ID: 1090240760

View in Genome Browser
Species Human (GRCh38)
Location 11:125179982-125180004
Sequence CAGGACATGAATTGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 495}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090240760_1090240768 7 Left 1090240760 11:125179982-125180004 CCTCCTCCCCAATTCATGTCCTG 0: 1
1: 0
2: 1
3: 58
4: 495
Right 1090240768 11:125180012-125180034 CCTGCTCACTACACGCACACGGG 0: 1
1: 0
2: 1
3: 4
4: 86
1090240760_1090240766 6 Left 1090240760 11:125179982-125180004 CCTCCTCCCCAATTCATGTCCTG 0: 1
1: 0
2: 1
3: 58
4: 495
Right 1090240766 11:125180011-125180033 TCCTGCTCACTACACGCACACGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090240760 Original CRISPR CAGGACATGAATTGGGGAGG AGG (reversed) Intronic
901804056 1:11726617-11726639 AAGGGCATGAACTGGTGAGGGGG + Intergenic
901897109 1:12323468-12323490 CTGGCCAGGAATTGGGGTGGGGG - Intronic
902821185 1:18944422-18944444 CAGGTCAGGAATTGGGGCTGGGG - Intronic
902999158 1:20252413-20252435 CAAGATATGAATTGGGCGGGGGG - Intergenic
903360903 1:22776354-22776376 CAGGAAATGAATACGGAAGGAGG - Intronic
903581874 1:24377166-24377188 AATTACTTGAATTGGGGAGGCGG + Intronic
904487557 1:30837270-30837292 TAAGACTTGAAGTGGGGAGGGGG + Intergenic
904574983 1:31499764-31499786 CAGGGCAGGAGGTGGGGAGGAGG - Intergenic
905577937 1:39060761-39060783 AATGACATGAATCTGGGAGGCGG + Intergenic
906212510 1:44019942-44019964 CTAGACAGGAAGTGGGGAGGGGG + Intronic
906469433 1:46115661-46115683 CAGGACATTAATTCGGGACTTGG - Intronic
906505161 1:46373542-46373564 CAGGACATCAAATGGCAAGGGGG + Intergenic
906584137 1:46961577-46961599 CAGGCTATGATGTGGGGAGGAGG + Intergenic
907897699 1:58707466-58707488 AATGACATGAACTCGGGAGGCGG + Intergenic
908874499 1:68655760-68655782 CAGGACATCACATGGTGAGGGGG + Intergenic
909096928 1:71298786-71298808 CAGGACATGGGGTGGGGTGGAGG - Intergenic
910882609 1:91935877-91935899 CAGTATATGAATTGGGGACAGGG + Intergenic
911188362 1:94925928-94925950 AAGGAGAGGATTTGGGGAGGGGG + Intronic
911730203 1:101284554-101284576 CAACACATGAATTTGGGAAGGGG - Intergenic
912679944 1:111722615-111722637 GATGACATGCACTGGGGAGGCGG - Exonic
913075295 1:115336861-115336883 CTGTGCATGGATTGGGGAGGAGG + Intronic
913144115 1:115972476-115972498 AAGGACATGAATTTGGGTGAGGG - Intergenic
914228665 1:145744324-145744346 CTGGTTTTGAATTGGGGAGGAGG - Exonic
915038496 1:152948448-152948470 CAGGACAGGAATGTGGCAGGGGG + Intergenic
915170313 1:153972905-153972927 CAGGAGAAGCATTGGGGAGTTGG + Intronic
916922779 1:169486078-169486100 CACGACGTGAACTGGGGCGGTGG + Intergenic
917355421 1:174121968-174121990 CAACATATGAATTGGGGTGGGGG + Intergenic
919095501 1:193029969-193029991 GAGGAAATGAATAGGAGAGGGGG - Intronic
920881728 1:209887082-209887104 CTGGCCATGAATTGGGGCAGTGG - Intergenic
921668513 1:217901220-217901242 AAGGACTGGAAGTGGGGAGGGGG + Intergenic
921878493 1:220226767-220226789 CAACATATGAATTGGGGTGGGGG - Intronic
922411477 1:225380105-225380127 CAGAACAGGAAGTGGGGAGATGG - Intronic
923191723 1:231626758-231626780 CTGGACGGGAAGTGGGGAGGGGG - Intronic
923193096 1:231639600-231639622 AAGGACATGGATGGGGAAGGAGG + Intronic
923436262 1:233970538-233970560 CAGCAAGTGAATTTGGGAGGTGG - Intronic
924286460 1:242492960-242492982 CAATATATGAATTTGGGAGGGGG + Intronic
924536801 1:244942102-244942124 AAGCACTTGAATTGGGGAGGTGG + Intergenic
924642337 1:245846080-245846102 CAGAACATGAATGGGGTGGGGGG + Intronic
924940286 1:248808593-248808615 CAGTACAGGAATGGGGGATGGGG + Intergenic
1063866118 10:10367227-10367249 CAGGACAGGAGCTGGGTAGGTGG - Intergenic
1064547605 10:16466440-16466462 AATCACTTGAATTGGGGAGGCGG - Intronic
1064816351 10:19269182-19269204 CAAGATATGAATTGTGGAGTGGG - Intronic
1065206435 10:23361827-23361849 CAGGACATCAAATGATGAGGAGG - Intergenic
1066386921 10:34948987-34949009 CATGAGATTACTTGGGGAGGAGG - Intergenic
1066653951 10:37682317-37682339 TGGGACATGAATTGGGGTGCTGG - Intergenic
1066661753 10:37743128-37743150 GAGGACATGGAATGGGGGGGGGG + Intergenic
1067224639 10:44367633-44367655 CAGGACATGAATGGTGGGTGAGG + Intergenic
1067368234 10:45656685-45656707 CAGCATATGAATTTGGGTGGGGG - Intronic
1069138885 10:64799561-64799583 CAGCATATGAATTGGGGGTGGGG + Intergenic
1069179900 10:65345432-65345454 CATGACATGAATTTCAGAGGTGG + Intergenic
1069950357 10:72014462-72014484 CAGGTTAAGATTTGGGGAGGGGG - Intergenic
1070606207 10:77900254-77900276 CAGGAGATGACCTGGAGAGGAGG - Intronic
1070613489 10:77950760-77950782 AAGTAAATGAATTGGGGTGGGGG - Intergenic
1071162657 10:82768175-82768197 GAACACATGAAGTGGGGAGGGGG - Intronic
1071328399 10:84538803-84538825 CAGGCCAGGGATTGGGGTGGGGG + Intergenic
1071348802 10:84718767-84718789 CAGGACATGTATGTGGCAGGCGG + Intergenic
1072069019 10:91898764-91898786 AATGACATGAACTCGGGAGGTGG - Intergenic
1072537548 10:96374947-96374969 CAGGACATTAGTTGCGGGGGGGG + Intronic
1074136484 10:110631733-110631755 CAGGACATCGCTTGGGAAGGGGG - Intergenic
1074298006 10:112209021-112209043 AAGGACAGGGATTGGGGATGGGG + Intronic
1074942300 10:118247552-118247574 CAACACATGAATTGGGGACTAGG - Intergenic
1075422018 10:122308842-122308864 CAGGAGATGCATTTGGGAGATGG - Intronic
1075855569 10:125626654-125626676 GAGGCCATGAAGTGGGGAGAAGG + Intronic
1076422469 10:130340994-130341016 CATGACATGTCCTGGGGAGGGGG + Intergenic
1076776728 10:132701829-132701851 CAGTGCAGGAATTGGGGCGGTGG + Intronic
1077112610 11:868652-868674 CAGGACGGGAGCTGGGGAGGGGG - Exonic
1077993002 11:7428769-7428791 AGGGAGATGAAGTGGGGAGGTGG + Intronic
1078066740 11:8083614-8083636 CAGGAAAGGAATTGGAGGGGTGG - Intronic
1078074839 11:8149104-8149126 AATGACATGAATCCGGGAGGCGG + Intronic
1080278308 11:30527535-30527557 GAGGACAGGAAATGGGGAAGAGG + Intronic
1080466400 11:32501382-32501404 AATCACTTGAATTGGGGAGGTGG + Intergenic
1080585217 11:33675671-33675693 TAAGACATGAACTGGGGAGTGGG - Intergenic
1080833247 11:35916031-35916053 CAGGGAAGGAAGTGGGGAGGTGG + Intergenic
1083463503 11:62831074-62831096 CAGGACATGGTGTCGGGAGGGGG + Exonic
1084286382 11:68133908-68133930 CATGACAGGAAGTGGGTAGGGGG + Intergenic
1084659502 11:70538617-70538639 CAGGAAATGCATGGAGGAGGAGG + Intronic
1085339962 11:75724726-75724748 GAGGACAGGAACTGGGGAGATGG - Intronic
1085977651 11:81679132-81679154 AAGGACATAAATTGGGGAAAGGG - Intergenic
1086498129 11:87425056-87425078 CAACATATGAATTGGGGTGGGGG - Intergenic
1087292468 11:96335049-96335071 CATGCCATGAATCAGGGAGGAGG + Intronic
1087321507 11:96665509-96665531 CAGGTCATGAATTTGGAAGCTGG + Intergenic
1087856902 11:103103167-103103189 TAGGACATCATTGGGGGAGGGGG + Intergenic
1088779798 11:113123369-113123391 AAAGACTTGGATTGGGGAGGGGG + Intronic
1090240760 11:125179982-125180004 CAGGACATGAATTGGGGAGGAGG - Intronic
1090651916 11:128814390-128814412 CAGCATATGAATTTGGGAGAAGG + Intergenic
1090833641 11:130438179-130438201 CAGGACATGACTTCAGGAGATGG + Intergenic
1091503277 12:1040391-1040413 AATGACATGAACTCGGGAGGCGG - Intronic
1091624752 12:2113392-2113414 CAAGATAAGAGTTGGGGAGGTGG + Intronic
1091961453 12:4698421-4698443 AACGGCATGAATTTGGGAGGCGG + Intronic
1092518173 12:9237899-9237921 CAGGTCAGGAAGTGGGGAGGGGG + Intergenic
1092909579 12:13134851-13134873 CAGCACATTAATGGGGCAGGGGG + Intronic
1093473882 12:19533921-19533943 AAGAACATGAATTGTGGAGGAGG - Intronic
1095909275 12:47409396-47409418 CAGGACATGAAGTTGGAGGGAGG - Intergenic
1096584972 12:52614089-52614111 CAGGACAGGAGTGGGGAAGGTGG + Intronic
1096780648 12:53990142-53990164 CAGGACAATATTTGGGGGGGGGG - Exonic
1097526419 12:60741549-60741571 CAGGAAAAGAATTGGGGAGAGGG - Intergenic
1098405546 12:70122611-70122633 CAGGACAGAAATTGTGCAGGTGG + Intergenic
1098757767 12:74387759-74387781 AAGGACATGAACTGGGGGGAGGG - Intergenic
1099055311 12:77833111-77833133 CAGAAAAAGAATTGGGAAGGAGG - Intronic
1100077594 12:90804097-90804119 CAAGACTTTAATTGGGGAGAGGG - Intergenic
1100149118 12:91714015-91714037 CAGCACATGAATTTGGGGGAGGG + Intergenic
1100404796 12:94263602-94263624 CAGGGCATTACTTGGGGTGGGGG + Intronic
1100694109 12:97072506-97072528 CAGCATATGAATTGGGTTGGGGG + Intergenic
1100831857 12:98523760-98523782 AATCACTTGAATTGGGGAGGCGG - Intronic
1100894317 12:99162524-99162546 CAGGACAAGAATGGAGGAAGGGG - Intronic
1101320717 12:103670719-103670741 CGGGACATGCATTTGTGAGGAGG + Exonic
1101510097 12:105385273-105385295 CAACACATGAATTGGGGTGGCGG - Intronic
1101534180 12:105602254-105602276 AAGGACCTGAATTGTGAAGGAGG + Intergenic
1102126354 12:110484338-110484360 AATGGCATGAACTGGGGAGGCGG + Intronic
1102202896 12:111069847-111069869 TAGGACTTCAGTTGGGGAGGCGG + Intronic
1102566790 12:113802349-113802371 CAAGACTTCAATGGGGGAGGTGG + Intergenic
1102781662 12:115570863-115570885 CAGGTCATGCATTTGGAAGGTGG + Intergenic
1102791398 12:115649414-115649436 TTGGACATGACTGGGGGAGGGGG - Intergenic
1104030231 12:125059720-125059742 GAAGACTTGAAGTGGGGAGGGGG + Intergenic
1105062779 12:133169053-133169075 AAGGGCATGAACTCGGGAGGTGG + Intronic
1105545685 13:21349019-21349041 CAGGACATGAATTTGGCAAGGGG - Intergenic
1106499323 13:30311984-30312006 CAGGTAATGCTTTGGGGAGGAGG - Intergenic
1106775170 13:33001882-33001904 CAACACATGAATTTGGAAGGTGG - Intergenic
1107744523 13:43490448-43490470 GAGGACATAAATTTGGGAGAGGG + Intronic
1107879061 13:44817323-44817345 GAGATCATGAAGTGGGGAGGGGG + Intergenic
1108382052 13:49863826-49863848 CATGGCAGGAGTTGGGGAGGAGG + Intergenic
1108439591 13:50436985-50437007 AAGGACATTTCTTGGGGAGGGGG + Intronic
1109930200 13:69206269-69206291 AATGGCGTGAATTGGGGAGGTGG + Intergenic
1111340401 13:86878441-86878463 AATGACATGAACTCGGGAGGTGG - Intergenic
1111902872 13:94220923-94220945 CAGCATATGAATTGGGGCAGGGG + Intronic
1112003095 13:95229894-95229916 GAGCACATGAGTTGGGGAGTTGG - Intronic
1112108853 13:96272443-96272465 CTAAACAGGAATTGGGGAGGAGG - Intronic
1113041027 13:106104015-106104037 TAGGACGTGGATTGGGGTGGAGG - Intergenic
1114150199 14:20030121-20030143 AAGGACAGGAAATGGGAAGGAGG + Intergenic
1114504554 14:23199285-23199307 GAAGACTTGAAGTGGGGAGGAGG + Intronic
1115913517 14:38283510-38283532 CAGCACATGAATTTGGGAGCAGG - Intergenic
1116566560 14:46451989-46452011 TAGGACATGACTTAGGGTGGCGG + Intergenic
1116765217 14:49062240-49062262 CAGGAAAGGAGTTGGGGAGAAGG + Intergenic
1116870804 14:50067696-50067718 CAACATATGAATTGGGGAAGGGG + Intergenic
1116891839 14:50276466-50276488 CAACATATGAATTGGGGTGGGGG - Intronic
1117067558 14:52025653-52025675 CAGGACATCACATGGTGAGGGGG + Intronic
1117753251 14:58945691-58945713 TAGAAGATTAATTGGGGAGGAGG - Intergenic
1120071917 14:80113291-80113313 AATGGCATGAATTCGGGAGGCGG - Intergenic
1120324402 14:83006992-83007014 CAGGACATCACATGGCGAGGAGG + Intergenic
1120375136 14:83695228-83695250 CAGGGCATGACGTGGTGAGGAGG + Intergenic
1121586566 14:95067087-95067109 CAGGAGCTGAGATGGGGAGGAGG - Intergenic
1121740383 14:96247937-96247959 GTGGACATGAGTTGGGGTGGAGG - Intronic
1121833458 14:97071683-97071705 GTGGACATGAATTAGGGTGGGGG - Intergenic
1122115640 14:99526036-99526058 CATGACCTAAATTTGGGAGGGGG - Intronic
1122292820 14:100688597-100688619 CAGGACTTGGGTGGGGGAGGAGG + Intergenic
1122825227 14:104367478-104367500 CGGGACAAGAATTGGCCAGGGGG + Intergenic
1123015306 14:105370902-105370924 CAGGACCTGAAGTGGAGAGGTGG + Intronic
1123020975 14:105397839-105397861 CAGGACAGGTCTCGGGGAGGGGG - Exonic
1123433536 15:20238131-20238153 CAGGAGAATAATTTGGGAGGTGG - Intergenic
1123445587 15:20328143-20328165 CAGGACAGGAATTGGGATAGTGG - Intergenic
1124290233 15:28446023-28446045 CAAAACAAGAAATGGGGAGGGGG - Intergenic
1124347050 15:28930060-28930082 AAGGAGCTGAGTTGGGGAGGTGG + Intronic
1125082968 15:35697176-35697198 CAGGAAATGCCTTAGGGAGGAGG - Intergenic
1125318261 15:38455088-38455110 CAGGAGCTGACTTGGGGAGGAGG - Intronic
1125601540 15:40918329-40918351 CAGGGCATGGGGTGGGGAGGGGG + Intergenic
1125616805 15:41021680-41021702 CAGGCCATAAACTGGGGAAGGGG + Intronic
1126528768 15:49688840-49688862 CAGGACAGGGAATGGGGAAGTGG - Intergenic
1127794774 15:62428077-62428099 CAAGACCAGAATTGTGGAGGGGG - Intronic
1127972668 15:63973727-63973749 AAGGACATTAATTGGGGTGGGGG + Intronic
1128153037 15:65375397-65375419 CAAGACCTGCATTGGGGAAGGGG + Exonic
1128500596 15:68224717-68224739 CAGGACATGAGCTGGGGGAGAGG - Intronic
1128789488 15:70422735-70422757 CAGGAAAAGAAAAGGGGAGGTGG - Intergenic
1131105690 15:89732782-89732804 CTGGAGAGGAATTGGGGAGGGGG - Intronic
1131523478 15:93134458-93134480 CAGGACTGGAGTTGGGCAGGGGG + Intergenic
1131873197 15:96780914-96780936 CAGCACAGGACTTGGGGAGGGGG - Intergenic
1132369851 15:101288331-101288353 AATGGCATGAATTCGGGAGGCGG - Intronic
1132780380 16:1621221-1621243 CAGGACATGTGATGGGGAAGAGG + Intronic
1133094745 16:3435723-3435745 CTGGACTTGACTTGGGGAGGGGG - Exonic
1133807729 16:9138340-9138362 CAGGACAAGAACTTGTGAGGAGG - Intergenic
1134167345 16:11941332-11941354 CCGGATCTGAGTTGGGGAGGGGG + Intronic
1134178000 16:12024223-12024245 CATCACATGAATCCGGGAGGCGG - Intronic
1134275821 16:12775164-12775186 CAGAACATCACATGGGGAGGGGG - Intronic
1134493349 16:14712349-14712371 CCGGATCTGAGTTGGGGAGGGGG - Intronic
1134498730 16:14751473-14751495 CCGGATCTGAGTTGGGGAGGGGG - Intronic
1134525284 16:14938103-14938125 CCGGATCTGAGTTGGGGAGGGGG - Intronic
1134547609 16:15122805-15122827 CGGGATCTGAGTTGGGGAGGGGG + Intronic
1134581843 16:15377612-15377634 CCGGATCTGAGTTGGGGAGGGGG + Intronic
1134720738 16:16379905-16379927 CCGGATCTGAGTTGGGGAGGGGG - Intronic
1134946689 16:18331980-18332002 CCGGATCTGAGTTGGGGAGGGGG + Intronic
1135312772 16:21418974-21418996 CCGGATCTGAGTTGGGGAGGGGG + Intronic
1135430962 16:22383059-22383081 AATCACTTGAATTGGGGAGGTGG - Intronic
1135446119 16:22519908-22519930 CCGGATCTGAGTTGGGGAGGGGG - Intronic
1135494762 16:22941754-22941776 CAGGACATCACATGGAGAGGGGG - Intergenic
1135764618 16:25166739-25166761 CAGGAAAGGACCTGGGGAGGAGG - Intronic
1136194824 16:28644478-28644500 CCGGATCTGAGTTGGGGAGGGGG - Intronic
1136309448 16:29397733-29397755 CCGGATCTGAGTTGGGGAGGGGG + Intronic
1136322889 16:29499488-29499510 CCGGATCTGAGTTGGGGAGGGGG + Intronic
1136437573 16:30239456-30239478 CCGGATCTGAGTTGGGGAGGGGG + Intronic
1137288978 16:47038716-47038738 CAGGACTTGAACCCGGGAGGTGG - Intergenic
1137552122 16:49444798-49444820 CAGGGCCTGAAATGGGGAGGTGG + Intergenic
1137552243 16:49445604-49445626 TAGGGCATGAAATGGGGAGGTGG - Intergenic
1137909429 16:52361359-52361381 CAACATATGAATTTGGGAGGTGG - Intergenic
1138024643 16:53512882-53512904 GAGGACATGAAATTTGGAGGGGG - Intergenic
1138586064 16:57971174-57971196 CAGGTGCTGAATGGGGGAGGGGG + Intergenic
1138655957 16:58491545-58491567 AATCACTTGAATTGGGGAGGCGG - Intronic
1139167870 16:64591334-64591356 CAGGACAGGAATATGAGAGGGGG - Intergenic
1139320733 16:66111797-66111819 AAGGACATGAATTTGGTGGGTGG + Intergenic
1139820991 16:69721238-69721260 CAGCACCTGAATTTTGGAGGGGG - Intronic
1139909909 16:70391383-70391405 AAGGACATGAATTTGGGAGAGGG - Intronic
1140777395 16:78262664-78262686 CAGGACAGGAACTCAGGAGGAGG + Intronic
1141316598 16:82968295-82968317 CAGGACATGAAGGTGGAAGGTGG - Intronic
1141650748 16:85391713-85391735 GTGGACATGAATTGGGGGTGGGG + Intergenic
1141945144 16:87304609-87304631 CAGGCCATGCACTGGGAAGGGGG - Intronic
1143189812 17:5033228-5033250 GGAGACATGAAGTGGGGAGGAGG - Intronic
1143708187 17:8715151-8715173 CAACACATAAATTTGGGAGGTGG - Intergenic
1144320503 17:14113382-14113404 AAAGACAAGAATTGGGGTGGAGG - Intronic
1144613917 17:16751517-16751539 CAGGAACTGATTTGGTGAGGGGG - Intronic
1144647817 17:16987430-16987452 CAGTACACGTATGGGGGAGGAGG + Intergenic
1144898793 17:18564154-18564176 CAGGAACTGATTTGGTGAGGGGG + Intergenic
1145133582 17:20381569-20381591 CAGGAACTGATTTGGTGAGGGGG - Intergenic
1146375136 17:32288764-32288786 CAGGAAATGGAGTGGGGAGAGGG - Intronic
1146711017 17:35041505-35041527 CACGGCATGAATTGGAGAAGTGG - Intronic
1147195884 17:38766460-38766482 CAGGGCATACCTTGGGGAGGTGG - Exonic
1148716954 17:49722764-49722786 GAGGACATGAACTGGGAAGGAGG - Intronic
1148757041 17:49978688-49978710 CAGGCCAGGAAATGGGGAAGTGG - Intergenic
1148944865 17:51252325-51252347 CAGAACCAGTATTGGGGAGGGGG - Intronic
1149630263 17:58116241-58116263 CAGGCCATGAAGTGGTGTGGAGG + Intergenic
1150225083 17:63520179-63520201 CTGGGCATGACTTGGGGTGGGGG - Intronic
1151931913 17:77237835-77237857 CAGGACCTGAACTAGGGAGGTGG - Intergenic
1152089993 17:78241107-78241129 CAGCACAGGGAGTGGGGAGGGGG + Intergenic
1152234993 17:79134042-79134064 CAGGACATGAGGTGGGCAGGAGG + Intronic
1152373551 17:79905690-79905712 CAACACATGAATTGGGGAGGGGG - Intergenic
1154411080 18:14142681-14142703 CTGGGCTTGAAGTGGGGAGGAGG - Intergenic
1156082622 18:33356583-33356605 AAGGACATGAATAGGAAAGGGGG + Intronic
1157027076 18:43857748-43857770 CAGGAAATGAATTACGGAGAGGG - Intergenic
1157630047 18:49086290-49086312 CAGGGCATCACATGGGGAGGGGG + Intronic
1157701604 18:49764365-49764387 CAGGGCCTGGAGTGGGGAGGGGG + Intergenic
1158172872 18:54618781-54618803 AAGGAGATGAATTGGGAAGGAGG + Intergenic
1158534948 18:58299712-58299734 TGGGAGATGAATTGGGGTGGGGG + Intronic
1158702880 18:59764591-59764613 CAATATATGAATTGGGGTGGGGG + Intergenic
1159580952 18:70234474-70234496 CAGGATGTGAATGGGGGAGGGGG - Intergenic
1160045093 18:75379206-75379228 CTGAACATGAATTGGGGAAGGGG + Intergenic
1160447245 18:78937178-78937200 CAGGAGATGAGCTGGGAAGGTGG + Intergenic
1160557837 18:79737629-79737651 AAGGACATGCATGGGGGATGCGG - Intronic
1160818829 19:1048720-1048742 AATGACGTGAACTGGGGAGGCGG + Intronic
1161422877 19:4185278-4185300 GAGAACATGAATTGGGTGGGTGG + Intronic
1161426773 19:4207980-4208002 AAGCAAATGCATTGGGGAGGTGG - Intronic
1161873831 19:6891975-6891997 CAGGAGATGAGATGGGGAGGTGG + Intronic
1163242763 19:16074570-16074592 CAACACATGAATTGGAGAGGGGG + Intronic
1164431508 19:28193138-28193160 GAAGACATGAAGCGGGGAGGGGG - Intergenic
1164902233 19:31938140-31938162 CAGGACATGGAATGGGGTGAAGG - Intergenic
1165409335 19:35649192-35649214 TAGTACTTGAATTGGGGTGGGGG + Intronic
1166193202 19:41189580-41189602 CAGTGAATGAATTGTGGAGGAGG + Intergenic
1167068180 19:47202821-47202843 AATGACATGAATCCGGGAGGCGG + Intronic
1167469511 19:49667535-49667557 CAGAGTAGGAATTGGGGAGGAGG + Intronic
1167605852 19:50480993-50481015 CAGGAAGGGAATAGGGGAGGCGG - Intronic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
925575582 2:5356790-5356812 CAACACATGAATTTGGGTGGGGG + Intergenic
925750209 2:7083138-7083160 CATCATATGAATTGGGCAGGAGG - Intergenic
925880667 2:8349760-8349782 CAGCACCTGAATTTTGGAGGAGG + Intergenic
925936272 2:8764741-8764763 GAAGGCATGAATTGGGGAGGTGG - Intronic
926273495 2:11385983-11386005 CAGAGCATGAATTTGGGAGCTGG - Intergenic
928004941 2:27556043-27556065 AAGTGCTTGAATTGGGGAGGCGG + Intronic
928861828 2:35867708-35867730 AATCACTTGAATTGGGGAGGCGG - Intergenic
929186375 2:39099823-39099845 CATCACTTGAACTGGGGAGGTGG - Intronic
930081647 2:47454340-47454362 CATGGCATGAATCTGGGAGGCGG + Intronic
930587394 2:53284067-53284089 CATGACATGAACCTGGGAGGCGG - Intergenic
931259678 2:60606366-60606388 CAGCACATGATTTGCCGAGGCGG + Intergenic
931555535 2:63499594-63499616 AAGGACCTGAATTGGGGTGGTGG + Intronic
931980066 2:67685235-67685257 CAGGGCAAGCCTTGGGGAGGAGG - Intergenic
932153811 2:69396983-69397005 AATGGCATGAACTGGGGAGGTGG + Intronic
932564023 2:72894461-72894483 AAGGACAGGAATTGGGGATTCGG - Intergenic
932836098 2:75039029-75039051 CAGCCCATGAATTTCGGAGGTGG + Intergenic
934042136 2:88136480-88136502 GAGGACCTGAATTTGGGAGTAGG + Intergenic
934884653 2:98013965-98013987 CAGGACATGGACAGAGGAGGAGG + Intergenic
935654943 2:105414041-105414063 CAGGCTATTAGTTGGGGAGGGGG + Intronic
935720637 2:105976065-105976087 CATCACTTGAATTTGGGAGGAGG - Intergenic
936442970 2:112571688-112571710 CATGACAACAATTGGGAAGGGGG - Intronic
937034009 2:118765560-118765582 TGGGGCATGAAGTGGGGAGGAGG + Intergenic
938251758 2:129821250-129821272 CAGCACAGGAGTTGGGGATGAGG - Intergenic
938755855 2:134378248-134378270 CAGCACTAGAAGTGGGGAGGTGG + Intronic
938999572 2:136718503-136718525 CAAGAGATAAATTGGGGAAGTGG - Intergenic
939025533 2:137009444-137009466 TATGACATGAATGGGGGAGGAGG - Intronic
939522216 2:143245514-143245536 GAGAACATGAATTGAGGAGAAGG + Intronic
939960103 2:148558814-148558836 CAGGACATAAAGTGGGAAAGAGG + Intergenic
940174435 2:150863155-150863177 AAGGACATAAATTTGGGGGGCGG - Intergenic
940495014 2:154416474-154416496 CAATGCATGAATTTGGGAGGGGG + Intronic
940668590 2:156639694-156639716 CATGACTTTAATTGGGGAGGAGG - Intergenic
940809961 2:158231325-158231347 CAGGAGAAGATTTGAGGAGGTGG - Intronic
941018463 2:160383441-160383463 TTAGACATGAATTGGGGGGGGGG + Intronic
941885947 2:170527550-170527572 CAAGCCATGAATTAGGCAGGCGG - Intronic
942660402 2:178258185-178258207 AAGCGCTTGAATTGGGGAGGCGG - Intronic
942966578 2:181901101-181901123 TAAGTCAGGAATTGGGGAGGAGG - Intronic
943960069 2:194253262-194253284 AATGGCATGAACTGGGGAGGCGG + Intergenic
944719184 2:202405599-202405621 AAGGGCATGAACTTGGGAGGCGG + Intronic
944862116 2:203824954-203824976 CAACACATGAATTTGGGAGGTGG - Intergenic
945049957 2:205814304-205814326 CATGATATGTATTTGGGAGGGGG - Intergenic
945245980 2:207717555-207717577 AGGGTCATGGATTGGGGAGGAGG + Intronic
945963933 2:216165499-216165521 CAGGACATCAATTCTGGAGCTGG - Intronic
946146512 2:217735218-217735240 CAGGAGGTGAGTGGGGGAGGGGG - Intronic
946403077 2:219478969-219478991 GAGGACAGGAGGTGGGGAGGGGG + Intronic
947015312 2:225612870-225612892 CAACATATAAATTGGGGAGGGGG + Intronic
947063419 2:226192292-226192314 CACTACATGAATTGAGAAGGAGG + Intergenic
947881115 2:233513840-233513862 TAGGACATAAATTGGAGGGGTGG + Intronic
947995412 2:234523283-234523305 CAGCATATGAATTTGGGTGGGGG - Intergenic
948188921 2:236043632-236043654 CAGGACTTGAACTCGAGAGGCGG + Intronic
948322677 2:237083142-237083164 CAGTACAGGAATTTGGGAGTTGG - Intergenic
948815799 2:240509939-240509961 GAGGGCATGGATGGGGGAGGAGG - Intronic
948815868 2:240510139-240510161 GAGGGCACGGATTGGGGAGGAGG - Intronic
1169015128 20:2285845-2285867 CAGGAAGTGAATCAGGGAGGTGG + Intergenic
1169942082 20:10948026-10948048 CCTGACATTCATTGGGGAGGAGG + Intergenic
1170415035 20:16130489-16130511 CAGGAACTGAAGTGGGGAGGCGG - Intergenic
1171311690 20:24150079-24150101 CAGGACATGCATGGGTGAGGCGG + Intergenic
1172008879 20:31834834-31834856 CAGCACATGATGTGGGCAGGTGG + Intergenic
1172785594 20:37466319-37466341 CAGGACAGGAAAGGGAGAGGAGG - Intergenic
1172883870 20:38218529-38218551 GAAGAAATGACTTGGGGAGGGGG + Intronic
1173457310 20:43213901-43213923 CAGGACATCACATGGTGAGGGGG - Intergenic
1173614107 20:44391424-44391446 CAGGACAAGAGGTGAGGAGGGGG - Intronic
1173745305 20:45432197-45432219 CAGGACATCACATGGTGAGGGGG - Intergenic
1173750817 20:45474687-45474709 CATAAAATGAATTAGGGAGGAGG + Intronic
1174603828 20:51746025-51746047 CAGGACATGGATTGAGCTGGAGG + Intronic
1174702801 20:52625982-52626004 CATAACATGTATTTGGGAGGAGG + Intergenic
1175310986 20:58011465-58011487 GAGGACATGAAATGGGCAGAAGG + Intergenic
1175536966 20:59721562-59721584 CAGGCCAGGAGTTGGGAAGGGGG + Intronic
1175586624 20:60146277-60146299 CAGCACATGAATTGCAGGGGTGG - Intergenic
1175655367 20:60765240-60765262 CAGGAGCTGAAGTGGGGAGAAGG + Intergenic
1175761402 20:61564235-61564257 GTGGACGTGAATTTGGGAGGGGG + Intronic
1176861975 21:14015734-14015756 CTGGGCTTGAAGTGGGGAGGAGG + Intergenic
1176950247 21:15036353-15036375 CAGAAACTGAATTTGGGAGGAGG - Intronic
1177261049 21:18730466-18730488 AAGTACATGAATTGTGGAGATGG - Intergenic
1177277498 21:18932211-18932233 CATGACAGGTATTGTGGAGGTGG + Intergenic
1177297173 21:19190704-19190726 CTGGGGATGAATTGGGGAAGGGG - Intergenic
1177338409 21:19763642-19763664 CAGCACATGAATTTGGGGGTTGG - Intergenic
1177775112 21:25559251-25559273 CAATATATGAATTTGGGAGGTGG + Intergenic
1178504103 21:33149327-33149349 GAGGATATGAACTGGAGAGGGGG - Intergenic
1178772032 21:35514484-35514506 CAACACATGAATTGGGTGGGAGG - Intronic
1179225411 21:39448595-39448617 CAGGAGATGAATGTGGGAGGTGG + Intronic
1179391123 21:40992564-40992586 CTGGACATTATTTGGGGAGAGGG + Intergenic
1180011623 21:45055077-45055099 CATTACATGAAGTGGGAAGGTGG - Intergenic
1180309500 22:11158141-11158163 AATGGCATGAATCGGGGAGGCGG + Intergenic
1180547977 22:16519952-16519974 AATGGCATGAATCGGGGAGGCGG + Intergenic
1181342996 22:22197988-22198010 CAGGAAATGACCTGAGGAGGAGG - Intergenic
1181497149 22:23293811-23293833 CTGAACCTGAATAGGGGAGGGGG - Intronic
1181529695 22:23510298-23510320 CAACACAAGAATTTGGGAGGGGG - Intergenic
1182039696 22:27227304-27227326 GATGGCATGAACTGGGGAGGCGG - Intergenic
1182055890 22:27354335-27354357 TTGGAGATGAATTGGGCAGGGGG - Intergenic
1182851103 22:33475038-33475060 CAGGACATGCACCAGGGAGGGGG + Intronic
1184244074 22:43227119-43227141 AGGGACCTGAAGTGGGGAGGAGG - Intronic
1184258917 22:43303345-43303367 CAGGGCATGGATGGGGCAGGAGG - Intronic
1184717743 22:46291445-46291467 CAGGACAGGACTTGGAGAGAAGG - Intronic
1185357908 22:50385908-50385930 AATGGCATGAACTGGGGAGGTGG - Intronic
1185360346 22:50403118-50403140 CAGGACGTGAACCCGGGAGGCGG + Intronic
949612997 3:5722165-5722187 AATGACTTGAACTGGGGAGGCGG + Intergenic
949658332 3:6247712-6247734 CAGGAAATAAATTGGACAGGTGG + Intergenic
949666854 3:6348995-6349017 CAGGACATGAATTGGCATGAAGG + Intergenic
950138986 3:10602123-10602145 CAGGGCAGGAAGTGGGGAGGGGG - Intronic
950251357 3:11468397-11468419 GGGGACATGGAGTGGGGAGGAGG - Intronic
950397123 3:12742141-12742163 AATCACTTGAATTGGGGAGGTGG + Intronic
950875103 3:16264605-16264627 CAGGGCATTAGTTGGGGTGGGGG + Intronic
951405465 3:22291100-22291122 CATCATATGAAATGGGGAGGAGG + Intronic
952291844 3:32024575-32024597 CAGGACTTGAACCTGGGAGGTGG - Intronic
953996512 3:47523915-47523937 CAGGACTTGCAGTGGGGACGGGG + Intergenic
954368125 3:50156742-50156764 CAGGCCCGGAAGTGGGGAGGTGG + Intronic
956142817 3:66162767-66162789 AGGGACATGAATTGTGGAGGTGG + Intronic
956330612 3:68102913-68102935 CAGAACATGATTTGGGTAGGAGG - Intronic
956521431 3:70108551-70108573 CAGTATATGAATTTGGGTGGTGG - Intergenic
956916553 3:73877979-73878001 GTGGACATGAAGTGGGGAGCAGG + Intergenic
958953013 3:100436734-100436756 CAGCATATGAATGGGGGAAGGGG - Intronic
959712787 3:109401572-109401594 ATGGACATGAATTTGGGGGGGGG + Intergenic
960605101 3:119497063-119497085 GAGGACTTGAAATGGGTAGGAGG - Intergenic
961328735 3:126126740-126126762 CAGCATACGAATTGGGGAGTGGG - Intronic
961671733 3:128537215-128537237 GATGACCTGAATAGGGGAGGAGG - Intergenic
962428132 3:135292810-135292832 CAGTACATAAATGGGGGAGGAGG + Intergenic
962682193 3:137812017-137812039 GAGGACATGGATGGGTGAGGAGG - Intergenic
963327716 3:143880615-143880637 CAGGACAGAAAGTGGAGAGGTGG + Intergenic
963846033 3:150159067-150159089 CAGCAGAAGAATGGGGGAGGTGG - Intergenic
965037410 3:163458733-163458755 CAACATATGAATTTGGGAGGAGG - Intergenic
965208970 3:165759922-165759944 GAGGATAGGAAGTGGGGAGGGGG - Intergenic
965247459 3:166292027-166292049 CAGGAGATGGAGTGGGAAGGTGG + Intergenic
965859370 3:173129270-173129292 CAGGACATGAATTTTGGATTTGG + Intronic
966312247 3:178606660-178606682 AAGGACATGATTTGGGGGTGGGG + Intronic
966622410 3:181980268-181980290 CAGCATATGAATTTGGGAGCAGG - Intergenic
966651116 3:182302342-182302364 CAGAAAATGATTTGGGGTGGGGG + Intergenic
966894982 3:184437845-184437867 CAGGACATCACATGGTGAGGGGG - Intronic
966952569 3:184835794-184835816 AATGACATGAATCCGGGAGGTGG - Intronic
967129010 3:186453474-186453496 CAACACATGAATTGGGGGGCGGG - Intergenic
967870710 3:194226741-194226763 CAACATATGAATTGGGGTGGGGG - Intergenic
968432587 4:567499-567521 CAGGACATAAACTAGGCAGGAGG - Intergenic
969147378 4:5136026-5136048 CAGGAGGTGAATTCAGGAGGTGG + Intronic
969402989 4:6969490-6969512 AATGACATGAATCCGGGAGGCGG - Intronic
969636165 4:8370512-8370534 CAGGACAGGGATGGGGGAAGAGG + Intronic
970228043 4:13880179-13880201 CAGGACAGGAATTAGGCAGAAGG + Intergenic
970725243 4:19036345-19036367 CAACACATGAATTGGGGGTGGGG - Intergenic
970976292 4:22046700-22046722 CAGGGCATGACATGGTGAGGGGG - Intergenic
971018620 4:22512967-22512989 CAGGACAGGAATCTGGGACGTGG + Intronic
971245351 4:24922193-24922215 CAGCATATGAATTTGGGAGGAGG + Intronic
971282235 4:25250293-25250315 AAGGACATGAATGGAGCAGGAGG + Intronic
971456466 4:26850098-26850120 CAACATATGAATTTGGGAGGGGG - Intergenic
971635998 4:29058494-29058516 AATCACTTGAATTGGGGAGGTGG + Intergenic
972023877 4:34352205-34352227 ATGGACATGAATTGGGGGGCAGG + Intergenic
972240678 4:37188503-37188525 AAGCACTTGAACTGGGGAGGTGG + Intergenic
972362115 4:38336329-38336351 CAGGACAGCACATGGGGAGGGGG - Intergenic
973174361 4:47186201-47186223 CAAGGCATGAATTGGTGGGGGGG + Intronic
974164617 4:58185386-58185408 CAGGACTTTAAAAGGGGAGGGGG + Intergenic
974901896 4:68009736-68009758 CAGGACATGGAGTGGGGAGAAGG - Intergenic
976088968 4:81435553-81435575 AATGGCATGAACTGGGGAGGTGG - Intronic
976305787 4:83558125-83558147 AATCACTTGAATTGGGGAGGCGG + Intronic
976473410 4:85455458-85455480 AAGGGGATGAAGTGGGGAGGTGG - Intergenic
976554809 4:86438106-86438128 GAGGGCATAAATGGGGGAGGAGG + Intronic
976950238 4:90819326-90819348 CAATACATGAATTGTGGAGCAGG + Intronic
977776357 4:100924563-100924585 CAGGACAGGGATTGGGGAAGAGG + Intergenic
977850591 4:101822700-101822722 AATGACATGAACTTGGGAGGTGG - Intronic
978486480 4:109260432-109260454 CAAGACAAGACTTTGGGAGGGGG - Intronic
978875580 4:113636827-113636849 CAACATATGAATTGGGGAGGTGG + Intronic
981788258 4:148505184-148505206 CAATACATGAATTTGGGAAGGGG - Intergenic
982605539 4:157512374-157512396 GAGGACGTGAATTGTGTAGGTGG - Intergenic
982882873 4:160742279-160742301 CAACATATAAATTGGGGAGGGGG - Intergenic
984025113 4:174534008-174534030 AGTGACATGAATTGGGGAGAAGG + Intergenic
984170992 4:176359002-176359024 GACAACTTGAATTGGGGAGGGGG + Intergenic
984785411 4:183563215-183563237 CAGGACCTGAACCTGGGAGGTGG + Intergenic
985130345 4:186732721-186732743 CAACACATGAACTGGGGAGATGG + Intergenic
987159420 5:15125849-15125871 CAGGACATGACATGGTGAGGGGG - Intergenic
987254412 5:16135344-16135366 CTGGACATGAATTGGAAAGCTGG + Intronic
987472289 5:18347887-18347909 AATGGCATGAACTGGGGAGGTGG - Intergenic
987610229 5:20193578-20193600 CATAAAATGAATTGGGGAGTAGG - Intronic
991399202 5:66235882-66235904 AAGCACTTGAATTGGGGAGGCGG + Intergenic
993387837 5:87280841-87280863 AATGGCATGAACTGGGGAGGTGG - Intronic
993635734 5:90341254-90341276 AATGGCATGAATTCGGGAGGCGG + Intergenic
995411932 5:111867559-111867581 CAATATATGAATTGGGGATGGGG + Intronic
995565416 5:113429127-113429149 CAGCATATGAATTTGGGAAGGGG - Intronic
995844786 5:116481853-116481875 TAAGCCATGATTTGGGGAGGAGG + Intronic
995954035 5:117753048-117753070 AATGACATGAATCCGGGAGGCGG + Intergenic
997539510 5:134649558-134649580 CAGGCCCTGAAGTGGGGTGGGGG + Intronic
997877320 5:137560828-137560850 CAGCATATGAACTGGGGTGGGGG + Intronic
998017467 5:138743839-138743861 AAGGGAATGAAATGGGGAGGAGG + Intronic
999067834 5:148710347-148710369 CAACACAAGAATTTGGGAGGGGG + Intergenic
999259789 5:150230956-150230978 CAGGAGATGAGCTGGGAAGGTGG - Intronic
999537673 5:152535358-152535380 CAGGACATTACATGGCGAGGGGG - Intergenic
999831420 5:155323875-155323897 CAACGTATGAATTGGGGAGGGGG - Intergenic
999971430 5:156867845-156867867 TATGACATGCATTGGGGAAGAGG + Intergenic
1000114776 5:158143441-158143463 CAGGGCATGCAGTGGGGTGGGGG - Intergenic
1000784922 5:165531083-165531105 GAAGACATGAATTTGGGAGGCGG + Intergenic
1001334535 5:170786237-170786259 AAGGACAGGGATTGGGGAGATGG + Intronic
1002884444 6:1281264-1281286 CAGGGAATGAGTTGGGGAGAGGG + Intergenic
1003142195 6:3480939-3480961 CAGCATATGAATTTGGGAGGGGG + Intergenic
1003809850 6:9767644-9767666 CAGGGCATGCAATGGGGATGTGG + Intronic
1004349379 6:14877957-14877979 CAGGACTTGAATATGTGAGGAGG + Intergenic
1004658478 6:17688030-17688052 AATGGCATGAATTCGGGAGGCGG + Intronic
1005287143 6:24339963-24339985 AAGGAAATGAATTGGTGAAGCGG + Intronic
1005824654 6:29625528-29625550 AAGGAAATCTATTGGGGAGGGGG - Intronic
1006682140 6:35805160-35805182 GATGACAAGAATTGGGAAGGTGG - Intergenic
1007165678 6:39827437-39827459 CAGGAGCTGAAGTGGGGCGGGGG + Intronic
1007495512 6:42257771-42257793 CTGGCCAAGAATTGGGGAGGAGG + Intronic
1009878281 6:69533389-69533411 TTGGACATGACTTGGAGAGGTGG - Intergenic
1010302124 6:74273426-74273448 CAGGACATTACATGGTGAGGTGG + Intergenic
1010412145 6:75572844-75572866 CATGAAATGATTTAGGGAGGAGG - Intergenic
1010824409 6:80455054-80455076 CAGGAAATAAATGGGAGAGGAGG - Intergenic
1010974473 6:82296897-82296919 CAGCATATGAATTTGGAAGGGGG + Intergenic
1011171643 6:84511266-84511288 CAACATATGAATTTGGGAGGTGG - Intergenic
1011190939 6:84727551-84727573 TAGGACATCACTTGGTGAGGAGG - Intronic
1011862013 6:91770325-91770347 CAGGACAATAATTGGGTCGGGGG + Intergenic
1012269866 6:97195299-97195321 CAGCAGATGAACTGGAGAGGTGG + Intronic
1013095669 6:106942844-106942866 CAAGATATGAATTTGGGAGGTGG - Intergenic
1014642177 6:123926159-123926181 CAACATATGAATTTGGGAGGAGG + Intronic
1016030537 6:139332903-139332925 AAGCACATGAACTGGGGATGCGG + Intergenic
1016085838 6:139913208-139913230 CAGGACATGAACCCGGGAGGCGG + Intergenic
1017206570 6:151808931-151808953 CAGGACGTGGGGTGGGGAGGAGG - Intronic
1018897139 6:168027591-168027613 CTGGACATGACTGTGGGAGGTGG + Intronic
1019302693 7:316049-316071 CAGGACATGGCTCAGGGAGGCGG - Intergenic
1020390223 7:7649746-7649768 CAGCATATGAATTGGGTGGGGGG - Intronic
1020622790 7:10537972-10537994 CAGGCTTTGATTTGGGGAGGAGG + Intergenic
1020974407 7:14987610-14987632 CAGGAAAGGAGTTGGGGAAGCGG + Intergenic
1021510066 7:21425613-21425635 CAACACATGAATGGGGAAGGGGG + Intergenic
1021736667 7:23645975-23645997 CTGAACAGGAATTGGGAAGGAGG - Intergenic
1022501971 7:30887476-30887498 CTGGGCATGCGTTGGGGAGGAGG + Intronic
1022653117 7:32294996-32295018 CAGGTCATGAAATGGGTATGTGG - Intronic
1023256655 7:38319033-38319055 CAGGCCAAGACTTGGGTAGGAGG - Intergenic
1023808078 7:43889150-43889172 CAGAACATGAAATGTGGAGGGGG + Intronic
1024719180 7:52115831-52115853 GAAGACTAGAATTGGGGAGGGGG - Intergenic
1026109738 7:67449537-67449559 CAGGGCATCACTTGGCGAGGGGG + Intergenic
1026806054 7:73430204-73430226 CAGGAAATGAAGAGGTGAGGCGG + Intergenic
1027291457 7:76716421-76716443 AAGGACTTGAAAAGGGGAGGGGG + Intergenic
1029167407 7:98602522-98602544 CAGGGCATCACGTGGGGAGGGGG - Intergenic
1029256990 7:99276301-99276323 CTAGACATGGATTTGGGAGGAGG - Intergenic
1030688770 7:112511822-112511844 CAACACATGAATTTGGGAGGAGG + Intergenic
1031023221 7:116650890-116650912 CATGACAAGAATTGTGGAGTAGG - Intergenic
1031147396 7:118012039-118012061 GAGGAAATGATTTGGGGAGGGGG + Intergenic
1032018967 7:128396140-128396162 CTGAACATGAAGTGGGAAGGGGG - Intronic
1032222697 7:130006589-130006611 CGGGCACTGAATTGGGGAGGGGG + Intergenic
1032398874 7:131610111-131610133 CAGGACAGGGGTTGGGGTGGAGG - Intergenic
1032969313 7:137140492-137140514 CTGGAAATGACTTGAGGAGGGGG + Intergenic
1033063629 7:138130935-138130957 GAGGACATGAATTGAGAAGCAGG - Intergenic
1033607683 7:142939537-142939559 CAGGACAGGAATGGGGCAGGAGG + Exonic
1034441855 7:151089692-151089714 CAGGACAGGATTTGAGGAGAGGG + Intronic
1035000714 7:155610305-155610327 CCGGGTATGAATTTGGGAGGAGG + Intergenic
1035516808 8:240707-240729 AAGGACATGCAGTGGGTAGGGGG - Intronic
1037396452 8:18448974-18448996 GAAGACTTGAAATGGGGAGGGGG - Intergenic
1038003116 8:23407201-23407223 CAGGACCTGAGTGGTGGAGGTGG - Intronic
1038930810 8:32191674-32191696 CTGGACAGGAAATGGGGATGGGG + Intronic
1039306948 8:36273129-36273151 CAGGGCATGCAATGGGGATGCGG - Intergenic
1039373812 8:37013448-37013470 GAAGACTTGAAGTGGGGAGGGGG - Intergenic
1039427793 8:37501023-37501045 CAGGTCATGAAGCCGGGAGGAGG - Intergenic
1039565053 8:38545339-38545361 AATGGCTTGAATTGGGGAGGTGG + Intergenic
1039906537 8:41790562-41790584 CAGGTCATGAATTGGTGGGGTGG - Intronic
1040555621 8:48475189-48475211 CAGGATATGAATGGGGCAGTAGG - Intergenic
1040698291 8:50029493-50029515 CAGGAAGAGAAGTGGGGAGGTGG - Intronic
1040761340 8:50849090-50849112 AATCACTTGAATTGGGGAGGCGG + Intergenic
1041158941 8:55017888-55017910 AAGAACATGACTTGGGGAGTGGG + Intergenic
1041164807 8:55080698-55080720 CAATACATGAATTGGAGTGGGGG + Intergenic
1043543233 8:81286719-81286741 CAGGAAATGAAATCAGGAGGGGG - Intergenic
1043561538 8:81499557-81499579 CAGCAGATGAGTTGGGGGGGGGG + Intergenic
1045284404 8:100778066-100778088 AATCACTTGAATTGGGGAGGCGG - Intergenic
1045381800 8:101634740-101634762 AAGGACATGACTTGGGGAGTGGG + Intronic
1045614643 8:103895569-103895591 CAACACATGAATTTGGCAGGAGG + Intronic
1045947079 8:107808540-107808562 CAGAACAGGAATTAGGGAAGGGG - Intergenic
1046024575 8:108707008-108707030 AAGGACATGAACTTGGGATGAGG - Intronic
1048204759 8:132406477-132406499 CAGGAATGGAATTGTGGAGGGGG - Intronic
1049162392 8:141105717-141105739 CAGGACCTGCCTTGGGGAAGAGG - Intergenic
1049767288 8:144360724-144360746 GGGGACATGAAGTGGGGTGGGGG + Intronic
1049948057 9:617344-617366 TAGGAGAAGGATTGGGGAGGAGG + Intronic
1050756297 9:9008312-9008334 AGTGACATGAACTGGGGAGGCGG - Intronic
1052084825 9:24252003-24252025 AATGACATAAATTGGGCAGGGGG - Intergenic
1053227682 9:36374914-36374936 CAACACATTAATTGGGGAGGAGG + Intronic
1053300910 9:36948816-36948838 CAGGAAAGGAGTTGGAGAGGAGG - Intronic
1053397651 9:37788742-37788764 CAGGAATTGAGCTGGGGAGGCGG + Intronic
1056625276 9:88248257-88248279 CAGGACATTGAGTGAGGAGGGGG + Intergenic
1056762476 9:89425212-89425234 CAGGACATACCTAGGGGAGGTGG - Intronic
1058301828 9:103383588-103383610 CATCAGATGACTTGGGGAGGTGG + Intergenic
1058636470 9:107043167-107043189 AAGGGCATGAATTGTAGAGGAGG - Intergenic
1059763764 9:117363748-117363770 CAGGACATGATGTAGAGAGGTGG + Intronic
1060043940 9:120325415-120325437 CAGGACAGGAGTTGGGGGTGGGG - Intergenic
1060626316 9:125115283-125115305 AATGACATGAACTCGGGAGGCGG + Intronic
1060858924 9:126937950-126937972 CAGGAAGTGAATGGGGGAGGTGG + Intronic
1060877770 9:127095614-127095636 CAGGAATTCAAGTGGGGAGGAGG - Intronic
1061164326 9:128913591-128913613 CAGGGCATGTTCTGGGGAGGAGG + Intronic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1062002635 9:134224615-134224637 CATGACATGAATTGAGTAGCAGG + Intergenic
1062102658 9:134736600-134736622 AAGGACATGAATTTGGGGGCTGG - Intronic
1062280753 9:135750648-135750670 CAGGATAGGGATTGGGGAGCAGG - Intronic
1062447748 9:136602736-136602758 CAGGACAGAAATTGGGTGGGGGG - Intergenic
1203775381 EBV:70106-70128 CAGGACATGTTTGGGGGAGTTGG + Intergenic
1187302487 X:18064588-18064610 CAGGGCATGAAGAGTGGAGGAGG - Intergenic
1187892441 X:23948779-23948801 CAACATATGAATTGGGGTGGGGG + Intergenic
1188563294 X:31494593-31494615 AAGAACATGACTTGGGGAGATGG - Intronic
1188874915 X:35417793-35417815 GAGCACATGAACTGGGGAGCAGG - Intergenic
1188885337 X:35543144-35543166 CATGGCATGAATCCGGGAGGCGG - Intergenic
1189136503 X:38556036-38556058 CAGGACATCACATGGGGAGGGGG + Intronic
1189254016 X:39623435-39623457 AAGGACATGAATTTTGGGGGGGG - Intergenic
1189356299 X:40312446-40312468 CAACACATGAATTTGGGAGGGGG - Intergenic
1189739173 X:44100913-44100935 GAGGAGATGAGTTGGGGAGTAGG + Intergenic
1190249077 X:48708582-48708604 CAGGCCAAGAATTGGGGGTGGGG + Exonic
1191766539 X:64704795-64704817 CAGGACATGCAATGGGGGTGTGG + Intergenic
1192207415 X:69105605-69105627 CAGCAGGTGAATTGGGGTGGGGG + Intergenic
1192718442 X:73667621-73667643 CCGGACATGAATTTGGGGGTTGG + Intronic
1194120139 X:89951715-89951737 GAAGACTTGAAATGGGGAGGGGG - Intergenic
1194815281 X:98433226-98433248 CAGGACAGGAATTGGGGCAAAGG - Intergenic
1195000573 X:100639486-100639508 CAGGAAATTAATTGGGAAGGGGG - Intronic
1195245204 X:102989026-102989048 GAGTACAGGAATTAGGGAGGCGG + Intergenic
1195303739 X:103558041-103558063 CAGGACACGTATTGTTGAGGTGG + Intergenic
1195527666 X:105910610-105910632 CAGGGCATGGAGTGAGGAGGTGG + Intronic
1195656709 X:107338329-107338351 CAACATATGAATTTGGGAGGGGG - Intergenic
1196825001 X:119733941-119733963 AATGGCATGAACTGGGGAGGTGG + Intergenic
1198934626 X:141893702-141893724 GAGGGCAGGAATTGGGGGGGGGG + Intronic
1200155845 X:153974552-153974574 CAGGACATGGAATGGGAAGCTGG + Intronic
1200473000 Y:3609236-3609258 GAAGACTTGAAATGGGGAGGGGG - Intergenic