGAGCTCTCTGGGACTGCCC 0: 1
1: 0
2: 1
3: 26
4: 269
Right 1090230574 11:125100235-125100257 AACACTGAAGATTTTGAAGACGG 0: 1
1: 1
2: 3
3: 58
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090230571 Original CRISPR GGGCAGTCCCAGAGAGCTCA TGG (reversed) Intronic
900697558 1:4021672-4021694 GGGCAGAGCCAGAGAGCCCGCGG + Intergenic
902718116 1:18286661-18286683 AGGGAGTCCCAGACAGATCAGGG + Intronic
903327932 1:22582017-22582039 GGGCAGCTCCAAAGAGGTCAAGG - Intronic
905330300 1:37190455-37190477 GGGGATTTCCAGAGATCTCAGGG - Intergenic
910935581 1:92483191-92483213 GGGCAGGCGCAGAGAGGCCATGG + Intronic
911107466 1:94146260-94146282 GGGCAATCGCATAGAGCTCTAGG - Intergenic
912419896 1:109535853-109535875 GAAAAGTCCCAGAGAGCTCCTGG - Intergenic
912561776 1:110556248-110556270 GAGCAGCCTCTGAGAGCTCAGGG - Intergenic
912952126 1:114127440-114127462 GGGCAGTCCCAGAAAAGTCAAGG + Intronic
913220240 1:116654323-116654345 CTGCAGTCTCAGAGGGCTCACGG + Intronic
914400637 1:147316797-147316819 GGTCAGGCCCAGGGAGATCAGGG - Intergenic
915231777 1:154451138-154451160 GAGCAGTCACAGAAAGCTCATGG + Intronic
915916659 1:159944659-159944681 GGGCAGTCTCAGAGAGCCAGAGG + Intronic
916582808 1:166123704-166123726 GGGCAGTTCCTGGGATCTCAGGG + Intronic
917452714 1:175160536-175160558 GGGCAGTCCCAGGGACCACGTGG - Exonic
917475545 1:175366112-175366134 TGACAGTCCCCGAGACCTCATGG - Exonic
917641786 1:176990011-176990033 AGGCAGTCCAAGAAAGCTGAAGG - Intronic
917749021 1:178037843-178037865 AGGCAGTCCCAGGGTGCTCCCGG - Intergenic
918385625 1:184004800-184004822 TGGGAGTCACAGAGAGCACAGGG + Intronic
922597070 1:226822274-226822296 GAGCAGTCACTGAGATCTCAGGG - Intergenic
922616547 1:226964443-226964465 TGGCCGTCCCTAAGAGCTCAGGG - Intronic
924792563 1:247266352-247266374 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1063679688 10:8175077-8175099 AGGCAGTCCCAGAGAGCTCCTGG - Intergenic
1065236252 10:23655439-23655461 GGAGAGTTCCAGAGAGCCCATGG + Intergenic
1065513876 10:26506025-26506047 GGGCAGGCCTAGAGTGCTTAAGG - Intronic
1066229982 10:33422745-33422767 GGGGATTCTCAGAGAGCCCACGG - Intergenic
1067145131 10:43689055-43689077 GGCCTGGCCCAGAGAGCTCTTGG + Intergenic
1068322809 10:55441899-55441921 GGGCACACACAGAGAGCACAAGG + Intronic
1069489541 10:68849594-68849616 GGGAGGACCCAGGGAGCTCAGGG + Intronic
1073075942 10:100826000-100826022 GGGGAGCCGCAGAGAGCTCGTGG + Intronic
1073475596 10:103750641-103750663 GGGGAGGCTCAGAGAGCTGATGG + Intronic
1075264432 10:120988705-120988727 GGGCAGAGACAGAGAGGTCAGGG - Intergenic
1075731770 10:124640654-124640676 GGGCGATCCCATGGAGCTCAGGG - Intronic
1076921327 10:133456088-133456110 AAGCAGTCCCAGAGAGGTGATGG - Intergenic
1076924508 10:133475685-133475707 AGGCAGTCCCAAAGACCTCCTGG - Intergenic
1077107691 11:849161-849183 GGACAGACCCAGAGCGCTCCAGG - Intronic
1077156411 11:1093974-1093996 GTGCAGGGCCAGAGAGCTCAGGG - Intergenic
1077164166 11:1127605-1127627 GGGCAGTGACCCAGAGCTCAGGG - Intergenic
1077468077 11:2743166-2743188 GGGCATTCCCAGAAATCACAGGG + Intronic
1077889957 11:6411593-6411615 GTGCCATCCCAGAAAGCTCAGGG - Intronic
1079362121 11:19777794-19777816 GTGCAATCCAAGAGAGCTCCAGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083621987 11:64053728-64053750 CAGCAGTCCCAGAGAGCGGAAGG - Intronic
1084549640 11:69833551-69833573 GAGCTCCCCCAGAGAGCTCATGG + Intergenic
1085996945 11:81929328-81929350 TGGCAGTCCTAGAGAACACATGG + Intergenic
1088968450 11:114749762-114749784 GGGCATTCCCACAGAGGTGACGG - Intergenic
1089111603 11:116062029-116062051 GGGCAGTCCCAGACAAACCAGGG - Intergenic
1090230571 11:125100191-125100213 GGGCAGTCCCAGAGAGCTCATGG - Intronic
1090278002 11:125432883-125432905 GGGAAGCCCCAGAGGGCCCAAGG - Exonic
1092172706 12:6383865-6383887 AGGGAGTTCCAGAGAGCGCAAGG - Intronic
1094249759 12:28346687-28346709 TGGCAATCCCAGGGAGCACATGG - Intronic
1096674869 12:53221049-53221071 GGGGGTTCCCAGAGAGTTCACGG - Intronic
1100646455 12:96537087-96537109 GAGCAGCCTCAGAGAGCTCCAGG + Intronic
1102686952 12:114732356-114732378 GGGCAGAGCCAGAGGCCTCATGG + Intergenic
1102754320 12:115324729-115324751 GGGCAGTCACAGAGATTTCATGG + Intergenic
1103561789 12:121796657-121796679 GGCCTGTCCCCGAGTGCTCATGG - Intronic
1103567187 12:121822769-121822791 GGGCACTTGCGGAGAGCTCAGGG - Exonic
1103676683 12:122661352-122661374 GGGCAGTCCCAGCAACCTCAGGG - Intergenic
1104932717 12:132348239-132348261 GGGACGGCCCAGAGAGCTGAAGG - Intergenic
1105307900 13:19181834-19181856 GGCCAATCCCAGACAGCGCACGG - Exonic
1108144693 13:47464076-47464098 GCTCAGGCCCAGAGAGATCACGG - Intergenic
1110407837 13:75170367-75170389 GGGCAGTGCCTGAGTGCTAATGG + Intergenic
1110703722 13:78580179-78580201 GTCCAGTTCCAGAGAGCTGAGGG - Intergenic
1110852912 13:80264867-80264889 GGGTGGGCCCACAGAGCTCAGGG - Intergenic
1111567593 13:90036123-90036145 GGGTAGTGCAAGAGAGCTGAGGG + Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1113630573 13:111880347-111880369 AGGCAGGCACAGGGAGCTCAGGG - Intergenic
1113719072 13:112539239-112539261 GGGAAGGCCCAGAGAGGTGAAGG + Intronic
1114665685 14:24376098-24376120 GGGCTGTCCCAGAGCGCACCAGG - Exonic
1117788134 14:59308980-59309002 TGGCAGTCCCAGGGACCACATGG + Intronic
1118507590 14:66430567-66430589 GGGCTGTCCAAGAGACTTCAGGG - Intergenic
1119064482 14:71511865-71511887 GGACAGCCTCAGAGAGCTCCCGG + Intronic
1119303898 14:73591817-73591839 GAGCAGTCCCAGAAAGCCCCTGG - Exonic
1121321319 14:92993317-92993339 AGGCAGAGCCAGAGAACTCAAGG - Intronic
1121408664 14:93734571-93734593 GGGCAGGCCCAGAGAGCAAGTGG - Intronic
1121422073 14:93823444-93823466 GGGTAGTGCGAGAGAGCTCTGGG - Intergenic
1122398278 14:101450720-101450742 GGCCAGGCCCAGAGGGGTCAGGG - Intergenic
1122824780 14:104364340-104364362 GATCAGTCCCAGAGGGATCAGGG - Intergenic
1122958941 14:105085782-105085804 GGCCAGTCCCAGTGAGAGCAGGG - Intergenic
1122987201 14:105217956-105217978 GGGCAGGCCCAGAGAGCACCAGG - Intronic
1123053813 14:105560053-105560075 AGGCAGGCCCAGACAGCCCAGGG + Intergenic
1123078396 14:105680470-105680492 AGGCAGGCCCAGACAGCCCAGGG + Intergenic
1123122927 14:105926472-105926494 GTGCAGGCCCACAGAGCTCGAGG - Intronic
1126119959 15:45242618-45242640 GGGCAGAGCCTGAGAGCTCTGGG - Intergenic
1129165586 15:73775393-73775415 GGGCAGTCCCTGAGGGCTGTGGG + Intergenic
1129610034 15:77045672-77045694 GGGGAGTTCCGGAGAGGTCAGGG - Exonic
1130104924 15:80921952-80921974 GTTCAGCCCCAGAGAGCTCCTGG - Intronic
1133275751 16:4637596-4637618 GGGAAGTCCCAGTAACCTCAGGG + Intronic
1134036656 16:11036313-11036335 GAGCAGACCCAGAGAGGTCTGGG - Intronic
1134662016 16:15991441-15991463 GAGTAGCCCCAGCGAGCTCAGGG + Intronic
1135421506 16:22308391-22308413 GGGCAGCTCCAGAGAGGCCAGGG + Intronic
1136178944 16:28537974-28537996 CGGGGGGCCCAGAGAGCTCAAGG - Intronic
1136494546 16:30634346-30634368 GGGCAGTGCCAGTGCGCTGAAGG - Intergenic
1138419969 16:56892718-56892740 GGGCAGTCCCAGAGCCCTCTGGG - Intronic
1138497436 16:57416773-57416795 GGGCAGTCCCTAAGAGCTGGGGG - Intergenic
1139530816 16:67541947-67541969 GGGCAGTGCCTGAGAGCTGTGGG - Exonic
1141719291 16:85746732-85746754 GACCAGGCCCAGAGAGCTGAAGG - Intronic
1142433501 16:90043162-90043184 GGGCAGTGTCAGGGAGCTGAGGG - Intronic
1142509287 17:384514-384536 GGGCATTCCCAGAGGACTCCTGG + Intronic
1144576638 17:16433804-16433826 GGGCAGGCCCAAAGAGCACCAGG + Intronic
1146213224 17:30958022-30958044 GGGAAGGCCCAGGGAGCTGATGG - Exonic
1147726674 17:42569871-42569893 TGGCAGCCCCAGAGAGCTTCTGG - Intronic
1147970551 17:44217469-44217491 ATGCAGCCCCAGAGAGCTCTAGG + Intronic
1148655311 17:49278834-49278856 CTGCAGTCCCAGAGAATTCAGGG + Intergenic
1150630466 17:66877032-66877054 GGGGACTCCCAGAGAGGACAAGG + Intronic
1151718968 17:75845006-75845028 GCCAAGTCCCAGAGAGCTCTGGG + Intergenic
1152382057 17:79947194-79947216 GGACTGCCCCAGAGACCTCAGGG + Intronic
1153478646 18:5524597-5524619 AGGCTGTGCCAGAGATCTCAAGG + Intronic
1156467280 18:37355826-37355848 GGGCAGTGGCACAGAGCCCAGGG - Intronic
1156704854 18:39868336-39868358 GGGAAGTCACATAGAACTCAAGG + Intergenic
1161226054 19:3146471-3146493 GGGCTGTCCCAGAGGGTTCCAGG + Intronic
1162480056 19:10922545-10922567 GGGCAGACACAGACACCTCAAGG + Exonic
1162554428 19:11378078-11378100 GGGGACTCCCAGGGAGCCCAAGG - Exonic
1162955394 19:14094972-14094994 GCGCAGGCCCAGAGAGGTTAAGG - Intronic
1163145285 19:15375398-15375420 GGGCAGAGCCTGAGAGCACAGGG - Intronic
1163364590 19:16868947-16868969 GGGCAGAGGCAGAGAGGTCACGG + Intronic
1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG + Intronic
1164830581 19:31317181-31317203 GGGCATGCCCAGAGAGCTGGAGG - Intronic
1165533201 19:36421394-36421416 GAGCAGTCCCAGAAAGCGCCTGG - Intergenic
1165603401 19:37078212-37078234 GGGCACTCCCAGAAACCTCCGGG + Intronic
1165908979 19:39212314-39212336 AGCCAGGCCCAGAGAACTCAGGG + Intergenic
1168361893 19:55748227-55748249 AGGCAGTCCCAGAAATTTCATGG - Intergenic
929602144 2:43211041-43211063 GAGCAGTCCCAGTGGGCTCAGGG - Intergenic
930050141 2:47208957-47208979 GGGAGGTCAGAGAGAGCTCAGGG - Intergenic
930053575 2:47235429-47235451 GGCCAGAGCCAGAGAGCCCATGG - Intergenic
930139528 2:47937537-47937559 GGGCAGTCAGAGAGAGCTGATGG + Intergenic
930502245 2:52235955-52235977 GGGCAGACCCAGAAAGCTTTTGG - Intergenic
931164631 2:59733375-59733397 GGCAAGTCCCAGAGAGCCCTGGG - Intergenic
931271526 2:60708071-60708093 GGGCAGTTACAGATAGGTCAAGG - Intergenic
932651904 2:73566983-73567005 TGGCAGGCCCAGAGAGGACATGG - Intronic
932666864 2:73705197-73705219 GGAGAGCCCCAGGGAGCTCAAGG + Intergenic
933274185 2:80266303-80266325 GGGCACACAGAGAGAGCTCATGG + Intronic
934521094 2:95020701-95020723 GGGCAGACCCAGAAAGGCCAGGG - Intergenic
934942049 2:98509878-98509900 GGGCTGTCCCAAAGAACTCCAGG + Intronic
935606866 2:104980404-104980426 GTGGATTCCCAAAGAGCTCAGGG + Intergenic
936467202 2:112764345-112764367 GCGCAGGCCCAGATACCTCACGG - Intronic
937701103 2:124863779-124863801 GGGCAGGCTGAGAGAGTTCAGGG + Intronic
938972292 2:136443511-136443533 GAGCAGGCCCAAAGTGCTCATGG + Intergenic
940134924 2:150425221-150425243 GCGCAGGAACAGAGAGCTCAAGG - Intergenic
942044336 2:172090657-172090679 AGGCAGTCCCGGAGAGCTGCGGG + Intergenic
942806126 2:179932940-179932962 GGTCAGTGCCAGACAGCTCAAGG + Intergenic
945119028 2:206440006-206440028 AGGCTGTCCCAGCGAGCTCCTGG + Intergenic
946494625 2:220183514-220183536 GGGCAGTCTCAGAAAGCCTATGG - Intergenic
947444069 2:230149764-230149786 TGGCTGTCACAGAGAGCACAGGG + Intergenic
947757213 2:232575291-232575313 GGCCAGGGCCTGAGAGCTCAGGG + Intronic
947866404 2:233400681-233400703 GGGCTACCCGAGAGAGCTCAGGG - Intronic
948439895 2:237979914-237979936 GTGCAGGCCCACAGTGCTCATGG - Intronic
948757771 2:240169203-240169225 GGTCAGGCCCAGAGGGCTCCTGG + Intergenic
949066543 2:241994148-241994170 GGGCAGGCCCAGCAAGCTCAGGG + Intergenic
1169753777 20:9022547-9022569 GGGCAGTCATAGACAGCTGAGGG + Intergenic
1169857070 20:10114302-10114324 GGACAGTCCCAGGGAGTTCTGGG + Intergenic
1170603594 20:17859859-17859881 AGGCAGTCCTTGAGAGCCCAGGG + Intergenic
1170876298 20:20253454-20253476 GGCCAGACTCACAGAGCTCAGGG - Intronic
1171239292 20:23551946-23551968 AGGGAGGCCCAGAAAGCTCAGGG - Intergenic
1172136469 20:32689921-32689943 AGGAGGTCCCAGAGAGCTGAGGG + Intergenic
1172787654 20:37479846-37479868 TGGCAGTGGCAGGGAGCTCAGGG - Intergenic
1173428064 20:42959833-42959855 GGGGAGTCCAAGAGAGAACAAGG + Intronic
1173529077 20:43754708-43754730 GGGCAGACCCAGTGAGGTCACGG - Intergenic
1174734258 20:52949954-52949976 GGGCATTCCCATAAAGCACAGGG + Intergenic
1174973579 20:55305719-55305741 GCGCAGGCCCAGGGAGATCAGGG - Intergenic
1175716403 20:61257191-61257213 GAGCAGTCGCTGATAGCTCATGG - Intronic
1179951898 21:44712908-44712930 GGGGAGGCACAGAGAGCTCCTGG + Intergenic
1180073150 21:45448780-45448802 GGGCAGTCCCAGAGCCGTCAGGG + Intronic
1180226797 21:46398306-46398328 GGACAGTCCCAGCGAGCGCAGGG - Intronic
1180821540 22:18832342-18832364 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1181191438 22:21143703-21143725 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1181207760 22:21266807-21266829 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
1182101207 22:27658819-27658841 GGGGAGGCCCAGAGACATCAAGG - Intergenic
1182464386 22:30505498-30505520 GGGCAGTGCCAGGCTGCTCAGGG + Intronic
1183291441 22:37004157-37004179 GGGCAGTGCCAGAGGGCACCAGG - Intronic
1183456000 22:37923735-37923757 GCAGAGTCCCAGAGAGCTCGGGG - Intronic
1183597495 22:38821567-38821589 GGCCAGGCCCAGAGAGGGCAGGG + Exonic
1184045492 22:41970129-41970151 AGTCAGTTCCAGAGGGCTCATGG - Intergenic
1184147606 22:42620433-42620455 GGGGAGTCACAGTGGGCTCATGG - Intronic
1184838425 22:47037765-47037787 GTGAATTCCCAGAGAGCTCAAGG - Intronic
1184914459 22:47559503-47559525 GGGCTGCCCCTGGGAGCTCAGGG + Intergenic
1184997053 22:48215025-48215047 GGCCAGTCACAGAGGGCTCGGGG + Intergenic
1203219160 22_KI270731v1_random:28609-28631 CTGCAGTCTCAGAGGGCTCACGG - Intergenic
1203271665 22_KI270734v1_random:58218-58240 CTGCAGTCTCAGAGGGCTCACGG + Intergenic
953269257 3:41424261-41424283 GCTCAGTCCCAGGGAGATCAGGG - Intronic
953561554 3:43996740-43996762 GGGCGGTCCCGGAGCGCACACGG - Intergenic
954300968 3:49700584-49700606 GGCGAGTCCCAGGGGGCTCAGGG - Intronic
954652845 3:52175863-52175885 GGACAGTCCCTGAGAGGTAAGGG - Intergenic
955959029 3:64320076-64320098 GGGCATTCACACAGAACTCATGG + Intronic
958445970 3:94215561-94215583 TGGCATACCCAGAGAGCACATGG + Intergenic
958911789 3:100002105-100002127 GGTCAGTCCCAGTGAGCTTTGGG - Intronic
959339096 3:105105557-105105579 GGGCAGTCCAAGACACCACAGGG + Intergenic
960009934 3:112822570-112822592 TGGCACTCCCAGAGACATCACGG + Intronic
962084014 3:132171862-132171884 GTTCAGTTTCAGAGAGCTCACGG + Intronic
962183213 3:133230452-133230474 TGGCAGTCCCATAGAACACATGG - Intronic
962526802 3:136244421-136244443 GCGCTTTCCCAGAGAGCCCAGGG + Intergenic
964269875 3:154944463-154944485 GGGCAGAGCCTGAGAGCTCTGGG - Intergenic
966885135 3:184373317-184373339 GGGCTCTTCCAGGGAGCTCAAGG - Intronic
967310690 3:188103435-188103457 GGGCAGTCCCTAGAAGCTCAAGG + Intergenic
968261861 3:197331774-197331796 GGGCAGTGGCAGAGAGCAAACGG + Intergenic
968548999 4:1212917-1212939 AGGCAGCCCCATTGAGCTCAGGG + Exonic
968973668 4:3810173-3810195 GGGCAGGCACTGAGTGCTCACGG - Intergenic
969272809 4:6114328-6114350 GGGCAGCCCCAAAGAGGTCAAGG + Intronic
969518077 4:7659721-7659743 GGGCAGTCTGTGAGAGCACAGGG + Intronic
969657128 4:8504839-8504861 GTTCAGCCCCAGGGAGCTCAGGG - Intergenic
972106368 4:35494046-35494068 GGGCCTTCCCAGAGAGCACAGGG - Intergenic
973314570 4:48746642-48746664 AGGCAGTCACAGACTGCTCAGGG - Intronic
973878925 4:55249227-55249249 CAGCAGCCCCAGAGAGCTCACGG - Intergenic
974359420 4:60857247-60857269 GCTCAGTCCTAGAGAGCTCCAGG + Intergenic
981252541 4:142621348-142621370 GGCCAGTCCTAAATAGCTCATGG + Intronic
982341313 4:154302325-154302347 GCGCAGTCACAGGGAGCGCAAGG - Intronic
983435661 4:167711748-167711770 GGGTATTGACAGAGAGCTCAGGG - Intergenic
985575122 5:670324-670346 CTGCAGGCCCAGAGAGCCCAGGG - Intronic
985665660 5:1180555-1180577 GAGCAGTCACAGAAAGCTCCCGG + Intergenic
987066675 5:14296694-14296716 AGGCAGTCACAGAGAACTGAGGG - Intronic
987946877 5:24621243-24621265 AGCCAGTCCCAGAGATCTCAGGG - Intronic
988501455 5:31787125-31787147 GGGCAGTCACAGTGACCTCATGG + Intronic
988551541 5:32204869-32204891 GGGCAGTCCCAGGGAGCAAGGGG + Intergenic
990694596 5:58401837-58401859 GGTCAGACCCAGAGTGGTCATGG - Intergenic
991767227 5:69998367-69998389 GGGCATTCCCAGAAACATCAAGG + Intergenic
991846461 5:70873445-70873467 GGGCATTCCCAGAAACATCAAGG + Intergenic
993126827 5:83845652-83845674 GGGTACTCCCAGAGAGTCCAGGG - Intergenic
993932375 5:93955745-93955767 AGGCAGTCCCACACAGCTGAGGG - Intronic
994823980 5:104689164-104689186 GGGTAGATCCAGATAGCTCAAGG - Intergenic
996707461 5:126512072-126512094 GGGCAGACTCTGAGAGATCAGGG - Intergenic
996884243 5:128337515-128337537 TGGCAGCCCTACAGAGCTCAGGG + Intronic
999247403 5:150162453-150162475 TCCCAGTCCCAGAGAGCACAGGG + Intergenic
1001260305 5:170222588-170222610 GGGTTTGCCCAGAGAGCTCATGG + Intergenic
1002065917 5:176651587-176651609 GGGCAGCAACAAAGAGCTCAGGG - Intronic
1004338934 6:14790015-14790037 GGAAAGGCCCAGAGTGCTCAGGG + Intergenic
1004608769 6:17218918-17218940 GAGCAGTGACAGAGAGTTCAGGG - Intergenic
1006358315 6:33573544-33573566 AGGAGGTCCCAGAGAGCTGAGGG + Exonic
1007234990 6:40384181-40384203 GGGAAGTGGCAGAGAGCACATGG - Intergenic
1007406201 6:41637617-41637639 AGGCAGTCCAAGAGGGTTCAGGG - Intronic
1007619476 6:43203321-43203343 GAGCAGTTCTAGGGAGCTCAGGG + Intronic
1007739745 6:44003212-44003234 GGGCAGTCCCAGAGGGCGGCAGG - Exonic
1008428074 6:51382167-51382189 AGGAAGACACAGAGAGCTCAAGG + Intergenic
1013515105 6:110877469-110877491 GGCCAGCCCCAGAGACCCCAGGG + Intronic
1019530460 7:1500451-1500473 GGGCCGACCCTGAGAGCTCTGGG - Intronic
1020939196 7:14509673-14509695 GGGCAGAGCCCGAGAGCTCTGGG + Intronic
1023805862 7:43872530-43872552 GGGCTCACCCAGAGTGCTCAGGG + Intronic
1023851487 7:44152652-44152674 GGACAGTCACCGAGAGCCCAGGG + Intronic
1024479671 7:49850928-49850950 TGGCAGCCCCAGGGAGCTAATGG - Intronic
1024617471 7:51127753-51127775 GAGCAGTCCCAGAGAGCAAAGGG + Intronic
1024866593 7:53910483-53910505 TGGATGTCCCAGAGAGCACAGGG + Intergenic
1024952543 7:54879771-54879793 GCCCAGGCCCAGAGAGCACAGGG + Intergenic
1028196374 7:87912346-87912368 GAGCAGGACCAGAGAGCTCAAGG - Intergenic
1029669846 7:102022052-102022074 GGGGAGTGGAAGAGAGCTCATGG + Intronic
1031214267 7:118870394-118870416 GGGCATTTTCAGAGATCTCAGGG + Intergenic
1033267944 7:139902226-139902248 GGGTAGTTCTAGAGAGCTTATGG - Intronic
1033441055 7:141379119-141379141 TGGCAGTCCAACAGAGCTTATGG - Intronic
1034438474 7:151074926-151074948 GGGCAATCCCAGGGACCTCAGGG + Intronic
1035043584 7:155948795-155948817 GGGCAGCTCCACAGAGCTGATGG - Intergenic
1035322801 7:158044556-158044578 AGGCAGGCACAGAGAGCTCGGGG + Intronic
1035569195 8:660839-660861 GAGCAGTCCCATATAGCTCATGG - Intronic
1038394530 8:27237098-27237120 GTGCTGCCCCAGGGAGCTCAGGG + Intronic
1038687154 8:29729044-29729066 GGAGAGTCCCAGGGAGCACAGGG - Intergenic
1039597868 8:38807098-38807120 TGGCATTCCCAGAGAGGGCATGG - Intronic
1043295318 8:78654522-78654544 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1044077990 8:87846858-87846880 GGGCAGCCCCACAGAGCTCTGGG - Intergenic
1044965613 8:97571112-97571134 TGTCAGACACAGAGAGCTCATGG + Intergenic
1045423798 8:102042881-102042903 TGCCAGGCCCAGAGAGTTCAAGG + Intronic
1047418707 8:124687577-124687599 TGGCACACGCAGAGAGCTCAAGG + Intronic
1047509659 8:125506426-125506448 GGGCAGCCCAGGAGAGCTGAGGG - Intergenic
1047759816 8:127945913-127945935 AAGGAGGCCCAGAGAGCTCATGG - Intergenic
1047760619 8:127951366-127951388 GTGCACTAGCAGAGAGCTCAGGG + Intergenic
1048622630 8:136151537-136151559 GGCCAGCCAAAGAGAGCTCAGGG - Intergenic
1049016360 8:139922831-139922853 GCTCAGGCCCAGAGAGCTGAAGG + Intronic
1049751934 8:144289023-144289045 TGGCAGTCTCAGAAAGCCCAAGG + Intronic
1049783783 8:144440875-144440897 GGGCAGTGCCAGTGAGGCCAGGG + Intronic
1049877229 8:145032565-145032587 GGGCAGAGCCTGAGAGCTCTGGG + Intergenic
1050431417 9:5566001-5566023 GCTCAGGCCCAGACAGCTCAGGG + Intronic
1052320852 9:27165782-27165804 GGGCAAACCCAGAGAGAGCACGG - Intronic
1053165393 9:35840804-35840826 GGGCTGGCCCAGAATGCTCAGGG + Intronic
1053802845 9:41775101-41775123 GGCCTGACCCAGAGAGCCCATGG + Intergenic
1054142402 9:61539969-61539991 GGCCCGACCCAGAGAGCCCATGG - Intergenic
1054191150 9:61986447-61986469 GGCCTGACCCAGAGAGCCCATGG + Intergenic
1054462146 9:65471119-65471141 GGCCCGACCCAGAGAGCCCATGG - Intergenic
1054647219 9:67601270-67601292 GGCCTGACCCAGAGAGCCCATGG - Intergenic
1055250322 9:74295516-74295538 GGCCACTCCTTGAGAGCTCAAGG - Intergenic
1056180614 9:84078816-84078838 GAGCAGGCCCAGAAAGCTGAAGG + Intergenic
1056871674 9:90287686-90287708 GGGAATCCCCAGAAAGCTCAGGG + Intergenic
1059250222 9:112881546-112881568 GGGCAGCCCCAGGCAGCTCTGGG + Intronic
1059664935 9:116437643-116437665 GGGCTTTCCCACAGGGCTCAGGG - Intronic
1060259208 9:122059008-122059030 AGCCAGTCCCAGAGTGCTTAAGG - Intronic
1062148107 9:135001920-135001942 TGGCAGCCCCAGGGAACTCATGG + Intergenic
1062433201 9:136535099-136535121 GGGCAGCCCCACAGACCTGAGGG + Intronic
1062459515 9:136657024-136657046 GAGAAGTTCCCGAGAGCTCAGGG - Intergenic
1062552898 9:137098243-137098265 GGCCAGTCCCAGGCAGCTCTGGG + Intronic
1062590565 9:137272722-137272744 GGGCAGGCCCAGGGGGCACAGGG - Intronic
1062719109 9:138025737-138025759 GTGCAGTCCCTGAGGGCACAGGG + Intronic
1185643202 X:1599732-1599754 GGGCAGTGGCAGAGAGTGCAGGG + Intronic
1187937982 X:24354324-24354346 GAGCAGGCACAGAGAGCTAAAGG + Intergenic
1195129122 X:101837491-101837513 GGGCAGGCCCAGAGAGCCAGAGG - Exonic
1195177130 X:102322347-102322369 GGGCAGGCCCAGAGAGCCAGAGG + Intronic
1195181734 X:102364746-102364768 GGGCAGGCCCAGAGAGCCAGAGG - Intronic
1197726111 X:129777572-129777594 GGGCAGCCCCAGAGGGTTCTGGG - Intergenic
1197931285 X:131698946-131698968 GGGTACTCCCAGAGAGCTGCAGG + Intergenic
1199657760 X:150013961-150013983 GTGCAGTCCCAGGGAACGCATGG + Intergenic
1201914471 Y:19167627-19167649 GGGCAGAGCCCGAGAGCTCAGGG + Intergenic
1202143049 Y:21748978-21749000 GAGGAGTCCCAGAGAGGTCTTGG - Intergenic
1202143778 Y:21756837-21756859 GAGGAGTCCCAGAGAGGTCTTGG + Intergenic