ID: 1090251599

View in Genome Browser
Species Human (GRCh38)
Location 11:125255566-125255588
Sequence CTAACACAGAAATTCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090251599_1090251607 -7 Left 1090251599 11:125255566-125255588 CCCTCAAGGAATTTCTGTGTTAG 0: 1
1: 1
2: 0
3: 22
4: 247
Right 1090251607 11:125255582-125255604 GTGTTAGTGGGGAAGGGGATTGG 0: 1
1: 0
2: 0
3: 35
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090251599 Original CRISPR CTAACACAGAAATTCCTTGA GGG (reversed) Intronic
900495631 1:2974785-2974807 CTCACACAGAGACTCCTGGATGG + Intergenic
900499338 1:2992992-2993014 TTGACACAGCAATTCCATGATGG + Intergenic
901397002 1:8988831-8988853 CTTACACAGAAATTCCCTGCAGG + Intergenic
905704605 1:40045418-40045440 CCCACCCAGAAATTCCTTGAAGG - Intronic
906173645 1:43749693-43749715 CTAACACAAGAATTTCTGGAAGG - Intronic
907264627 1:53249937-53249959 CTAACCCATAAGATCCTTGAGGG - Intronic
908018371 1:59871920-59871942 CTCACACATAATTTCCTTCAGGG - Intronic
908798172 1:67852215-67852237 CTAAAACAGAAAATGCATGAGGG - Intergenic
910109663 1:83669121-83669143 CTAAATCAGAAACTCTTTGAGGG + Intergenic
910818505 1:91318965-91318987 CAAACACATACCTTCCTTGAAGG + Intronic
910863963 1:91770487-91770509 CTAAAACAGAAATCTCTTCATGG + Intronic
911120731 1:94293771-94293793 TGAACACGGAAATTCCTGGAGGG - Intergenic
912576870 1:110680059-110680081 CTAAAAAATAAACTCCTTGAAGG + Intergenic
912687911 1:111781378-111781400 CTAAAATGTAAATTCCTTGAGGG + Intronic
914267162 1:146048103-146048125 CTAACCCAGAAATTCCCTTCTGG + Intergenic
914958400 1:152185020-152185042 CTAAATCATAAGTTCCTTGAGGG - Intergenic
916095598 1:161347173-161347195 CCAACAGAGAAATTCCTTTATGG + Intronic
916955497 1:169829067-169829089 CTGTCAAAGAAATTCCTTAAAGG - Intronic
917713512 1:177710982-177711004 CTCAGACAGAGATTTCTTGAAGG + Intergenic
917904776 1:179577663-179577685 ATAAGAGAGAAATTCCTTGTAGG + Intergenic
918340069 1:183560981-183561003 CTAAATCAGAAACTCCCTGAAGG + Intronic
921371273 1:214425125-214425147 CTAGCCCAGAAGTACCTTGAAGG + Intronic
921605208 1:217144140-217144162 ATAACAAAGAAAGTCTTTGAGGG - Intergenic
922315439 1:224437522-224437544 CTAATGTATAAATTCCTTGAGGG + Intronic
923339693 1:232996752-232996774 CTTGCAGAGAAATTCCTTGTGGG + Intronic
924905193 1:248444683-248444705 CTAGCAAGGAAATTCCTTGCTGG + Intergenic
1063962934 10:11322082-11322104 CTTACACAGAAACTACTTGTTGG + Intronic
1066497915 10:35960206-35960228 CTAAATCAGAAGTTTCTTGAAGG - Intergenic
1069054366 10:63829489-63829511 CAGCCACAGACATTCCTTGATGG - Intergenic
1070466820 10:76732369-76732391 CTAAAACTGAGTTTCCTTGATGG + Intergenic
1070777479 10:79118306-79118328 GGACCACAGAGATTCCTTGATGG - Intronic
1071087418 10:81878772-81878794 CTAACCCACAAATTCTTTAATGG + Intronic
1071218077 10:83430912-83430934 CTCACAAGGAAATTCCTTGTAGG - Intergenic
1071381598 10:85068812-85068834 CTAACTATGAAAGTCCTTGATGG - Intergenic
1071481400 10:86067686-86067708 CTCACACAGAAAGGCCTGGAAGG + Intronic
1074317719 10:112374579-112374601 CTGAGACAGAAATTTCTTAATGG - Intronic
1075800553 10:125151194-125151216 CGAACACAGAAATTCCTCCATGG + Intronic
1079307692 11:19338251-19338273 CTAGGATACAAATTCCTTGATGG + Intergenic
1080616107 11:33946345-33946367 TTAAAACAGAAATTTCTGGAAGG - Intergenic
1081394006 11:42563683-42563705 TTAACTCAGAAATTCCTCCAAGG + Intergenic
1083083922 11:60123082-60123104 TTCACAAAGAAATTCCTTGTGGG - Intergenic
1085174084 11:74471542-74471564 CTAGAACATAAATTCATTGAGGG + Intergenic
1085538498 11:77243584-77243606 CACACACAGAAATTCCGAGATGG + Intronic
1086256756 11:84886067-84886089 CAAACACAAAAATCCCTTAAAGG + Intronic
1086456274 11:86961747-86961769 CTAACACATAAAATCCGTGATGG + Intergenic
1086974557 11:93117141-93117163 CTTACAAGGAAATTCCTTGTGGG + Intergenic
1089043953 11:115482341-115482363 CTAAAATATAAGTTCCTTGATGG + Intronic
1090184456 11:124727392-124727414 CTAACACAGAGACACCCTGAGGG + Intergenic
1090216898 11:124975585-124975607 CTAGCACAGAAGCTCCTTGAGGG - Intronic
1090251599 11:125255566-125255588 CTAACACAGAAATTCCTTGAGGG - Intronic
1093567202 12:20621680-20621702 CTACCACAGATGATCCTTGATGG - Intronic
1094001517 12:25700140-25700162 TTAACACAGAAAGACCATGATGG - Intergenic
1096064625 12:48729786-48729808 GTAAAACAGAACTTCTTTGATGG - Intergenic
1096427176 12:51513850-51513872 CCAAGCCAGAAATTTCTTGAAGG - Exonic
1098198254 12:68025371-68025393 CTAGAACATAAATTCCATGAAGG - Intergenic
1099050188 12:77772715-77772737 TTTAAAAAGAAATTCCTTGATGG + Intergenic
1099273481 12:80545187-80545209 TTAATATAAAAATTCCTTGATGG + Intronic
1100737217 12:97549701-97549723 CTAAGACAGAAAAACCTTCAGGG - Intergenic
1101280665 12:103251908-103251930 TTAAGACAGAAATTACTTGGGGG + Intronic
1105322184 13:19337343-19337365 CAAGAACAGAAATTCCTTCAAGG + Intergenic
1106721079 13:32435152-32435174 CTACAACATAAATTCCATGAGGG + Intronic
1110291141 13:73807858-73807880 GTAAAACAGAAATTCCTCCAGGG + Intronic
1110820367 13:79908441-79908463 CTAACTGTGAAAATCCTTGAGGG + Intergenic
1110925297 13:81143208-81143230 ATAACACAGATATTGCTTGCAGG + Intergenic
1111044865 13:82801756-82801778 CTAACCCAGAAACTCCATAAAGG + Intergenic
1111518022 13:89361191-89361213 CCAACACTGAAATACCTTTATGG - Intergenic
1113371164 13:109726797-109726819 TCAACACAGAAATTCCTTTGAGG + Intergenic
1116047677 14:39764390-39764412 CTAAAACAAAAATTCCTTCCTGG - Intergenic
1116086294 14:40242748-40242770 CCCACAAAGAAATTCCTTGTGGG + Intergenic
1116155916 14:41205613-41205635 CTACCACAGAAATTGCAGGATGG + Intergenic
1116763578 14:49044092-49044114 CTAACATGGAAAATCCTTGAGGG + Intergenic
1116861644 14:50000384-50000406 GAAACACAGAAATGCCTTGGGGG + Intronic
1116981240 14:51173320-51173342 ATAACACAAATATTCATTGATGG - Intergenic
1117555441 14:56878654-56878676 CTAAAATATAAATTCCTTAAGGG + Intergenic
1117694214 14:58342278-58342300 CTTACAAACAAATGCCTTGAGGG - Intronic
1117694861 14:58350181-58350203 CTAACACACAAGTTCCAAGATGG - Intronic
1120900162 14:89568659-89568681 ATTATACAGAAATTCCTTGCTGG + Intronic
1121734711 14:96210192-96210214 CTCACAGTGAAATTCCTTGTGGG - Intronic
1122001419 14:98658733-98658755 CTAACAATGAAAGTCCTAGATGG - Intergenic
1124647415 15:31448299-31448321 AAAAGACAGAAAGTCCTTGAAGG + Intergenic
1124866463 15:33496922-33496944 GTAAAAAAAAAATTCCTTGAAGG + Intronic
1124989673 15:34659272-34659294 CTAAAAAAGAAAGTTCTTGAGGG + Intergenic
1125060643 15:35418445-35418467 GTCATACAGACATTCCTTGATGG + Intronic
1125826045 15:42677350-42677372 CTACAACAGAAATTGCGTGAAGG + Intronic
1126391750 15:48163615-48163637 CTAACTCTGAAAGTCCTAGATGG - Intronic
1126901529 15:53319510-53319532 CTACCCCAGAAATTCCTTCTTGG - Intergenic
1127897613 15:63316231-63316253 CTTACAAGGAAATTCCTTGTAGG - Intergenic
1129047704 15:72751554-72751576 GTAAAAAACAAATTCCTTGAAGG + Exonic
1129488720 15:75903352-75903374 CTAATTCACAAATTCCTTGCAGG - Intergenic
1129960447 15:79680057-79680079 CTGGAACAGAAATTCTTTGAGGG - Intergenic
1131365183 15:91833086-91833108 CTAAGACAGAAATACTGTGAAGG + Intergenic
1134591804 16:15460749-15460771 CCAGCCCACAAATTCCTTGAGGG - Intronic
1135193016 16:20370255-20370277 CTAGAACATAAACTCCTTGAGGG - Intronic
1135899299 16:26442053-26442075 CTAACACATGAAATCCTTAAGGG + Intergenic
1138218167 16:55223961-55223983 CTAACCCAGTAATTCCCTGAGGG - Intergenic
1138241436 16:55430582-55430604 CTAAAACAGAAACTCCATGAGGG - Intronic
1139416691 16:66817353-66817375 CTTACAAAGGATTTCCTTGATGG - Intronic
1141643741 16:85356489-85356511 CTAACACAGATATTTCTTCTAGG - Intergenic
1142224050 16:88869010-88869032 CTTACAGGGAAATTCCTTGTGGG - Intergenic
1146386233 17:32377038-32377060 CTAACAGTGAAATTCATTGATGG + Exonic
1149588102 17:57807115-57807137 ATAATTCAGAAATTCCTTGCCGG - Intergenic
1150269467 17:63853945-63853967 CTATACTAGAAATTCCTTGAGGG - Intergenic
1150816925 17:68399721-68399743 CAGTCACAGAAATTCCATGAGGG - Intronic
1151026102 17:70678733-70678755 TTGACACAGAAAATCCCTGAAGG - Intergenic
1153722919 18:7925135-7925157 CTAAAAGAGAAATTCATTTAGGG + Intronic
1154963312 18:21331377-21331399 ATGACAAAGAAATTCCTTAAAGG - Intronic
1155854326 18:30813860-30813882 CCAACACTGAAATTACTTTAAGG + Intergenic
1157034005 18:43949347-43949369 TTAACACAAAAATTCTGTGAGGG - Intergenic
1157788500 18:50508141-50508163 ATAGCACAGAAACTCCTTAAAGG - Intergenic
1158655087 18:59323592-59323614 CTACCACAGAACTTCCATGTTGG + Intergenic
1159421410 18:68225385-68225407 CTAAAACTGAAATTTCTGGAGGG - Intergenic
1159681889 18:71364228-71364250 GTTTCACAGAAATTCCCTGATGG + Intergenic
1164262593 19:23581030-23581052 CTAGAATAAAAATTCCTTGATGG - Intronic
1166177778 19:41087098-41087120 CTAAGGAAGAATTTCCTTGAGGG + Intergenic
925104229 2:1276266-1276288 CCAGCTCAGAAATTCCTAGATGG - Intronic
925317964 2:2939774-2939796 TTAACACAGCACCTCCTTGAGGG + Intergenic
928145220 2:28768141-28768163 CCAACACAGAAAATTGTTGAGGG + Intronic
928964597 2:36964827-36964849 CTAAAACATAAACTCCATGAGGG + Intronic
929645089 2:43618228-43618250 CTAAACCATAACTTCCTTGAAGG + Intergenic
929784570 2:44980009-44980031 ATAACTCAGAACTTCCTTCAAGG - Intergenic
930242225 2:48947827-48947849 CTAATCCAGAAATTCCATAATGG + Intergenic
930324424 2:49897411-49897433 CCAACACGGAAATTTCTTGATGG + Intergenic
930796952 2:55403651-55403673 CTAGCACAGAGATTCCTTCAAGG - Intronic
930823951 2:55676945-55676967 GTATCACAGAAGTTCCATGATGG + Intronic
931027726 2:58132084-58132106 CTAACACATAAAATCCATTAAGG + Intronic
932691990 2:73921196-73921218 CTCACACAGAAATCCCCTAAGGG - Intergenic
933487372 2:82939535-82939557 TTAACTCAGAAAGTCCTAGATGG + Intergenic
935654213 2:105408031-105408053 CTCCCACAGAAATTCCATAAAGG + Intronic
936709964 2:115121006-115121028 CTAACTGAGCAATCCCTTGAGGG - Intronic
940810448 2:158237004-158237026 CTTAGAAAGAAAGTCCTTGATGG - Intronic
941549827 2:166901200-166901222 GTAACTCAGAAAGTCCTAGAGGG - Intronic
942207000 2:173629170-173629192 ATAGGACAGAAATTCCCTGAAGG + Intergenic
948354005 2:237362658-237362680 CGAACTCAGAGATTCTTTGATGG - Intronic
948878150 2:240841111-240841133 ATAACACAGAATTTCCTCAAGGG + Intergenic
1173079564 20:39852732-39852754 GCAACACAGAAGTTCCTTGAAGG + Intergenic
1174934316 20:54851313-54851335 TTAACACAGAAATTAGGTGATGG + Intergenic
1177584235 21:23069385-23069407 CTGAAACAGAAATTCCAAGAGGG + Intergenic
1177824538 21:26067720-26067742 CTAATACAGAAATTAATTTAAGG + Intronic
1178179926 21:30147958-30147980 CTACCACAGAAAATCTGTGAAGG - Intergenic
1179586960 21:42379537-42379559 CTAACAAAGAAAGTGATTGATGG + Intronic
1179672140 21:42956960-42956982 CCCACAAGGAAATTCCTTGAGGG + Intergenic
1183173731 22:36206564-36206586 CTCACAAAGAAAATCCTTGTAGG - Intergenic
1183553845 22:38509616-38509638 CCCACAAAGAAATTCCTTGTGGG - Intergenic
1183962109 22:41417739-41417761 CTCACACAGAAAGTGCTTAATGG - Intergenic
949603473 3:5628536-5628558 CTAAACATGAAATTCCTTGATGG + Intergenic
949639957 3:6025155-6025177 CTAAAACAGAAAATTCTTAAAGG + Intergenic
950272235 3:11626918-11626940 CTAAAATATGAATTCCTTGAGGG - Intronic
950817924 3:15726749-15726771 CTAGCAACGAAAGTCCTTGATGG - Intronic
951476280 3:23109776-23109798 CTAATACAGTAACTCTTTGAGGG - Intergenic
951682304 3:25307480-25307502 CCAACACACAAATTCCTCAATGG + Intronic
951849564 3:27123995-27124017 ACAACACAGAAAATCCTTCAAGG - Intronic
952083712 3:29792927-29792949 CTATAATTGAAATTCCTTGAAGG + Intronic
952520505 3:34152340-34152362 CTGACAGAGAAATTCCTGAAAGG + Intergenic
952556419 3:34536275-34536297 CTATTATAGAAATTCATTGATGG + Intergenic
952719324 3:36515825-36515847 CTCACAAGGAAATTCCTTGTGGG - Intronic
953655793 3:44853360-44853382 AATACACAGAAGTTCCTTGAGGG - Intronic
953781636 3:45876635-45876657 CTCTCACAGCAATCCCTTGAAGG + Intronic
954394969 3:50288604-50288626 CGAACCCAGCACTTCCTTGAAGG + Exonic
954589090 3:51764535-51764557 CTAACACAGAATTCCATGGAAGG - Intergenic
955393341 3:58536915-58536937 CTAACACAGAAACTGCAAGAGGG + Intronic
961796282 3:129411319-129411341 CAAGCACAGAGATTCCCTGAAGG - Exonic
963421275 3:145063894-145063916 CTAAAACTCAAATTCCTTAAAGG - Intergenic
963967880 3:151393561-151393583 CTCACAAGGAAATTCCTTGTGGG - Intronic
964723871 3:159794519-159794541 CTAACACACAAAATTCTTGCTGG - Intronic
965279545 3:166731260-166731282 CTAACTGAAAAATTGCTTGATGG + Intergenic
965759505 3:172060652-172060674 CTAAAATCTAAATTCCTTGAAGG + Intronic
965862406 3:173162534-173162556 CTATCACAGGAATACCTTCAGGG + Intergenic
965975223 3:174613038-174613060 CTTATACAGATATACCTTGATGG + Intronic
967224467 3:187277496-187277518 GTAAAACAGAAGGTCCTTGAGGG - Intronic
967309152 3:188089660-188089682 GTAAAAGAGAAATTGCTTGAGGG - Intergenic
969280061 4:6164131-6164153 TTAACTCAGAAAGTCCTAGATGG - Intronic
970683906 4:18543497-18543519 TTTACACAGAAATGCCCTGAAGG + Intergenic
970790988 4:19857405-19857427 CTAACGCAGATGTTCCTTGATGG + Intergenic
971237400 4:24855066-24855088 CTAAAACATAAGTTCCATGAAGG + Intronic
971513856 4:27462586-27462608 CTAACACAGCAATTCCTACCTGG - Intergenic
974791775 4:66700270-66700292 CCAACTAAAAAATTCCTTGATGG + Intergenic
975112877 4:70646634-70646656 CTAACGCTGAAATTCTATGATGG - Exonic
976256025 4:83101631-83101653 CTAACTTTGAATTTCCTTGATGG - Intronic
977912482 4:102553994-102554016 CCAACTCAGAAATTCTGTGATGG + Intronic
979198068 4:117943494-117943516 CTAACAATGAAAGTCCTAGATGG - Intergenic
979665094 4:123302676-123302698 CTAGCACAGAAATTCCATAAAGG - Intronic
980063964 4:128161840-128161862 CTAACATATAAATTCCTTAATGG + Intronic
981424908 4:144591857-144591879 CTAATACTGTAATTCCTTCAAGG + Intergenic
981653554 4:147086653-147086675 CTAACACAGAAGTTCCTGAGTGG + Intergenic
983208770 4:164937749-164937771 CTAGAACAGCAATTCCCTGAAGG + Intergenic
983210152 4:164949943-164949965 CTAAAACAGCAATTCCCTGAAGG - Intergenic
983787827 4:171756825-171756847 CTAACACAGAAATTATTTTCTGG + Intergenic
983804805 4:171981469-171981491 CCAACAGAGAAATTCCTTGTGGG - Intronic
984377030 4:178945129-178945151 CTAAAAAGGAAATTCCTTGTGGG - Intergenic
985263135 4:188133420-188133442 CTAAAATATAAATTCCATGATGG + Intergenic
988247593 5:28707262-28707284 CTCACAAAGAAATTCCCTGTGGG - Intergenic
989015937 5:36934363-36934385 CTAATACAGAAATTCATTAAAGG + Intronic
990469524 5:56101964-56101986 CAAACACAAAAATTCCTAAAGGG + Intronic
990843931 5:60115359-60115381 CTGACACAGAAACACCTTCAGGG + Intronic
993289000 5:86040489-86040511 CATACAGAGAGATTCCTTGAGGG + Intergenic
994008374 5:94869400-94869422 CTAAAATTGAAATTCCTTGCTGG + Intronic
996399297 5:123043762-123043784 CTACCTTTGAAATTCCTTGAGGG - Intergenic
996913406 5:128680996-128681018 CTATATCAGGAATTCCTTGATGG + Intronic
998942079 5:147295370-147295392 TTAACAAAGAAATAACTTGATGG - Intronic
1000683811 5:164221810-164221832 GTAACAAACAAATTTCTTGAAGG + Intergenic
1001645395 5:173277961-173277983 CTAACACAGAAGTTCCTTGAGGG - Intergenic
1003744369 6:8983138-8983160 CTACCACAGCTATTCCTTGGGGG - Intergenic
1003887183 6:10532367-10532389 ATAACACAGAAATGACTTCAGGG - Intronic
1004303497 6:14479232-14479254 CAAAAGCAGAAATTCCCTGAGGG + Intergenic
1005199236 6:23324453-23324475 AAACCACAGCAATTCCTTGATGG + Intergenic
1008132526 6:47735022-47735044 CTTACAATGAAATTCCTTGTGGG + Intergenic
1008904814 6:56664880-56664902 AACACACAGAAATTCCTAGAAGG + Intronic
1010083386 6:71888039-71888061 ATCAGACAGAAATCCCTTGAAGG - Intronic
1010324556 6:74549971-74549993 CTACCACAGATATTCCCTTAAGG + Intergenic
1012445673 6:99304829-99304851 ATAACACAGCACTCCCTTGATGG + Intronic
1013127723 6:107201110-107201132 CATACACAGCAATTCCCTGAGGG + Intronic
1013381940 6:109581819-109581841 CTAACTCTGAAAGTCCTAGATGG - Intronic
1014977346 6:127904018-127904040 CTAACCCATAAAAGCCTTGAGGG - Intronic
1018409441 6:163528089-163528111 CTTACTCAGAAATTCATTTATGG + Intronic
1022418277 7:30196991-30197013 CTAACCCAACAATTTCTTGAGGG - Intergenic
1024188604 7:46981741-46981763 CTAACCCTGTAAATCCTTGAAGG + Intergenic
1024657082 7:51459948-51459970 TTAACATAGGAAGTCCTTGAGGG + Intergenic
1024933307 7:54687296-54687318 CTCACAAGGAAATTCCTTGTGGG + Intergenic
1027262677 7:76476484-76476506 CCAAAACAGAAACTCCCTGAGGG - Intronic
1027314053 7:76974583-76974605 CCAAAACAGAAACTCCCTGAGGG - Intergenic
1027339802 7:77193990-77194012 GTAACACAGAAATTCCATTTTGG - Exonic
1028661187 7:93277498-93277520 TTGACAAAGAAATTCATTGAAGG - Intronic
1028705312 7:93837604-93837626 ATATCACAGAAATTCCTCAAAGG + Intronic
1028705314 7:93837630-93837652 ATATCACAGAAATTCCTCAAAGG + Intronic
1029873150 7:103716728-103716750 CTAACTTAAATATTCCTTGAGGG - Intronic
1031165164 7:118219035-118219057 TTAGCACAAAAATTCCTTAATGG - Intronic
1032060652 7:128722274-128722296 CTACAACAGAAACTCCATGAAGG + Intronic
1033594899 7:142851687-142851709 ATAACACAGAAATACGATGAAGG - Intergenic
1035485224 7:159218211-159218233 CTCACAAGGAAATTCCTTGTAGG - Intergenic
1037138416 8:15491304-15491326 CTCACAGGGAAATTCCTTGTGGG - Intronic
1037236100 8:16720956-16720978 CTAAACCATAAATTCTTTGAGGG - Intergenic
1039085108 8:33771962-33771984 CTAACACAGAAAGACCTTTGTGG - Intergenic
1039241147 8:35558157-35558179 CCAACCCAGAAGCTCCTTGAGGG + Intronic
1042941341 8:74112040-74112062 CTAAAACATGAGTTCCTTGAGGG - Intergenic
1044826371 8:96201692-96201714 CTAACACAGAACTCACTAGAAGG - Intergenic
1045554646 8:103203946-103203968 ATAACCCAGAAATTCCTGTAGGG - Intronic
1045557364 8:103227413-103227435 CTTACAAAGAAATTCCTTGTGGG + Intronic
1045589987 8:103582621-103582643 CTAACACAGATGTTCCTTTAAGG - Intronic
1047108344 8:121760141-121760163 CTTACCCAGAAATTCCTTTGTGG + Intergenic
1047657969 8:126999437-126999459 CTAAGAGAGAAATTCCTTCTAGG + Intergenic
1047919319 8:129617565-129617587 CTAACACAGATATTACTGGAGGG - Intergenic
1048277615 8:133078871-133078893 CTAGATCAGAAACTCCTTGAGGG - Intronic
1048600405 8:135913719-135913741 CAAACACAAAAATTCCCTGGGGG + Intergenic
1048754496 8:137721980-137722002 CTAAGACAAAAATTCATTAAAGG + Intergenic
1051737992 9:20222455-20222477 CTAAAACAGAAATTACCAGATGG - Intergenic
1053104980 9:35401468-35401490 TTAACTCAGATCTTCCTTGATGG - Intronic
1053460147 9:38262420-38262442 CTTACACAGAAAGTCCATGGTGG + Intergenic
1054748733 9:68882695-68882717 CTGACACAGAACTTCCTTATGGG - Intronic
1056259848 9:84837000-84837022 CTATAACAGAAATTCAATGAGGG + Intronic
1060707912 9:125823591-125823613 CTAACACAGAAATTTCATTGAGG - Intronic
1186143104 X:6597892-6597914 CTAATACAGAAGTACCCTGATGG - Intergenic
1186918963 X:14256445-14256467 ATAAAACTGAAGTTCCTTGAAGG + Intergenic
1187169480 X:16837059-16837081 CTTAAATAAAAATTCCTTGAGGG + Intronic
1188116572 X:26251299-26251321 CTACCACTGATATTCCTTTAAGG - Intergenic
1188535292 X:31190408-31190430 CTAACAGAGGAATTTCTTGTGGG + Intronic
1188979650 X:36715489-36715511 CTTACAAGGAAATTCCTTGCAGG + Intergenic
1189208296 X:39260856-39260878 CTGAACCAGAAATTCCTTAATGG - Intergenic
1189686877 X:43573631-43573653 CCTAAACATAAATTCCTTGATGG - Intergenic
1190951785 X:55152763-55152785 CCCACAAAGAAATTCCTTGTGGG + Intronic
1191024172 X:55895888-55895910 ATAACCCAAATATTCCTTGATGG - Intergenic
1191871895 X:65753068-65753090 CTAACCGAGCAATCCCTTGATGG + Intergenic
1192295477 X:69843065-69843087 CTAACCCATAAGCTCCTTGAAGG - Intronic
1193983777 X:88215695-88215717 CTAAAACAGAAAATACTAGATGG + Intergenic
1195723795 X:107892401-107892423 GTAACCAAGAAATTCCTTCATGG - Intronic
1196295699 X:113994301-113994323 CTCACAAGGAAATTCCTTGTAGG + Intergenic
1197536420 X:127693890-127693912 CTAAGATAAAAATTCCTTGGAGG - Intergenic
1197551907 X:127901779-127901801 CTAACAAAGCAATCTCTTGAGGG + Intergenic
1197695857 X:129549142-129549164 CTAATAAAGAGATGCCTTGAGGG - Intronic
1198620326 X:138501099-138501121 CTATCAGCAAAATTCCTTGAGGG - Intergenic
1200475488 Y:3635794-3635816 CTAACCAAGTAATTGCTTGAGGG + Intergenic
1200507588 Y:4032719-4032741 CAAACAAAAAAATTCCTGGAGGG - Intergenic