ID: 1090241054

View in Genome Browser
Species Human (GRCh38)
Location 11:125182164-125182186
Sequence TTACAATCCTGGGCAAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090241054_1090241059 8 Left 1090241054 11:125182164-125182186 CCCCAGTTTGCCCAGGATTGTAA 0: 1
1: 0
2: 5
3: 21
4: 170
Right 1090241059 11:125182195-125182217 ACACTGAAAGTCTGTTTCTGTGG 0: 1
1: 0
2: 4
3: 29
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090241054 Original CRISPR TTACAATCCTGGGCAAACTG GGG (reversed) Intronic
901639161 1:10684635-10684657 TTGCAGTTCTGGGCAAACTGGGG + Intronic
901806449 1:11741566-11741588 TTACAAAGATGGGGAAACTGAGG - Intronic
902404896 1:16177221-16177243 TTACAAAGATGGGGAAACTGAGG - Intergenic
904230252 1:29064021-29064043 TTTGAATACTGGGCAACCTGAGG - Intronic
904353831 1:29925887-29925909 GGACAGTCCTGGGCACACTGGGG - Intergenic
904774965 1:32901044-32901066 TTTCACTGCTGGGGAAACTGAGG + Intronic
905304838 1:37010420-37010442 CTACAATCCTGGGGAAACCAAGG + Intronic
907546270 1:55262591-55262613 TGACAGTCCTGGGTAAACTGGGG + Intergenic
909942792 1:81630588-81630610 TTAAAATTCTAGGAAAACTGAGG - Intronic
912142685 1:106750503-106750525 TTAAATTCTTGGGCGAACTGGGG - Intergenic
913070443 1:115293626-115293648 TTTCTATCCTGGCCACACTGAGG - Exonic
913438278 1:118870226-118870248 CCACAATGCTGGGAAAACTGAGG + Intergenic
917880870 1:179334723-179334745 TTACAATACTGGGCCAGGTGCGG + Intronic
919818850 1:201460003-201460025 TCTCAGTCCTAGGCAAACTGTGG - Intergenic
919876138 1:201870245-201870267 TTACAATCTTGGAATAACTGGGG - Intronic
921050636 1:211508912-211508934 TAACTTTCCTGGGCAAATTGGGG + Intergenic
922516356 1:226210945-226210967 TTTCAATGCTGGCAAAACTGAGG + Intergenic
1064245418 10:13664098-13664120 TTTCACTGCTGGGGAAACTGAGG + Intronic
1064368622 10:14730762-14730784 GAACATTCCTGGGCAAACTGGGG - Intronic
1064531399 10:16314301-16314323 TGATAATTCTGGGCAAACTTGGG + Intergenic
1068804510 10:61180061-61180083 TTAGAACCCTGGGGAAAGTGAGG - Intergenic
1069898967 10:71696137-71696159 CCAGAATCCTGGGGAAACTGAGG + Intronic
1072587760 10:96797952-96797974 TTAAAATCCTGGGGATACTTTGG + Intergenic
1072993248 10:100218667-100218689 TTACAACTCTGGAGAAACTGAGG + Intronic
1073465061 10:103690059-103690081 ACACAGTCCTTGGCAAACTGAGG - Intronic
1074424610 10:113339858-113339880 TTACAGTCCTGGGGAAACCTTGG + Intergenic
1075266697 10:121006267-121006289 TTACAAACCAGGGGAAATTGGGG - Intergenic
1075980022 10:126730308-126730330 GGACAATGCTGGGAAAACTGGGG - Intergenic
1079412013 11:20197299-20197321 CTACAATTCTGGGAAAACTAAGG + Intergenic
1080397146 11:31900684-31900706 TGACTATCCTGGGCACACTAAGG - Intronic
1081755464 11:45541144-45541166 TTTCAATCCTGGGCCAGGTGTGG + Intergenic
1082671992 11:56045536-56045558 TAACAACCCTGGCCAAACTCTGG + Intergenic
1082690068 11:56290931-56290953 TTACTATGCTGGGCAATGTGGGG - Exonic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084861775 11:72023475-72023497 TTAGAATCCTGTTCCAACTGAGG + Intronic
1085051777 11:73383712-73383734 TTTCACAGCTGGGCAAACTGAGG - Intronic
1086065024 11:82734532-82734554 TGAGAATCCTGGGAAAACTCAGG - Intergenic
1086512873 11:87578698-87578720 CTACATTTCTGAGCAAACTGAGG - Intergenic
1087043956 11:93829157-93829179 TCTCAGTCCTGGACAAACTGGGG - Intronic
1088480312 11:110290870-110290892 TTAAAATACTTGGCAAATTGTGG - Intronic
1089047264 11:115513015-115513037 TCACAATCCATGGCAATCTGAGG - Intergenic
1089794376 11:120968230-120968252 ATACCATCCTGGGCAAACTAGGG - Intronic
1090241054 11:125182164-125182186 TTACAATCCTGGGCAAACTGGGG - Intronic
1090252764 11:125263164-125263186 TTGCATTTCTGGGGAAACTGAGG - Intronic
1091100304 11:132866223-132866245 TTTCATTCCTGAGGAAACTGAGG + Intronic
1091454578 12:597421-597443 TTAGTATCCTGGGTAAACAGTGG - Intronic
1093775446 12:23068434-23068456 TTACAATCTTGGGCCAGGTGCGG - Intergenic
1094640669 12:32271995-32272017 CTACAATAATGGGTAAACTGAGG - Intronic
1098207106 12:68122612-68122634 TTTTAAACCTAGGCAAACTGAGG - Intergenic
1102642852 12:114382114-114382136 TGACCAGCCTGGGCAACCTGGGG + Intronic
1104503518 12:129309044-129309066 TTACATGAGTGGGCAAACTGAGG - Intronic
1104814348 12:131637369-131637391 TTACTATCCTGGGCACTCTGGGG - Intergenic
1104888935 12:132130334-132130356 TGACACATCTGGGCAAACTGTGG + Intronic
1105733756 13:23246590-23246612 TTATAATAATGGGCAAAATGAGG - Intronic
1105781554 13:23709224-23709246 CTTGAATCCTGGGCACACTGGGG + Intergenic
1112211422 13:97381410-97381432 TTAGAATCCTGGGCACATTTTGG - Intronic
1112746838 13:102536478-102536500 CTACATTTCTGGGCACACTGCGG - Intergenic
1117720190 14:58621612-58621634 GTACAATCTTGGACAAACTGGGG - Intergenic
1119148684 14:72338663-72338685 TTACAAACCTATACAAACTGGGG + Intronic
1121403387 14:93702708-93702730 TTTCTAACCTGGGCAAACTGGGG - Intronic
1121770582 14:96532825-96532847 TTACTATCCTGGCCAAACTAGGG - Intronic
1122272846 14:100576056-100576078 TTTCACTGCTGGGGAAACTGAGG + Intronic
1125821694 15:42637411-42637433 AGACAAGCCTGGGCAACCTGCGG - Intronic
1125893945 15:43286437-43286459 TTTCACACCTGGGCAAAGTGAGG + Intronic
1125900983 15:43346963-43346985 TGAGAATTCTGGGAAAACTGAGG - Intronic
1127889963 15:63241521-63241543 TTACAAGCCTGTTCACACTGTGG + Intronic
1128070315 15:64791711-64791733 TTGCACTCGTGGGGAAACTGCGG - Intergenic
1135777456 16:25269261-25269283 TTTCAGTCCTGGGCCAACAGTGG - Intergenic
1137515243 16:49137852-49137874 TTACAGAGCTGGGGAAACTGAGG + Intergenic
1138047977 16:53745901-53745923 TTACCAGCCTGGGCAATCTAAGG + Intronic
1146461210 17:33047272-33047294 CTGCAATCCTTGGCATACTGGGG + Intronic
1146595181 17:34162311-34162333 TTCTAATCCTGGGGAACCTGGGG + Intronic
1147876994 17:43628745-43628767 TTGCACTCATGGGGAAACTGAGG - Intergenic
1149300619 17:55301981-55302003 TAACAGTGGTGGGCAAACTGAGG + Intronic
1150177748 17:63079383-63079405 AAACAATAGTGGGCAAACTGTGG - Intronic
1151895044 17:76974545-76974567 TTGCAGTCCTGGGCAAACCAAGG + Intergenic
1153972241 18:10237311-10237333 TTTTAATCTTGGCCAAACTGAGG + Intergenic
1154324756 18:13381905-13381927 TTCTAAACCTCGGCAAACTGGGG - Intronic
1154422624 18:14247811-14247833 TGACCATCCTGGCCAAAATGGGG - Intergenic
1157596415 18:48866718-48866740 TTTCAAATCTGGGGAAACTGAGG + Intergenic
1159479547 18:68970609-68970631 AAACAATCCTGAGGAAACTGAGG - Intronic
1163042808 19:14615062-14615084 TTTTATACCTGGGCAAACTGAGG + Intergenic
1164149966 19:22542251-22542273 GGACCATCCTGGGCAAAATGGGG - Intergenic
1164317869 19:24110360-24110382 ATACAAGCCTGGGCAAAATATGG + Intronic
1164859775 19:31553818-31553840 TTCCAGTCCAGGGCAAAGTGAGG + Intergenic
1166210980 19:41306443-41306465 TTCCACTGCTGGGCATACTGGGG - Exonic
925408855 2:3627209-3627231 CTGCAGTCCTGGGCAAACTGGGG + Intronic
925593718 2:5535012-5535034 TTACATTCCTGGGTAAAATGGGG + Intergenic
926352948 2:12013987-12014009 TTTCAAAGCTGGGGAAACTGAGG - Intergenic
926745863 2:16157443-16157465 TTACAATGATGGGTAAAGTGGGG - Intergenic
928261208 2:29768271-29768293 TTAGAATTCTGGGTAAACGGGGG + Intronic
928362249 2:30674647-30674669 TTACAATCCTGGGCTAACCTTGG - Intergenic
930150257 2:48052003-48052025 TTCTAATCCTGGGCACACAGTGG - Intergenic
931441558 2:62293929-62293951 TTACAGTGCTGGTCACACTGGGG - Intergenic
935973044 2:108549491-108549513 TTACCATCCTGGCCAACATGGGG - Intronic
937302235 2:120850187-120850209 TTAAAGTGCTGGGCACACTGAGG - Intronic
938109249 2:128553102-128553124 TTCCACACCTGGGGAAACTGAGG - Intergenic
938783285 2:134604236-134604258 TTACAATACAGGGAAAGCTGGGG + Intronic
940978817 2:159978057-159978079 TTGGAATCCTGGGTAAACTTAGG + Intronic
941778633 2:169420328-169420350 TTACCATCCTAGGCAACATGAGG + Intergenic
942674355 2:178412075-178412097 TTACCATCATGGGCAAACTGTGG - Intergenic
943715125 2:191143332-191143354 TTACACTGCTGAGGAAACTGAGG + Intronic
943782799 2:191843676-191843698 TTAAGATCCTGGGCAAGGTGAGG + Intronic
945460669 2:210104180-210104202 TGACACTCCTGGGGAACCTGAGG + Exonic
947200557 2:227611337-227611359 TTATAATCCTAGGCAAAGAGTGG + Exonic
947417042 2:229907552-229907574 TTACAATGCTGAGGAAGCTGAGG + Intronic
948134648 2:235627664-235627686 TTACTATCCTGGGCAATCTGGGG - Intronic
1173199321 20:40943160-40943182 GGACAGTCCTGGGCAAACTGGGG - Intergenic
1174465495 20:50714009-50714031 TGTCCAACCTGGGCAAACTGAGG + Intergenic
1174867532 20:54151866-54151888 TTTCACACCTGGGGAAACTGAGG - Intergenic
1175610422 20:60346852-60346874 TCACAGTCCCAGGCAAACTGGGG + Intergenic
1177279233 21:18957981-18958003 TAACAATCCTGAGCAAAAAGAGG + Intergenic
1177639303 21:23825980-23826002 TTACAATACATGGCAAAATGAGG - Intergenic
1178973795 21:37204900-37204922 TTCCAATCCAGGCCACACTGAGG - Intergenic
1182129731 22:27842184-27842206 GGACAGTCCTGGGCAAAGTGTGG + Intergenic
1184316306 22:43693558-43693580 TAAAAATCATGGGAAAACTGAGG + Intronic
952038632 3:29234728-29234750 TTACAATAATGGGGATACTGTGG + Intergenic
952824512 3:37513905-37513927 GTACAATACTGGGCAATGTGCGG + Intronic
955225523 3:57057057-57057079 TTATGATCCTGGGTAAAATGGGG + Intronic
956411101 3:68980722-68980744 TCACATTCCTGGAGAAACTGAGG - Intronic
961971939 3:130977198-130977220 AGACAATCCTGGGAAGACTGTGG + Intronic
964465189 3:156984034-156984056 TTACAATCCTGGACATACTTTGG - Intronic
965509204 3:169549593-169549615 GGAAAATCCTGGGCAAGCTGTGG - Intronic
967263316 3:187667056-187667078 TTACAGAAATGGGCAAACTGAGG + Intergenic
967269452 3:187720717-187720739 TTCCAAAACTGGGCAAACTGAGG + Intronic
968666651 4:1826002-1826024 TTTCCATCCTGGGCACACTTTGG - Intronic
970260981 4:14224670-14224692 TAACAATCCTGAGCACACTAGGG + Intergenic
975244741 4:72107044-72107066 GGAAAATCCTGGGCACACTGTGG - Intronic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
982997224 4:162364826-162364848 CTACAATACAGGGCAAACTAAGG + Intergenic
984472061 4:180189081-180189103 TTACAATCGTGGCAGAACTGGGG + Intergenic
985573926 5:665012-665034 TTACATTCCTGTACTAACTGGGG - Exonic
985967822 5:3351112-3351134 TTCCAATCCTGGGCAGCTTGGGG - Intergenic
990737018 5:58875508-58875530 CTATAATCCTGGACAAACTGGGG - Intergenic
992890717 5:81201522-81201544 TTAGAATCCTGGGGACAGTGGGG + Intronic
992950922 5:81857335-81857357 TTACAAGCATGGGCTAAATGGGG - Intergenic
996670961 5:126116873-126116895 TTCCAATCCAGGACCAACTGTGG + Intergenic
999127756 5:149259018-149259040 TTACAATCCAGGGCAGAAGGAGG - Exonic
1000761752 5:165234163-165234185 TCTCAATCCTGGGCAAACTGAGG - Intergenic
1001233270 5:170008316-170008338 TTAACATCCTGGCCAAAGTGAGG - Intronic
1001489922 5:172148125-172148147 TTCCAACCCTGGACACACTGTGG + Intronic
1001525078 5:172423157-172423179 TAACAAGCCCGGGCAAACTGAGG + Intronic
1001956998 5:175854453-175854475 TTACACTGAAGGGCAAACTGAGG - Intronic
1001998599 5:176182074-176182096 TTACAATGCTGGGCAGTGTGTGG + Intergenic
1004723251 6:18287613-18287635 TCACACTCCTGGGCTAACTCAGG - Intergenic
1006202766 6:32311448-32311470 TTACCCTCCTCAGCAAACTGAGG + Intronic
1006787381 6:36677807-36677829 ATACACTGCTGGGGAAACTGGGG - Intronic
1006929748 6:37680627-37680649 TTCCCAGCCTGAGCAAACTGGGG - Intronic
1007179147 6:39915821-39915843 CTCAAGTCCTGGGCAAACTGGGG + Intronic
1007308732 6:40927840-40927862 TTGCTTTCCTGGGAAAACTGGGG - Intergenic
1010399467 6:75431732-75431754 TTGGACTCCTGGGCCAACTGAGG + Intronic
1010943025 6:81941614-81941636 TTACAACTGTGGGCACACTGGGG + Intergenic
1012538152 6:100324867-100324889 TTACAAGCCTGGAGAGACTGGGG - Intergenic
1015316825 6:131826433-131826455 TTACATTCCTGGATAAACTGGGG - Intronic
1015671491 6:135695441-135695463 TTCCAAATCTGGGCAAACTTTGG + Intergenic
1017029596 6:150209130-150209152 TTAAACTCCTGTGCAAATTGTGG - Intronic
1018259387 6:161954294-161954316 TTATAATCCTGGCAAGACTGAGG + Intronic
1019510370 7:1414628-1414650 TTGCAAAGCTGGGGAAACTGAGG + Intergenic
1020371366 7:7435494-7435516 CTTCAATCCCGGGCAAACTAGGG + Intronic
1020809053 7:12829190-12829212 TTTCAGTCCTGGGCAAGCAGGGG - Intergenic
1029861009 7:103572100-103572122 TCAAAATCCTGGCCAAACTTTGG + Intronic
1032173944 7:129608784-129608806 TTACCATTCTGAGCAAACTGAGG - Intergenic
1032786289 7:135203073-135203095 TTATCATCCCGAGCAAACTGGGG + Intronic
1033607634 7:142939211-142939233 TTACATTCATGAGGAAACTGAGG - Intergenic
1033802939 7:144921902-144921924 TGCCATTCCTGGGCACACTGAGG - Intergenic
1033869013 7:145727256-145727278 ATACAATCCTGGGCAAATTGAGG - Intergenic
1035076467 7:156180832-156180854 TTTCAATCCTTGGGAATCTGTGG + Intergenic
1037243014 8:16799145-16799167 TTACATTTCTGGACAATCTGGGG + Intergenic
1037783782 8:21889695-21889717 CAGCACTCCTGGGCAAACTGTGG + Intergenic
1041157002 8:54998109-54998131 TTCCAAGCCTGGGGAAACAGTGG + Intergenic
1042167650 8:65961226-65961248 TTAGAATGCTGGGCAAAATGTGG + Intergenic
1043956774 8:86369566-86369588 TTACAATACTGTGCAAACTGGGG - Intronic
1044806326 8:96011947-96011969 TCACACTCCAGGGCAAACCGGGG - Intergenic
1047887669 8:129270465-129270487 TTTCATACCTGGGAAAACTGAGG + Intergenic
1048112366 8:131482739-131482761 TAACAATGATGTGCAAACTGAGG + Intergenic
1049550398 8:143255257-143255279 TTTCACACCTGGGAAAACTGAGG - Intronic
1052000934 9:23279426-23279448 TGACAATACTGGGCAGACAGAGG + Intergenic
1052544010 9:29849682-29849704 TTACAATAATGTGCAAATTGGGG + Intergenic
1053366062 9:37523349-37523371 AGACCATCCTGGGCAAAATGGGG + Intronic
1053380342 9:37644288-37644310 TTTCAATCCTGGGCTACCTGAGG - Intronic
1054716539 9:68562536-68562558 TTCTTATCCTGGGGAAACTGAGG - Intergenic
1055631852 9:78232819-78232841 TTACAATTCTAGGTAAAGTGTGG + Intergenic
1055699589 9:78928529-78928551 TGACCATTCTGGGCCAACTGTGG - Intergenic
1057401354 9:94726427-94726449 TCACCAGCCTGGGCAACCTGGGG - Intergenic
1058537892 9:105980935-105980957 GGACAGTCCTGGGAAAACTGGGG + Intergenic
1059488311 9:114644759-114644781 TTATATTGATGGGCAAACTGAGG - Intronic
1059748704 9:117228079-117228101 TTTTAAACCTGGGGAAACTGAGG - Intronic
1061054010 9:128212225-128212247 TTTCACTGGTGGGCAAACTGAGG + Intronic
1062057584 9:134476524-134476546 TCACAAAGATGGGCAAACTGAGG - Intergenic
1187211620 X:17237749-17237771 TAACTATCTTGGGGAAACTGAGG - Intergenic
1189757486 X:44285653-44285675 TTATAATAATGGGCAAAATGAGG - Intronic
1192201409 X:69068861-69068883 ATAAAACCCTGGGGAAACTGAGG - Intergenic
1192221609 X:69201025-69201047 TTTCTATCCTAGGCATACTGTGG + Intergenic
1193401652 X:81052932-81052954 TTTTAATCCTTGGCAAACTGTGG - Intergenic
1200211120 X:154346945-154346967 TCAGAATCCTGGGCACACAGTGG + Intergenic
1200219732 X:154385147-154385169 TCAGAATCCTGGGCACACAGTGG - Intergenic
1202190316 Y:22235804-22235826 TGACAAGCCTGGCCAAAATGAGG + Intergenic