ID: 1090253235

View in Genome Browser
Species Human (GRCh38)
Location 11:125265389-125265411
Sequence CAAACCTCCCTGGCAAACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090253233_1090253235 -10 Left 1090253233 11:125265376-125265398 CCGATTCAATGAACAAACCTCCC 0: 1
1: 0
2: 0
3: 4
4: 132
Right 1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG 0: 1
1: 0
2: 1
3: 16
4: 203
1090253231_1090253235 22 Left 1090253231 11:125265344-125265366 CCTAAACATGTATGACCAAGGCA 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG 0: 1
1: 0
2: 1
3: 16
4: 203
1090253232_1090253235 7 Left 1090253232 11:125265359-125265381 CCAAGGCAAGCTGATTTCCGATT 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG 0: 1
1: 0
2: 1
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090253235 Original CRISPR CAAACCTCCCTGGCAAACAC CGG Intronic
901271488 1:7955229-7955251 CAGACCACCCTGGCCAACATGGG - Intronic
903209934 1:21812234-21812256 CAAATCTCCATGGCAACCCCTGG + Intergenic
904414876 1:30354252-30354274 GAGACCACCCTGGGAAACACAGG - Intergenic
906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG + Intronic
906806967 1:48788405-48788427 CATCCCTTCCTGGCAAACAAAGG + Intronic
907291103 1:53413572-53413594 TACAGCTCCCTGGCAAAAACAGG + Intergenic
907359364 1:53902420-53902442 CAAGTCTCCCTGCCACACACTGG - Intronic
908441106 1:64155661-64155683 CTCACCTGCCTGGCAAACAAAGG - Intronic
910752528 1:90649257-90649279 TAAAGCTCCCTTGCAAACTCAGG + Intergenic
911734608 1:101323382-101323404 CAAATCTCACTGGCAAGCAGGGG - Intergenic
913321357 1:117590905-117590927 CCAACCTCCCTTCCAAATACTGG - Intergenic
917195515 1:172460882-172460904 CAAAGCTGCCTGCCAAAGACAGG - Intronic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
917792589 1:178508785-178508807 CAAACCTCCCTCCCCACCACAGG - Intergenic
917929216 1:179812402-179812424 CAAACCCTCCTGGAAAACAAAGG - Intronic
918298148 1:183177207-183177229 GAGACCACCCTGGCTAACACGGG + Intergenic
918441847 1:184575850-184575872 CAAGCATCCCAGGGAAACACTGG - Intronic
919105676 1:193147567-193147589 GAGACCACCCTGGCTAACACAGG - Intronic
921371956 1:214433102-214433124 AAGACCATCCTGGCAAACACTGG - Intronic
923792732 1:237126273-237126295 CACACCTCCATGGCCACCACAGG - Intronic
1069174140 10:65269415-65269437 CAGACCATCCTGGCTAACACGGG - Intergenic
1069207810 10:65714786-65714808 GAGACCACCCTGGCTAACACAGG + Intergenic
1069926792 10:71856065-71856087 CCAACCTCCCTTGCAGCCACGGG + Intergenic
1070500197 10:77065496-77065518 ACAACTTCCCTGGCAAATACAGG - Intronic
1070846637 10:79527733-79527755 GAACCCTTCCTGGCTAACACGGG + Intergenic
1070927158 10:80232535-80232557 GAACCCTTCCTGGCTAACACAGG - Intergenic
1074460832 10:113635625-113635647 CAGACCAGCCTGGCCAACACGGG - Intronic
1074472040 10:113735998-113736020 CAAACCTGCCTGGCCAACAAGGG - Intergenic
1075374979 10:121971758-121971780 CAAACCACCATGCCAAGCACAGG - Intronic
1075512720 10:123085205-123085227 GACACCTCCCAGGCACACACTGG - Intergenic
1076008801 10:126969777-126969799 CAAACTCCTCTGGCAAGCACGGG - Intronic
1077150047 11:1068833-1068855 CACAAATCCCTGGCAAGCACTGG - Intergenic
1077976647 11:7253705-7253727 TAAACCTCCCTGGAAACCACTGG - Intronic
1078448094 11:11420148-11420170 CAAACCTCCCTCACCAAAACTGG + Intronic
1078492210 11:11780072-11780094 CCCAGGTCCCTGGCAAACACTGG - Intergenic
1078671379 11:13368674-13368696 CACACCTCCTTACCAAACACTGG - Intronic
1080780402 11:35423887-35423909 CCAACCTCCCTGAGAAACAGAGG + Intergenic
1081487538 11:43543428-43543450 CAAACCACCCCCACAAACACAGG + Intergenic
1082730263 11:56787699-56787721 CAAACTTCCCTGGAACACATTGG - Intergenic
1083153713 11:60809842-60809864 CACACCTCCCACGCATACACAGG - Intergenic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083732955 11:64662949-64662971 CAAAGCTCCCTGCCAAATTCAGG - Intronic
1085088391 11:73688929-73688951 CAGACCACCCTGGGCAACACAGG + Intronic
1085192869 11:74644055-74644077 CTCACCTCCCTGGAAAAAACTGG + Intronic
1085392739 11:76190690-76190712 CAAACACCTCTGGGAAACACTGG + Intronic
1085606794 11:77907822-77907844 AAAACCCCCAAGGCAAACACAGG + Intronic
1085919292 11:80932513-80932535 CAGACCAGCCTGGGAAACACAGG + Intergenic
1087116310 11:94528741-94528763 CAAATGTTCCTGGCAGACACTGG - Intergenic
1088286748 11:108198048-108198070 CAGACCCCCTTGGCAAACAATGG + Intronic
1089650709 11:119910944-119910966 CATCCCTCCCTGGCAAAGCCAGG - Intergenic
1089901651 11:121992750-121992772 CCAACCTCTCTGAAAAACACAGG - Intergenic
1090253235 11:125265389-125265411 CAAACCTCCCTGGCAAACACCGG + Intronic
1092195502 12:6547514-6547536 AAGACCTGCCTGGGAAACACAGG + Intronic
1092984909 12:13836202-13836224 CAAACCTGCCTGCCATACTCAGG + Intronic
1097320636 12:58222366-58222388 CAAACATCCCAGGCAAAGGCTGG - Intergenic
1100447327 12:94673490-94673512 CTAAACTCGCTGCCAAACACAGG + Intergenic
1101973791 12:109337190-109337212 AAAACCTCTCTGGAAATCACAGG - Intergenic
1102002838 12:109568477-109568499 CTAACCTCAGTGGCACACACAGG + Intronic
1102171079 12:110842935-110842957 CAAAATTCCCTGGGAAACAAAGG - Intergenic
1102302782 12:111783115-111783137 CAAGCCTTCCTGGAAAACTCAGG - Intronic
1102390919 12:112547988-112548010 AAAACCAACCTGGCCAACACAGG - Intergenic
1103802000 12:123544239-123544261 AAGACCACCCTGGGAAACACAGG - Intergenic
1106752396 13:32788475-32788497 GAGACCTGCCTGGGAAACACAGG - Intergenic
1110680306 13:78302970-78302992 CAAACCTCCAAGGCAGGCACTGG - Intergenic
1115397017 14:32919840-32919862 CACACCTCCCTGGCGGCCACAGG - Intergenic
1118158227 14:63262619-63262641 CAAATCTGCCTGGCAGACAGTGG - Intronic
1121717627 14:96087573-96087595 CAAACCTGCCTGGTGACCACAGG - Exonic
1123739542 15:23223195-23223217 CAGACCATCCTGGCTAACACGGG - Intergenic
1124290763 15:28452167-28452189 CAGACCATCCTGGCTAACACGGG - Intergenic
1124292473 15:28465391-28465413 CAGACCATCCTGGCTAACACGGG + Intergenic
1127279547 15:57477378-57477400 CAAACTTCGTTGGAAAACACTGG + Intronic
1128050419 15:64659263-64659285 CAAAACTCGCTGGCAAACTGTGG + Intronic
1128338423 15:66803166-66803188 CAGACTTCCATGGCAAACTCAGG - Intergenic
1129851452 15:78796287-78796309 CAAGCCCCCCAGGCAAGCACAGG + Intronic
1136996440 16:35193977-35193999 CAAACCTCCGTGGCACTCAGGGG + Intergenic
1138468619 16:57213033-57213055 CAAGCCATCCTGCCAAACACAGG + Exonic
1138824596 16:60303894-60303916 GAAACCATCCTGGCTAACACGGG + Intergenic
1139973346 16:70790192-70790214 CATCCCTGCCTGGCAGACACGGG - Intronic
1140031943 16:71345798-71345820 CAAACCTCCCTTGATAGCACTGG - Intergenic
1140828123 16:78726431-78726453 GAAACCAGCCTGGCCAACACAGG - Intronic
1140835054 16:78786107-78786129 AAAACCAGCCTGGCCAACACGGG - Intronic
1141622801 16:85246121-85246143 CAAACTCCCCAGGAAAACACGGG - Intergenic
1145414885 17:22706784-22706806 CAGACCATCCTGGCTAACACGGG + Intergenic
1148875569 17:50684908-50684930 CAACCCTCCCTGGGAAACCCTGG + Intronic
1149330080 17:55571488-55571510 CAGACCATCCTGGCTAACACGGG + Intergenic
1151666864 17:75550076-75550098 CAAAGCTGCCTGGCAGCCACTGG - Intronic
1152280770 17:79383835-79383857 GAGGCCTCCCTGGCCAACACTGG + Intronic
1158231962 18:55266553-55266575 CAAGCCTTGCTGGCAAACTCTGG - Intronic
1159724745 18:71942695-71942717 CAACCCTCACTGGGAAACACAGG + Intergenic
1160390100 18:78523587-78523609 CAATGCTCCCTGCCAAACAGTGG - Intergenic
1160691549 19:462514-462536 CATCCCTCCCTGGCACACAGAGG + Intergenic
1160967250 19:1752206-1752228 CAAACCTTCTGGGCAAACCCCGG - Intergenic
1162009717 19:7805056-7805078 CAGAGCTCCCTGGCAAAGACTGG - Intergenic
1162884499 19:13686262-13686284 CAGACCAGCCTGGCCAACACGGG + Intergenic
1163710840 19:18845805-18845827 CAAACCTACCTGGCCAAAAAAGG - Intronic
1166372857 19:42312025-42312047 CAATCCTTCCTGGCAACAACTGG + Intergenic
1166767010 19:45257581-45257603 GAAACTTGCCTGGCCAACACGGG - Intronic
1167435406 19:49475883-49475905 AAGACCACCCTGGGAAACACAGG - Intronic
1167747266 19:51359255-51359277 CAGACCAGCCTGGGAAACACGGG - Intronic
1167972560 19:53197635-53197657 GAGACCATCCTGGCAAACACGGG - Intergenic
925725098 2:6864913-6864935 CAAACCACCCAGGCAAGAACCGG + Intronic
927254522 2:21028587-21028609 AGAACATGCCTGGCAAACACTGG + Intronic
927604715 2:24476603-24476625 AAGACCACCCTGGCTAACACGGG + Intergenic
929245828 2:39702357-39702379 CAAACCCCACTGGCAAAGACTGG - Intronic
930097098 2:47573024-47573046 CAGACTTCCCAAGCAAACACAGG + Intergenic
931559620 2:63545771-63545793 CACACCTCCTTGGCAAAAAACGG + Intronic
932275254 2:70446689-70446711 GAAACCAGCCTGGAAAACACAGG + Intergenic
933697803 2:85233131-85233153 AAAACCTGCCTGGGCAACACAGG - Intronic
933762066 2:85679313-85679335 CAACCCTCACTCGCAAACACAGG + Intergenic
936604325 2:113933879-113933901 GAGACCTTCCTGGCTAACACGGG - Intronic
937373511 2:121319303-121319325 CCTCCCTCCCTGCCAAACACAGG - Intergenic
939177065 2:138760961-138760983 CAAACATCCCTGGCAAGAGCAGG + Intronic
940677365 2:156740937-156740959 CAAACCTCCCTGGCCCACTCTGG - Intergenic
941045908 2:160675765-160675787 CCAACAGCCCTGGCCAACACAGG + Intergenic
941081102 2:161061518-161061540 CAAGAGCCCCTGGCAAACACTGG - Intergenic
942073202 2:172333948-172333970 CAAAGCTGCCTGGTAAACAGGGG - Intergenic
946121028 2:217515005-217515027 TAAACATCCCCAGCAAACACAGG + Intronic
946428523 2:219612769-219612791 CCAAACTCCTTGGCAGACACAGG - Intronic
1168836357 20:880383-880405 CAGACCAGCCTGGGAAACACAGG + Intronic
1169659551 20:7963294-7963316 CATTCCTCAGTGGCAAACACTGG + Intergenic
1170647708 20:18211745-18211767 AAAACCAGCCTGGCAAACATGGG + Intergenic
1170676427 20:18485630-18485652 CCACCATCCCTGGCAAACCCAGG - Intergenic
1174753594 20:53136611-53136633 CCAATCTCCCTCCCAAACACTGG + Intronic
1175434890 20:58938204-58938226 CAAAGCTCCCTGGCAAAGACTGG - Intergenic
1176728557 21:10465876-10465898 CAAACCTCACTGGCGAGGACAGG - Intergenic
1178021751 21:28416333-28416355 CAAAACTCCATTACAAACACAGG - Intergenic
1180166237 21:46031543-46031565 CAAACCTCAGCTGCAAACACTGG + Intergenic
1180929014 22:19576382-19576404 GAGACCACCCTGGCAAACATGGG + Intergenic
1183642012 22:39098436-39098458 CAAACCAGCCTGGGCAACACAGG + Intronic
950208506 3:11098590-11098612 TAAATCTCCCTGGAGAACACTGG + Intergenic
950702713 3:14761286-14761308 CATACCTCCCTGGGCAACTCAGG + Intronic
950901696 3:16503742-16503764 CCATCCTCCCAGGCAAGCACAGG + Intronic
951259538 3:20490487-20490509 CAAACATCTCTGTCAGACACTGG - Intergenic
951879449 3:27465756-27465778 GAAACCACCCTGGCTAACACGGG + Intronic
952460340 3:33518185-33518207 CAAAACTCCTTGGTAACCACTGG - Intronic
954291316 3:49651462-49651484 CAATCCTCCCTGTCAATCCCAGG - Intronic
954331953 3:49895924-49895946 TGGACCTCCCTGGGAAACACGGG - Intronic
954938957 3:54353488-54353510 CAAAACTACCTGGAAAATACAGG - Intronic
955205566 3:56892905-56892927 CAAAGCTCCCTTTCAATCACTGG + Intronic
955776735 3:62441648-62441670 AAAACCTCACAGGGAAACACAGG + Intronic
956174906 3:66463648-66463670 TTAACCTCTTTGGCAAACACGGG - Intronic
956821392 3:72957465-72957487 CAAACTTCGCTGGGGAACACAGG - Intronic
956978100 3:74605690-74605712 CAAGCCTCCTTGAGAAACACAGG - Intergenic
957340052 3:78883990-78884012 CAAAACTACCTGGCACACTCTGG - Intronic
958158919 3:89791064-89791086 AAAACCTGCCTGGCCAACACAGG + Intergenic
959296754 3:104545117-104545139 CAAATCTCCCTGGTAGTCACTGG - Intergenic
959934674 3:112016822-112016844 CAAAGCTCCTTGGAAAACACAGG + Intergenic
961534888 3:127564323-127564345 CCAACCTCCCTTGCAAGCAGGGG + Intergenic
965824126 3:172713738-172713760 CAAACATACCTGGCCTACACTGG + Intergenic
966057707 3:175716472-175716494 CAAGCTTCCGTGTCAAACACAGG - Intronic
966836830 3:184055843-184055865 CAAACCTCCCTGGGAATCTTAGG + Intronic
1202738016 3_GL000221v1_random:26296-26318 CAGAGCTCCCTGGGAAACATAGG - Intergenic
968679942 4:1910889-1910911 CAGAGCTCCCTGGGAAACAAAGG - Intronic
968689379 4:1982825-1982847 CAAAACTCCCAGGCAGGCACAGG + Exonic
970119867 4:12741615-12741637 GAGACCACCCTGGCCAACACTGG - Intergenic
971277344 4:25210848-25210870 CAAAGCTCACTGGCCAAAACCGG - Intronic
971277589 4:25212754-25212776 CAAAGCTCACTGGCCAAAACAGG - Intronic
972420778 4:38884186-38884208 CAGACCTGCCTGGGCAACACAGG - Intronic
972555281 4:40175229-40175251 CAAACCTGCCTGGGTAACATGGG - Intergenic
973132843 4:46669987-46670009 CAGACCTTCCTGGCTAACACGGG - Intergenic
976733604 4:88288171-88288193 CAATCCAGCCTGGGAAACACAGG - Intergenic
979036375 4:115724812-115724834 TAAACCTCATTGCCAAACACAGG - Intergenic
980194494 4:129571075-129571097 CAATCCTCCGTGGTAAACACTGG - Intergenic
982048358 4:151472538-151472560 TAAACATCCTTGGCAATCACAGG - Intronic
983454043 4:167940491-167940513 CTAACCTCCCTGCCAAGAACAGG + Intergenic
991500847 5:67275360-67275382 CTACCCTCCCTGGAAACCACTGG + Intergenic
994348988 5:98722658-98722680 CAAGCCTCCCTGAGAAAGACAGG - Intergenic
995684802 5:114760709-114760731 CAAACCACCATGGCACAAACCGG - Intergenic
999177026 5:149638924-149638946 CAAACCTACCAGGCAACCAGAGG - Intergenic
1000672428 5:164078879-164078901 CCAACCTCCCAGGTAAACAAAGG - Intergenic
1004045046 6:12015038-12015060 CACACGTTCCTGGGAAACACAGG + Intronic
1004965744 6:20848990-20849012 GAGACCAGCCTGGCAAACACAGG - Intronic
1006410134 6:33868626-33868648 AAAACCAGCCTGGGAAACACAGG + Intergenic
1006874430 6:37282905-37282927 CGAACCTCCCTGGGAACCCCTGG - Exonic
1007081560 6:39108750-39108772 GGAACCACCCTGGCAAAAACGGG - Intronic
1007617944 6:43193116-43193138 CCACCCTCCCTGGCAAAGAGCGG - Exonic
1015815319 6:137205031-137205053 CAGACCTGCCTGGCACACAGTGG - Intronic
1016468417 6:144349207-144349229 CAGACCATCCTGGCTAACACGGG - Intronic
1016850733 6:148616202-148616224 CAAGGCCCCCTGGCAAAGACAGG - Intergenic
1019124795 6:169830965-169830987 GACACATCCTTGGCAAACACAGG - Intergenic
1019931580 7:4226710-4226732 CAAAACTCCCTGGAAGGCACTGG + Intronic
1022416763 7:30185078-30185100 CAAACCTTCCTGGCACCCAGAGG - Intergenic
1023533267 7:41181651-41181673 GAAACCTTTCTGGAAAACACTGG - Intergenic
1023833508 7:44054390-44054412 CAGACCAGCCTGGCCAACACAGG - Intronic
1023992639 7:45138343-45138365 CAGACCAGCCTGGCCAACACGGG - Intergenic
1024641371 7:51331567-51331589 CAGACCATCCTGGCTAACACAGG - Intergenic
1026147445 7:67759709-67759731 GAAACCAGCCTGGCCAACACGGG - Intergenic
1026159977 7:67860166-67860188 GAAACCAGCCTGGGAAACACAGG - Intergenic
1027557454 7:79683734-79683756 CACACATCCCTGGTAAACACTGG + Intergenic
1030308688 7:108046964-108046986 AAGACCTGCCTGGGAAACACAGG - Intronic
1030535535 7:110761934-110761956 CATAGCTCCCTGGTCAACACGGG + Intronic
1030662674 7:112238569-112238591 AACACCTCCCTGGCCACCACAGG - Intronic
1030923899 7:115427365-115427387 GAGACCACCCTGGCTAACACGGG - Intergenic
1031630741 7:124039914-124039936 AAAATCTCCCTGGCAGACTCAGG - Intergenic
1033755108 7:144392053-144392075 GAATCCTTCCTGGCAAACTCCGG - Intergenic
1034601536 7:152262085-152262107 CAAACCTCACTGGCGAGGACAGG + Intronic
1035259683 7:157653490-157653512 CCACCCTCCCTGGCACACACAGG - Intronic
1038085558 8:24192694-24192716 CATTCCTCCCAGGCAGACACAGG - Intergenic
1038811763 8:30853678-30853700 CAATCCTCCCTGACAGATACTGG + Intronic
1042252419 8:66770153-66770175 AAGACCATCCTGGCAAACACGGG - Intronic
1042610102 8:70589460-70589482 CACACCACACTGGGAAACACTGG - Intronic
1045735813 8:105295515-105295537 CCCACCTCACTGTCAAACACAGG + Intronic
1046361704 8:113167627-113167649 CAACACTCCCTGGAAAATACAGG - Intronic
1046724982 8:117664519-117664541 GAAACTTCCCTGGCAAAAATAGG + Intergenic
1049438897 8:142600261-142600283 CAAACCTCCCAGGGAAACGCAGG - Intergenic
1050302425 9:4273393-4273415 CAGACCAGCCTGGAAAACACAGG + Intronic
1052973005 9:34389134-34389156 AAGACCACCCTGGGAAACACAGG - Intronic
1057622756 9:96651075-96651097 GAGACCACCCTGGCAAACATGGG + Intronic
1061012912 9:127965953-127965975 CAAGCCACTCTGGCCAACACTGG + Intronic
1061908205 9:133709425-133709447 CAAACCTCCCTGTCAGCCCCCGG + Intronic
1062124258 9:134850680-134850702 CACACCTCCCAGGAAAGCACGGG + Intergenic
1062605121 9:137343787-137343809 AAGACCACCCTGGCTAACACGGG - Intronic
1203692315 Un_GL000214v1:55876-55898 CAGAGCTCCCTGGGAAACATAGG + Intergenic
1203556500 Un_KI270744v1:2768-2790 CAGAGCTCCCTGGGAAACATAGG + Intergenic
1203643980 Un_KI270751v1:48315-48337 CAGAGCTCCCTGGGAAACATAGG - Intergenic
1190211469 X:48451982-48452004 CAAATCCCCTTGGCAAAGACTGG + Intergenic
1196818342 X:119683051-119683073 GAAACCAGCCTGGCCAACACTGG + Intronic
1197898543 X:131343250-131343272 CAAACCCCCCTGGGAAACTGTGG - Intronic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1202349307 Y:23970608-23970630 AAAACCTCCCTTTCAAAAACTGG + Intergenic
1202521468 Y:25699496-25699518 AAAACCTCCCTTTCAAAAACTGG - Intergenic