ID: 1090232041

View in Genome Browser
Species Human (GRCh38)
Location 11:125114325-125114347
Sequence CCCGGCCCAGTATGATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090232034_1090232041 15 Left 1090232034 11:125114287-125114309 CCCAAATCTCAGGACCTCAGCAA No data
Right 1090232041 11:125114325-125114347 CCCGGCCCAGTATGATGAGCTGG 0: 1
1: 0
2: 3
3: 24
4: 172
1090232037_1090232041 1 Left 1090232037 11:125114301-125114323 CCTCAGCAACATCATGGCAGACC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1090232041 11:125114325-125114347 CCCGGCCCAGTATGATGAGCTGG 0: 1
1: 0
2: 3
3: 24
4: 172
1090232035_1090232041 14 Left 1090232035 11:125114288-125114310 CCAAATCTCAGGACCTCAGCAAC 0: 1
1: 1
2: 7
3: 33
4: 241
Right 1090232041 11:125114325-125114347 CCCGGCCCAGTATGATGAGCTGG 0: 1
1: 0
2: 3
3: 24
4: 172
1090232033_1090232041 16 Left 1090232033 11:125114286-125114308 CCCCAAATCTCAGGACCTCAGCA No data
Right 1090232041 11:125114325-125114347 CCCGGCCCAGTATGATGAGCTGG 0: 1
1: 0
2: 3
3: 24
4: 172
1090232032_1090232041 17 Left 1090232032 11:125114285-125114307 CCCCCAAATCTCAGGACCTCAGC No data
Right 1090232041 11:125114325-125114347 CCCGGCCCAGTATGATGAGCTGG 0: 1
1: 0
2: 3
3: 24
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090232041 Original CRISPR CCCGGCCCAGTATGATGAGC TGG Intergenic
906557759 1:46728140-46728162 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
909672314 1:78203204-78203226 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
910799437 1:91131060-91131082 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
910805816 1:91188961-91188983 CCAGTCCCAATCTGATGAGCTGG + Intergenic
912271126 1:108209783-108209805 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
912672996 1:111648805-111648827 CTCGGCCCAATACAATGAGCTGG - Intronic
919404778 1:197165895-197165917 CCAGTCCCAGTGAGATGAGCTGG - Intronic
919598902 1:199599232-199599254 CCAGTCCCAGTAAGATGAGCTGG - Intergenic
921221704 1:212978346-212978368 CCAGGCCCACTCTGATGTGCTGG - Intronic
921825649 1:219669196-219669218 TCCGGCACAGTATGCTGGGCAGG - Intergenic
921962142 1:221047233-221047255 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
923271888 1:232362982-232363004 CACAGCCAAATATGATGAGCTGG - Intergenic
924823198 1:247513853-247513875 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1065621517 10:27587120-27587142 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1067209787 10:44250245-44250267 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1067546675 10:47196890-47196912 CCAGCACCGGTATGATGAGCTGG + Intergenic
1067878956 10:50027221-50027243 CCAGGCCCAGGACGATGAGCAGG + Intergenic
1067892782 10:50150715-50150737 CCAGGCCCAGGACGATGAGCAGG - Intergenic
1072024904 10:91445684-91445706 CCAGTCCCAGTGAGATGAGCTGG - Intronic
1074112277 10:110431090-110431112 CCAGGCCCAGAAGGAGGAGCAGG - Intergenic
1075895862 10:125994087-125994109 TCCGGCCCAGAAAGATCAGCTGG - Intronic
1078331576 11:10426423-10426445 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1078392998 11:10952601-10952623 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1079799868 11:24854971-24854993 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1081873233 11:46392451-46392473 CCCGGCCCGGAACGCTGAGCAGG - Intergenic
1082867171 11:57910759-57910781 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1083151963 11:60797598-60797620 CTGGGCCCAGTATGATGATAAGG - Intronic
1083302007 11:61744450-61744472 CCCCGCCAAGCAAGATGAGCTGG + Exonic
1085775305 11:79360220-79360242 CCCAGCCCAGTATGAGAAACTGG - Intronic
1089255152 11:117190220-117190242 CCCGTTGCAGGATGATGAGCAGG - Exonic
1090232041 11:125114325-125114347 CCCGGCCCAGTATGATGAGCTGG + Intergenic
1092263701 12:6965573-6965595 CCCGCCCCAGTATCATGCGATGG - Exonic
1092703162 12:11256144-11256166 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1095230589 12:39734249-39734271 CCAGTCCCAGTAGGATGAGCTGG + Intronic
1095595206 12:43950949-43950971 CCAGTCCCAGTAGGATGAACTGG - Intronic
1096116539 12:49058788-49058810 CCCGGCCTGGTATGGAGAGCTGG - Intronic
1096552388 12:52381405-52381427 CAAGGCCCAGTATGAGGAGGTGG - Exonic
1096634832 12:52951579-52951601 CCGGGCCCAATATGACGAGCTGG + Exonic
1097950214 12:65419243-65419265 CTGGGCCCAATATGACGAGCTGG - Intronic
1098438878 12:70497537-70497559 CCAGCCCCAGTAAGATGAACTGG + Intergenic
1101468960 12:104977263-104977285 CTGGGCCCAATATGACGAGCTGG - Intergenic
1101816374 12:108149176-108149198 CCTGGCCCAGTGGGATGGGCAGG + Intronic
1106335181 13:28777214-28777236 CCAGTCCCAGTGAGATGAGCAGG + Intergenic
1108600670 13:51991726-51991748 TCAGGCCCAGAATGGTGAGCTGG - Intronic
1109187799 13:59291492-59291514 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1110135427 13:72062217-72062239 CCAGTCCCAGTAAGATGAACTGG - Intergenic
1111581707 13:90231146-90231168 TTCGGCCCAATACGATGAGCTGG + Intergenic
1112546607 13:100377151-100377173 CCAGTCCCAGTGAGATGAGCCGG + Intronic
1114870203 14:26646134-26646156 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1115043011 14:28955077-28955099 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1118222210 14:63865440-63865462 CCAGGCCTAGAATGATGAGTAGG + Intronic
1118222727 14:63870249-63870271 CCAGGCCTAGAATGATGAGTAGG - Intronic
1120554206 14:85908312-85908334 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1120565416 14:86048648-86048670 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1120861796 14:89261388-89261410 CTGGGCCCAGTATGATGAGAAGG + Intronic
1125227073 15:37407951-37407973 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1125354645 15:38803814-38803836 CCCGTCCCAATAAGATGAACTGG + Intergenic
1125730153 15:41888488-41888510 CCAGGCCCAGTGTTATGGGCTGG + Intronic
1126050739 15:44682891-44682913 CCAGTCCCAGTGAGATGAGCTGG - Intronic
1128883581 15:71265253-71265275 CCAGTCCCAGTGTGATAAGCTGG - Intronic
1129862413 15:78872893-78872915 TCCGGCCCAGGATGTAGAGCTGG + Exonic
1129966717 15:79742799-79742821 CCCGGGCCTGGAAGATGAGCAGG - Intergenic
1131003934 15:88960498-88960520 CCAGTCCCAGTATGACGAGCTGG + Intergenic
1131716049 15:95112050-95112072 CCAGGCCCAGGGTGATGAACTGG + Intergenic
1133718741 16:8474586-8474608 CCAGGGCCAGTAAGATGTGCTGG - Intergenic
1137336568 16:47554858-47554880 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1139517389 16:67459867-67459889 CCCCGCCCAGTATGCTGGCCAGG - Intronic
1141636140 16:85314870-85314892 CACGGCCCAGAATGCTTAGCTGG - Intergenic
1143681380 17:8478337-8478359 CGCGGACCAGTATAAAGAGCAGG - Exonic
1145269569 17:21397518-21397540 CCCGGCAGAGGCTGATGAGCTGG + Intronic
1145276383 17:21433843-21433865 CCTTGCCCAGGAAGATGAGCAGG + Intergenic
1145314218 17:21719736-21719758 CCTCGCCCAGGAAGATGAGCAGG + Intergenic
1145712671 17:26991715-26991737 CCTTGCCCAGGAAGATGAGCAGG + Intergenic
1151064288 17:71132335-71132357 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
1152416892 17:80168544-80168566 GCTGGCACAGTGTGATGAGCTGG + Intergenic
1152920141 17:83062415-83062437 CCTGGCCCAGCAAGATGGGCAGG - Intergenic
1153717944 18:7869537-7869559 CCAGTCCCAATGTGATGAGCTGG + Intronic
1153798366 18:8646528-8646550 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1154288827 18:13086525-13086547 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1155395218 18:25379877-25379899 CCAGTCCCAATGTGATGAGCTGG - Intergenic
1157695200 18:49716794-49716816 CCAGTCCCAGTAAGATGAGCCGG + Intergenic
1160466745 18:79083750-79083772 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1163591353 19:18195892-18195914 CCCTGCCAAGTCTGTTGAGCAGG + Intronic
930327439 2:49937617-49937639 CCCGCACCTGAATGATGAGCTGG + Intronic
931480291 2:62633086-62633108 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
931791424 2:65667220-65667242 CTGGGCCCAATATGATGAGCTGG + Intergenic
931987530 2:67756131-67756153 CCCCGCCCAACATGATAAGCAGG - Intergenic
934660651 2:96141848-96141870 CCTGGCCCAGGATGGTGAGGGGG + Intergenic
935177331 2:100661354-100661376 CCCGGCTCAGTCTCCTGAGCTGG + Intergenic
938144648 2:128823488-128823510 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
939652711 2:144785075-144785097 CCAGTCCCAATAAGATGAGCTGG - Intergenic
940998926 2:160180788-160180810 CCAGTCCCAGTGAGATGAGCTGG - Intronic
941276495 2:163497484-163497506 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
943548640 2:189311774-189311796 CCAGGTCCAATGTGATGAGCTGG - Intergenic
944267809 2:197748047-197748069 CCAGTCCCAGTGAGATGAGCTGG - Intronic
944635311 2:201670858-201670880 CCAGTCCCAGTGAGATGAGCTGG - Intronic
945207137 2:207344260-207344282 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
947033414 2:225824352-225824374 CCAGTCCCAGTAAGATGAACTGG - Intergenic
1168938699 20:1690713-1690735 CCCGTCCCAGTGAGATGAGCTGG - Intergenic
1169001316 20:2169698-2169720 CCCGGCCCATGATCCTGAGCCGG - Intronic
1171140058 20:22733314-22733336 CCAGGCCCAATATGACGAGCTGG - Intergenic
1173252182 20:41369909-41369931 CCCAGCCTAGGATGAGGAGCTGG - Intergenic
1174277328 20:49413526-49413548 CCTGGCCCAGGGTGATGATCGGG - Intronic
1177387358 21:20425463-20425485 CCAGGCCCAATACGATGAGCTGG - Intergenic
1180045415 21:45302906-45302928 CCAGGCCGAGCAGGATGAGCAGG - Intergenic
1181092455 22:20483329-20483351 CCAGGCTCAATATGATGAGCTGG - Intronic
1181119008 22:20652965-20652987 CCAGGCCCAGGATGATGAGCAGG - Intergenic
1183021585 22:35031287-35031309 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1184448373 22:44567713-44567735 CCGGGCCCAATATGACGAGCTGG + Intergenic
1184955426 22:47883038-47883060 CCTGGCACAGTGTGATGAGAGGG - Intergenic
1203239963 22_KI270733v1_random:7112-7134 CCGGGCCCAATATGACGAGATGG + Intergenic
951098804 3:18662858-18662880 CCCAGCCCAGTATGAAGGGTTGG + Intergenic
951236296 3:20240342-20240364 CCAGGGCCAGTTTGATGACCTGG + Intergenic
951254591 3:20433455-20433477 CCTGTCCCAGTGAGATGAGCCGG + Intergenic
951503762 3:23418383-23418405 CCAGTCCCAGTAAGATGAGTAGG + Intronic
952319166 3:32259693-32259715 CCAGGCCCAATATGACGAGCTGG + Intronic
954815013 3:53273484-53273506 CCAGGCCCAGAATGTGGAGCCGG - Intergenic
956207813 3:66772163-66772185 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
957474753 3:80709227-80709249 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
958156522 3:89762163-89762185 CCTGGTCCAGTTTGATGACCTGG - Intergenic
959007276 3:101034580-101034602 AAAGGCCTAGTATGATGAGCTGG + Intergenic
959733514 3:109631121-109631143 CCTGGCCCAGTCTGGTGGGCTGG + Intergenic
962642447 3:137401161-137401183 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
963089628 3:141471140-141471162 CTGGGCCCAATATGACGAGCTGG - Intergenic
964483346 3:157163174-157163196 CCGGGCCCAATATGATGAGCTGG - Intergenic
965264217 3:166519893-166519915 CTCGGCCCAGTCTGATGTTCTGG + Intergenic
966525342 3:180913126-180913148 CCCGGCCCAGTTCGAGGGGCGGG - Intronic
968659297 4:1792637-1792659 CCCGGCCTAGGATGAAGAGCGGG - Intergenic
969608762 4:8215723-8215745 CCCCGCCCCGCATCATGAGCTGG - Intronic
969909275 4:10428414-10428436 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
970628133 4:17912450-17912472 CTGGGCCCAATACGATGAGCTGG + Intronic
972538743 4:40020995-40021017 CCAGGCCCAATATGATGAGCTGG + Intergenic
975466428 4:74714298-74714320 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
976065461 4:81183291-81183313 CCAGTCCCAGTGAGATGAGCTGG - Intronic
976431459 4:84966722-84966744 GCCGGCTCAGTAGGAGGAGCAGG - Intergenic
978601513 4:110432506-110432528 CCAGTCCCAGTGAGATGAGCCGG + Intronic
979050279 4:115921441-115921463 CCGGGACCAATATGATGAGCTGG + Intergenic
979417364 4:120460437-120460459 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
981273077 4:142867516-142867538 CCAGTCCCAGTAAGATGAGCTGG - Intergenic
983388104 4:167092092-167092114 CCAGTCCCAGTGAGATGAGCTGG - Intronic
985542072 5:492003-492025 CCAGGCCCAGCACGATGAGCAGG + Exonic
988894606 5:35658202-35658224 CCCAGCCTATTATGATGACCAGG + Intronic
990164425 5:52978275-52978297 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
990803415 5:59631546-59631568 CCAGGTCCAGTGAGATGAGCTGG - Intronic
992976990 5:82130686-82130708 CCAGTCCCAGTGAGATGAGCCGG + Intronic
993961056 5:94296744-94296766 CCAGTCCCAGTGAGATGAGCTGG + Intronic
996452083 5:123636862-123636884 CCGGGCCCAATATGACGAGCTGG + Intergenic
996978506 5:129461487-129461509 CCCGGCCCAGCATGCCGAGCCGG + Exonic
996987592 5:129585238-129585260 CCAGTCCCAGTGAGATGAGCCGG + Intronic
998508414 5:142690866-142690888 CCTGGCCCGTTATGAGGAGCAGG - Intronic
999468569 5:151830947-151830969 CCAGTCCCAGTGAGATGAGCTGG - Intronic
1009264023 6:61531592-61531614 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1009880420 6:69560264-69560286 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1011301533 6:85879247-85879269 CCAGTCCCAATAAGATGAGCTGG + Intergenic
1012870793 6:104670881-104670903 CCAGTCCCAATGTGATGAGCTGG - Intergenic
1013390146 6:109678756-109678778 CCAGTCCCAGTGAGATGAGCTGG - Intronic
1013920249 6:115394938-115394960 CCAGTCCCAGTGTGATGAACTGG + Intergenic
1014009218 6:116457836-116457858 CTGGGCCCAATATGACGAGCTGG - Intergenic
1014466226 6:121760298-121760320 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
1015471775 6:133614410-133614432 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1015883376 6:137891749-137891771 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1020753507 7:12171198-12171220 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1024505864 7:50160718-50160740 CCAGGCCCAGAATGATGAAGAGG - Intergenic
1025003712 7:55339421-55339443 CCCAGGCCAGCATGATGAGAAGG + Intergenic
1027582773 7:80019925-80019947 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1030159309 7:106491386-106491408 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
1035689306 8:1549319-1549341 CCCGGCCCGGCATGAGCAGCTGG + Exonic
1039429091 8:37511715-37511737 CCCAGCTCTGTATGATGGGCTGG + Intergenic
1040968901 8:53112833-53112855 CCAGTCCCAGTAAGATGAACTGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1043366410 8:79537781-79537803 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
1045151884 8:99416759-99416781 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1048267230 8:132998365-132998387 CCCGGCACAGTTTGATCAGTTGG - Intronic
1049382619 8:142325028-142325050 CACGGCCCAGTTTCATGAGCAGG + Intronic
1054870563 9:70044305-70044327 CCCAGCCCAGCACGGTGAGCCGG - Intronic
1055708827 9:79036923-79036945 CTGGGCCCAATATGACGAGCTGG - Intergenic
1057460223 9:95254378-95254400 CCAGTCCCAGTGAGATGAGCCGG - Intronic
1057739629 9:97700199-97700221 CCGGCCCCAATATGATGAGCTGG + Intergenic
1057763483 9:97895656-97895678 CCAGCTCCAGTATGATGAGGAGG + Intergenic
1059088753 9:111334098-111334120 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
1060377321 9:123128333-123128355 CCGGGCCCAGGGTGCTGAGCAGG - Intronic
1061258202 9:129465003-129465025 CCCAGCCCTGTGAGATGAGCTGG - Intergenic
1062032871 9:134369955-134369977 TCCTGCCCAGTGGGATGAGCAGG + Intronic
1062394466 9:136347185-136347207 GCCGGCGCAGTCTGATGAGGAGG + Intronic
1186961045 X:14736579-14736601 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
1188561337 X:31471489-31471511 CCAGTCCCAGTGAGATGAGCCGG + Intronic
1189243256 X:39541958-39541980 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1192701847 X:73482512-73482534 CCAGCCCCAGTAAGATGAACTGG + Intergenic
1193352119 X:80475487-80475509 CCTGTCCCAGTGAGATGAGCCGG + Intergenic
1194322014 X:92460416-92460438 CCGGGCCCAATATGACGACCTGG + Intronic
1195665755 X:107428953-107428975 CCAGGCCCAATATGACTAGCTGG + Intergenic
1196273256 X:113736363-113736385 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1198002367 X:132452010-132452032 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1198680641 X:139178053-139178075 CCAGGCCCAATGAGATGAGCTGG + Intronic
1199436522 X:147819169-147819191 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
1199469906 X:148182389-148182411 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1199477459 X:148260756-148260778 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1200085850 X:153604573-153604595 CCGGGCCCAATATGACGAGCTGG - Intergenic
1200224970 X:154412218-154412240 CCCGGGCCAGTGTGCTGGGCAGG + Intronic
1200630179 Y:5573893-5573915 CCGGGCCCAATATGACAAGCTGG + Intronic