ID: 1090254184

View in Genome Browser
Species Human (GRCh38)
Location 11:125271768-125271790
Sequence CTGGGCTATGAGCTGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 335}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090254184_1090254186 -10 Left 1090254184 11:125271768-125271790 CCTTGCTCCAGCTCATAGCCCAG 0: 1
1: 0
2: 5
3: 35
4: 335
Right 1090254186 11:125271781-125271803 CATAGCCCAGATGTTTTTCCTGG 0: 1
1: 0
2: 1
3: 18
4: 189
1090254184_1090254189 7 Left 1090254184 11:125271768-125271790 CCTTGCTCCAGCTCATAGCCCAG 0: 1
1: 0
2: 5
3: 35
4: 335
Right 1090254189 11:125271798-125271820 TCCTGGCTCTGCTCAGCCCATGG 0: 1
1: 0
2: 3
3: 32
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090254184 Original CRISPR CTGGGCTATGAGCTGGAGCA AGG (reversed) Intronic
900201030 1:1406681-1406703 CCGGGCGAGGGGCTGGAGCAGGG + Intronic
900525002 1:3124220-3124242 CTGGGCCCTGAGCTGGAGGCCGG + Intronic
900604107 1:3516220-3516242 CTGTGCCCTGAGCTGGCGCAGGG + Intronic
900657051 1:3763558-3763580 CTGGTCAGTGAGCTGGAGCAGGG + Intronic
900777927 1:4598762-4598784 ACTGGCCATGAGCTGGAGCAAGG + Intergenic
900806105 1:4769385-4769407 CTGGCCTGTGAGTGGGAGCAGGG - Intronic
901156780 1:7145537-7145559 CTTGGGAATGAGCTGGAGCTGGG + Intronic
901216976 1:7560408-7560430 ATGGGCTGGGAGCTGGAGCCGGG + Intronic
902101550 1:13994541-13994563 CTGGGCACTGTGCTGGAGCCTGG + Intergenic
902631167 1:17705533-17705555 CTGGGCCATGAGCTGGGGCTGGG + Intergenic
902758737 1:18566956-18566978 CTGGTCTGTGAACTGGAGCCAGG + Intergenic
903281486 1:22252508-22252530 CTGGGCTGGGGGCTGGAGGAGGG + Intergenic
903465382 1:23548829-23548851 TTGGGCTAGGAGCTGGAGCCAGG + Intergenic
903501072 1:23800481-23800503 CTGGGCTTTGGGCTGTAGCGCGG + Intronic
904400204 1:30251696-30251718 CTGGTCCATGGGCTGGAGGAAGG + Intergenic
904512209 1:31021045-31021067 CTGGGCCATCTGTTGGAGCATGG - Intronic
904597510 1:31656117-31656139 CTGGAATGTGAGCAGGAGCAAGG + Intronic
905017316 1:34786506-34786528 CTGGGGCTTGAGCTGGAGCTCGG + Intronic
905023929 1:34837079-34837101 CTGGGCTTTCATCTGCAGCAGGG + Intronic
905589961 1:39154692-39154714 CTGGGCTCTGTCCTTGAGCAGGG + Intronic
905953451 1:41972475-41972497 CTGGGCTATGAGCTCTAGGAGGG - Intronic
906535170 1:46547511-46547533 GTGGGCTGGGACCTGGAGCAAGG - Exonic
906707589 1:47906062-47906084 CTGAGGTATGACCTTGAGCAAGG - Intronic
907255243 1:53173936-53173958 CTCGGCTCTGAGCTGGAGACAGG + Intergenic
907423111 1:54360756-54360778 CCAGGCTATGACCTGGGGCATGG - Intronic
909340386 1:74525020-74525042 ATGGGCTATGAGCTGGACACTGG + Intronic
912964362 1:114224601-114224623 TTGGGCTCTGAGCAGGAGCCCGG - Intergenic
915625983 1:157114467-157114489 CTGGTCTGTGAGCTGGTCCAGGG + Intergenic
915721468 1:157988833-157988855 CTGGGCTATAGTCTGCAGCAGGG + Intergenic
917671827 1:177280620-177280642 CCGGGCTATGTGCTGGCCCAGGG + Exonic
917972526 1:180217959-180217981 ATGAGCTCTGAGCAGGAGCATGG - Intergenic
918972196 1:191433762-191433784 CTGGGCTCTGGGCTGGTGCTGGG - Intergenic
920364977 1:205443525-205443547 CTGGGCTAGGGGCTGTAGCCTGG + Intronic
920912518 1:210232479-210232501 CTGGGCTGCGGGCTGGAGCTGGG + Intergenic
922027088 1:221760251-221760273 CTGGGTTGTTAGCAGGAGCAGGG - Intergenic
922880956 1:228980293-228980315 CTGAGCTGGGAACTGGAGCAGGG + Intergenic
923567637 1:235088340-235088362 CTGGGCTTGGAGCTGGAGGCTGG + Intergenic
924121992 1:240810095-240810117 CTAGGCTAAGAGCTGGACAATGG - Intronic
924140154 1:241013621-241013643 CTGAGCTATGAAATGGAGGAGGG - Intronic
924455008 1:244212366-244212388 CTGGGCAATGGGAGGGAGCAGGG + Intergenic
1063342245 10:5277184-5277206 CTGTGCTATGAGCTGCAGCGGGG - Intergenic
1066293251 10:34033065-34033087 CTGGGCTTTGAGTGGGAGCTAGG + Intergenic
1067030631 10:42877141-42877163 CTGCCCTTTGAGCTGGGGCATGG + Intergenic
1067466065 10:46500126-46500148 CTGGATTATGAGAAGGAGCAGGG + Intergenic
1067621123 10:47884480-47884502 CTGGATTATGAGAAGGAGCAGGG - Intergenic
1067788493 10:49270443-49270465 CTGGGCTGTGAGCTGCATGATGG + Intergenic
1072610840 10:97016957-97016979 CTGTGGTACGAGCTGGGGCAGGG + Intronic
1072615104 10:97043825-97043847 CTGGGCACTGATGTGGAGCATGG - Intronic
1072921257 10:99579034-99579056 CTGTGCTCTGGGCAGGAGCAGGG + Intergenic
1073208548 10:101781170-101781192 CTGGGCTAGGACCTGGGGCCTGG - Intergenic
1073598433 10:104822950-104822972 CTGGGCTAGGACCTAGACCAAGG + Intronic
1074147460 10:110729527-110729549 CTAGGCTATGAGCCGCAGGAGGG + Intronic
1074773543 10:116749175-116749197 CTGGGCTATGGGCTGGAGAAGGG - Intergenic
1076415636 10:130286192-130286214 CTGATCTTTGAGTTGGAGCAAGG - Intergenic
1076790228 10:132773090-132773112 CTGGGCTGTGGGCCGGCGCAGGG + Intronic
1076817288 10:132921217-132921239 CTGGGCACTGAGCTGGAGGGAGG + Intronic
1077580875 11:3416503-3416525 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1078798645 11:14620411-14620433 CTGGGCTATGGGCCAGGGCATGG - Intronic
1079028205 11:16965611-16965633 CTGGGCTTTGAGCTGGAGTAGGG - Intronic
1079328548 11:19514845-19514867 CTGTGCTCTGGGCTGAAGCAGGG + Intronic
1079624856 11:22604769-22604791 CTGGGCTATAAGCTGAGGGAGGG - Intergenic
1081441957 11:43090597-43090619 CTGAGCTATGGGCTAGAACAGGG + Intergenic
1082613875 11:55335255-55335277 ATGGGGTGTGAGCTGAAGCAGGG - Intergenic
1082842151 11:57698616-57698638 CTGGGCTCTGAGCGGTAGCTGGG - Exonic
1083421561 11:62556196-62556218 CTGTGCCATGTGCTGGACCATGG + Intronic
1083962451 11:66021803-66021825 CAGGGCGATGATCTTGAGCAGGG + Exonic
1084237802 11:67799337-67799359 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1084834606 11:71793496-71793518 CTGGGCTGTGAGGGGGAGGAGGG - Intronic
1085823159 11:79814808-79814830 CTGGGCTACGTGCTGGCGCATGG - Intergenic
1088070274 11:105775097-105775119 CTGGGCTTTAAGATGGAGGAAGG - Intronic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1088664164 11:112077772-112077794 CTGGGCTATGATCAGGAACCTGG - Intronic
1089073498 11:115718592-115718614 CTGGGCTGACAGCTGGAGCCAGG + Intergenic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1089399634 11:118156963-118156985 CAGTGCTCTGAGCTGGAGGAAGG - Intergenic
1089927477 11:122273695-122273717 CTGGGTTATTAGATGCAGCAAGG - Intergenic
1090254184 11:125271768-125271790 CTGGGCTATGAGCTGGAGCAAGG - Intronic
1090434774 11:126677624-126677646 CTGTGCTAGGTGCTGAAGCAGGG + Intronic
1092143303 12:6198793-6198815 CCGGGCTCTGGGCTGGAGCCTGG - Intergenic
1092408475 12:8236934-8236956 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1092633731 12:10416452-10416474 CTTGGTTATGAGATGGACCAGGG - Intronic
1094039630 12:26109509-26109531 CTTGGCTTTGAGCAGGAGGAGGG + Intergenic
1095725466 12:45446928-45446950 CTGGGCTCTGGGCTGGGGCTGGG - Intergenic
1097012849 12:55965665-55965687 CTTGGCAGTGAGCTGGAGCACGG - Intronic
1097360784 12:58656093-58656115 CAGGGCTATCAGCTGCAGGAAGG - Intronic
1098194322 12:67983737-67983759 CTTGGCTATGAGATGGACAATGG - Intergenic
1099392365 12:82097423-82097445 CTGGGCTCTGGGCTGGTACAGGG + Intergenic
1100432755 12:94545422-94545444 GTGGACTATGAGCTGAAGCTAGG - Intergenic
1100614764 12:96222462-96222484 GTGGGCTTTGACCTGCAGCATGG + Intronic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1103902789 12:124311940-124311962 CTGGGCTCTGCGCGGGAGGAGGG + Intronic
1103922998 12:124409230-124409252 CTGGCCTCAGAGCAGGAGCAGGG - Intronic
1104600412 12:130149659-130149681 CAGGGCCAGGAGCTGGAGAATGG + Intergenic
1105751567 13:23425811-23425833 CGTGCCTATGAGCTAGAGCATGG + Intronic
1105847505 13:24306448-24306470 CTGGCCTGTGAGCTGGTGAAAGG - Exonic
1106004716 13:25757924-25757946 CTGGGCTGGAAGCTGCAGCATGG - Intronic
1110384934 13:74899050-74899072 CTGGACTATGAGCTGCAGTGAGG - Intergenic
1110832421 13:80046450-80046472 CTGGTCTAAGTGCTGGAGAAAGG - Intergenic
1114055716 14:18965749-18965771 CTGGCCTCTGAGCTGGACCAGGG - Intergenic
1114106831 14:19436015-19436037 CTGGCCTCTGAGCTGGACCAGGG + Intergenic
1114555592 14:23560407-23560429 CTGGGATGGGAGCTGGAGTAGGG + Exonic
1114977415 14:28119103-28119125 CTGGTCTATGGGCTGCAGAATGG - Intergenic
1115133653 14:30083666-30083688 CTGGGCCATGACCTGGCACAGGG + Intronic
1118993368 14:70816095-70816117 CTGAGCTAAGTGGTGGAGCATGG + Intergenic
1119383999 14:74245877-74245899 CTAGGATGTGAGCTGGGGCATGG + Intronic
1119520906 14:75284420-75284442 CTGTGCAATAAGCTAGAGCAAGG - Intergenic
1119556914 14:75560310-75560332 ATGGGGTCGGAGCTGGAGCAGGG + Intergenic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1122295978 14:100705979-100706001 CTGGGCTCGGGGCTGCAGCAAGG + Intergenic
1122388430 14:101364366-101364388 CAGGTCTCCGAGCTGGAGCAGGG + Intergenic
1125200766 15:37099126-37099148 CTGGGGTAAAAGCTGGAGCGAGG + Intronic
1126096747 15:45095630-45095652 CTGGTCTCAGAGCTGGGGCAGGG - Intronic
1126814466 15:52441016-52441038 CTGGGCTTTGAACTAAAGCAGGG + Intronic
1127281884 15:57499957-57499979 CTGGGCTCTGAGCTGTGTCATGG + Intronic
1128522484 15:68384996-68385018 CTGGCCTATGCCCTGGAGAAAGG - Intronic
1129222359 15:74138729-74138751 TTGGGCTGTGACCAGGAGCAGGG - Intergenic
1129597056 15:76973562-76973584 CTGGGCTCTGAGCTGTCGCCTGG - Intergenic
1131248715 15:90817420-90817442 CTGGAAGATGAGCTGGAGGAAGG - Intergenic
1132291111 15:100704508-100704530 ATGGGCGCTGAGCTGGAGCTGGG + Intergenic
1133302642 16:4792151-4792173 CCAGGCCAAGAGCTGGAGCAGGG + Intronic
1133349437 16:5091757-5091779 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1133476486 16:6126797-6126819 ATGAGCTAGGAGCTGGAGGAAGG + Intronic
1133846092 16:9455066-9455088 CTGGGCATTGAGCTGGAGCCAGG - Intergenic
1134098618 16:11436062-11436084 CTGGGCCAGGAGCTGGAGCCAGG - Intronic
1134104624 16:11476922-11476944 CTGAGCTGAGATCTGGAGCAGGG + Exonic
1135617988 16:23928582-23928604 CTGAGCTAGGAGCTGGGGTAAGG + Intronic
1136019140 16:27428819-27428841 CTGGGCTTTGTGATGGAGTAAGG + Intronic
1137403688 16:48173913-48173935 CTGGGTCATGAGGTGGGGCATGG - Intronic
1137821358 16:51449025-51449047 CTGGGACCTGAGTTGGAGCATGG - Intergenic
1138384487 16:56626788-56626810 CTGGGTTCTGAGCTCGAGCCAGG + Intronic
1139371866 16:66473950-66473972 ATGGTGTATGAGATGGAGCAGGG - Intronic
1141594012 16:85086576-85086598 CAGGGCGAGGAGCTGGGGCAAGG + Intronic
1142910794 17:3089279-3089301 CTGGGCTCTGAGCTGGTACTGGG + Intergenic
1142940367 17:3375897-3375919 CTGGGCTCTGGGCTGGTGCTGGG + Intergenic
1143476377 17:7205826-7205848 ATGGGCTATGGGATGGAGGACGG - Intronic
1143477097 17:7208966-7208988 CTGGGCTGTGGGCTGTTGCAGGG - Intronic
1143518162 17:7430227-7430249 CTGGGATATACGCTGGGGCATGG - Intergenic
1144595668 17:16568609-16568631 CAGGGCTCGGAGCTGGAGCCTGG - Intronic
1146105173 17:30028418-30028440 ATGTGCTTTGAGCTGTAGCATGG + Intronic
1146173657 17:30651079-30651101 CTGGGTTCTGAGCGGGAGGAGGG - Intergenic
1147916268 17:43888845-43888867 CTGGGCTATGAGGTTGAGCTTGG - Intronic
1147976501 17:44251000-44251022 CTAGCATATGATCTGGAGCACGG - Intronic
1148699809 17:49580567-49580589 CTGGGCTCGGTGCTGGAGGAGGG + Intronic
1148757956 17:49984433-49984455 CTGGAGGATTAGCTGGAGCAGGG - Intergenic
1149840984 17:59964791-59964813 CGGGGCTAGGAGGTGGAGCCGGG - Intronic
1150650740 17:67008464-67008486 CTGGGCAAAGAGCTGAGGCATGG + Intronic
1150664471 17:67119459-67119481 CAGGGCTGGGAGCTGGAGGATGG + Intronic
1150918806 17:69462113-69462135 CAGGGCTATGAGATGAAGCAGGG - Intronic
1152477226 17:80526281-80526303 CTGAGCTGTGAGCTGGAGCCAGG - Intergenic
1153244184 18:3057475-3057497 CTGAGTTGTAAGCTGGAGCAAGG + Intergenic
1155193392 18:23451078-23451100 ATGGGCTGTAAGGTGGAGCAGGG - Intergenic
1156074393 18:33255749-33255771 CTGGGACAGGAGATGGAGCAAGG + Intronic
1160004824 18:75061991-75062013 CTGGGCTATGGGCTGCAGAGAGG - Intronic
1160269766 18:77373273-77373295 CTGGGGTATGAGGTGGAGAGTGG - Intergenic
1160536437 18:79597016-79597038 CTGGGCGAGGTGCTGGAGCCGGG - Intergenic
1161251937 19:3285319-3285341 CGGGGCTAGGAGCTGCAGGAGGG - Intronic
1161280143 19:3441573-3441595 CTGGCCCCTGGGCTGGAGCAGGG + Intronic
1161310329 19:3590247-3590269 CTGGGCTGGGTTCTGGAGCAGGG - Exonic
1161529875 19:4781824-4781846 CTGGGCTGTGTGCTGGATCCTGG - Intergenic
1162520910 19:11178795-11178817 CTGGGCCAGGAGCTGTAACAGGG + Intronic
1162651605 19:12092706-12092728 CTGGGCCATGAGGAGGATCATGG + Intronic
1163420862 19:17212934-17212956 CTGGGCTATTGGCTGGAGCCAGG + Exonic
1164724581 19:30457618-30457640 GGGGGCCATGAGCTGGAGCCAGG - Intronic
1165067289 19:33236642-33236664 CTGAGCTATCTGCTGGAGGAGGG + Intergenic
1165307179 19:35009987-35010009 CTGGGCTAGGAGCTGGGACTGGG - Intronic
1165491458 19:36125797-36125819 CTGAGCTAGGAGCTGAAGCAGGG - Exonic
1165794786 19:38512436-38512458 CTGGGCGATGTGCTGGAAGAGGG - Exonic
1166281895 19:41799702-41799724 CTGGGCCCTGCGCTGGTGCAGGG - Intronic
1166371138 19:42301956-42301978 CTGGTGCATGAGCTGGACCAAGG + Exonic
1166683719 19:44782539-44782561 CTGGGCTCTGGGCTGGTGCGTGG + Intronic
1166844487 19:45718302-45718324 CTGGAGTGTGAGCTGGAGCAGGG + Intronic
1167019354 19:46861992-46862014 CAGGGGAATGAGCTGGGGCACGG - Intergenic
1167676260 19:50887929-50887951 CTGGGCTAAGAGAGGGAGCTGGG + Intergenic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1168277983 19:55287536-55287558 CAGGGCGAGGAGCTGGAGCTGGG - Intronic
1168287904 19:55343481-55343503 TGGGGCTGTGGGCTGGAGCAGGG + Intronic
1168563527 19:57403669-57403691 ATGAGCCATGGGCTGGAGCAGGG + Intronic
1168593121 19:57652987-57653009 CTGGGTTATGAGCTGCATCTTGG - Intergenic
925695461 2:6572847-6572869 CTGGGCTGTGAGCTCCAGGATGG + Intergenic
927143519 2:20145550-20145572 CTGGCCTAAGGACTGGAGCAGGG - Intergenic
927177928 2:20423238-20423260 CTGAGCTAAGGCCTGGAGCAGGG - Intergenic
927810168 2:26176061-26176083 CCTGGCTCTGAGCTGGAGCAGGG - Intronic
927928967 2:27032132-27032154 CTGGGGTAGGAGGTGGAGAATGG - Intergenic
928106065 2:28471389-28471411 CTGGGATATGGGCGGGAGCCAGG + Intronic
929545085 2:42850527-42850549 CTGGGCCAGGGGCTGGAGCTGGG - Intergenic
929797701 2:45072699-45072721 CTGAGCTCTGTGCTGCAGCATGG - Intergenic
929821624 2:45278621-45278643 CTGGGCTTTGGGCTGGGGCCAGG - Intergenic
930866064 2:56123219-56123241 CTTGGCCAAGAGCTGGGGCAAGG - Intergenic
932461318 2:71883708-71883730 GTGGGCTGTGAGCTGGATGAAGG - Intergenic
933829690 2:86196818-86196840 CTGCGCTATGACTTGTAGCATGG + Intergenic
935061569 2:99612731-99612753 CTGGAATCTGAGCTGGTGCACGG + Intronic
935223780 2:101036377-101036399 CTGGGCTCTGAGCTCCTGCAGGG - Intronic
935232168 2:101108596-101108618 CTGGTCTTGGAGATGGAGCAAGG - Intronic
936040960 2:109149103-109149125 CTGGGCTCTGGGAAGGAGCAGGG + Intronic
937328106 2:121004402-121004424 CTTACCTATGAGTTGGAGCATGG + Intergenic
937527261 2:122786729-122786751 CTTGGATATGATCTGGAGCTTGG + Intergenic
938473891 2:131590350-131590372 CTGGCCTCTGAGCTGGACCAGGG - Intergenic
938943785 2:136192239-136192261 CTTGGAGATGGGCTGGAGCAGGG - Intergenic
939059331 2:137400837-137400859 CTGTGCTGTGTCCTGGAGCAGGG + Intronic
939888814 2:147711243-147711265 CTGGGCTGAGAGCTGAAGGAGGG - Intergenic
940630394 2:156230561-156230583 CTGGGCTCTGAGCTGGTGCTGGG - Intergenic
941928385 2:170917598-170917620 CAGAGCCATGGGCTGGAGCAGGG - Intergenic
941950458 2:171150526-171150548 CTGGGAGATGAGCTACAGCAAGG - Intronic
942753532 2:179314649-179314671 ATGGACTGTGAGCTGAAGCAGGG + Intergenic
945471297 2:210230347-210230369 CTGGGATTGGAGCTGGAGCTTGG + Intergenic
946191292 2:218009504-218009526 CTGGGCTGGGGGCGGGAGCAGGG - Intergenic
946337543 2:219048646-219048668 CTGGGATGTCAGCTGGACCATGG + Intergenic
947722142 2:232376693-232376715 GTGGGCACTGAGCTGGAACATGG - Intergenic
948504036 2:238415835-238415857 CAGAGCCATGGGCTGGAGCAGGG - Intergenic
948882865 2:240869272-240869294 CTGGTCAATGTGCTGGAGCCTGG + Exonic
1170350170 20:15431270-15431292 CAGAGCTATGAGTTGGAGTAGGG - Intronic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1171488142 20:25498417-25498439 CTGGGCTAGGCCCTGGATCAGGG - Intronic
1173369066 20:42418768-42418790 CTGGGGTATGTGCTGCAGCAGGG - Intronic
1174183312 20:48688602-48688624 CTGGGCTCTCAGCTGGAGGTGGG - Intronic
1174749778 20:53100301-53100323 CTGGGCAATGACCTGGAAAACGG - Intronic
1179236683 21:39553684-39553706 CTGAGCTATGCTCTGGAGAATGG + Intergenic
1179638508 21:42731363-42731385 CTGGGGCATGAGCTAGAGGATGG + Intronic
1180072690 21:45444256-45444278 CTGGGCTTGCAGCAGGAGCACGG + Intronic
1180474193 22:15688300-15688322 CTGGCCTCTGAGCTGGACCAGGG - Intergenic
1181014487 22:20061375-20061397 ATGGGGAAGGAGCTGGAGCATGG + Intronic
1181440627 22:22933630-22933652 CAGGCCTAGGAGCTGGATCAAGG + Intergenic
1182787084 22:32917038-32917060 GTGGGGTATGAGATGAAGCAGGG + Intronic
1182936616 22:34228604-34228626 CTGGAATATGAGCTCCAGCAGGG + Intergenic
1183384369 22:37506439-37506461 CTGGCCTATGACTTGGAGAATGG + Intronic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1184478681 22:44735175-44735197 CTGGGCCTTGGGCTGGGGCAGGG + Intronic
1184660871 22:45964970-45964992 CTGGGCAATGAGGTGGAGGATGG - Intronic
1184712397 22:46260119-46260141 CTGAGCTATGAGTTGCAGCAGGG + Exonic
1184861872 22:47176926-47176948 CTGGGCTGTGACCTGGAGTCAGG - Intergenic
950102242 3:10365119-10365141 CTTGGCTAGGAGCCGAAGCAGGG + Intronic
950202748 3:11056615-11056637 CTGGGCTCTGGGCTGCTGCAAGG - Intergenic
951184799 3:19701155-19701177 CTGGGGCATGAGCTGGAGAATGG - Intergenic
951527710 3:23669812-23669834 CTGGGCATGGGGCTGGAGCAGGG - Intergenic
951613733 3:24520442-24520464 TTGGGCCATGAGATGGAGAAGGG - Intergenic
952795940 3:37239202-37239224 CTGGGCTCTCAGGTTGAGCAGGG - Intergenic
953171630 3:40512425-40512447 CTGGTCTCCCAGCTGGAGCAAGG + Exonic
953387788 3:42516439-42516461 CTGGGCTGTGAACTGGTGCTGGG - Intronic
954343107 3:49971512-49971534 CTGGTCTGAGAGCTGGAGAATGG - Intronic
954640715 3:52096169-52096191 CTAGGCTATGAGTTTGAGCCTGG - Intronic
954706650 3:52484576-52484598 CTGGGCAATGGGCTGGTGCTCGG - Exonic
955204679 3:56885134-56885156 CTGGGCAATGAATTGGGGCATGG + Intronic
955796147 3:62639352-62639374 CTGGACTGTGAACTTGAGCATGG + Intronic
956193054 3:66625368-66625390 CTGAGCTAGGTGCTGGAGAAAGG - Intergenic
957053745 3:75429099-75429121 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
957152097 3:76499083-76499105 CTGGGTAATGAGCAGGAGTAAGG - Intronic
958552684 3:95637202-95637224 CTGGGGTATGAAAGGGAGCAGGG - Intergenic
959263320 3:104107435-104107457 CTGTGCTATGTGTTGGTGCAAGG - Intergenic
960578028 3:119246250-119246272 CTAGGCTCTGAGCTGGTGCTGGG - Intergenic
960941528 3:122938068-122938090 CTGGGATCTGGGCTGGAGCAAGG - Intronic
961195828 3:125000640-125000662 CTGGGATAAGAGCTGGAGCTTGG - Intronic
961301100 3:125922580-125922602 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
961318764 3:126058078-126058100 CTGGGCTGTGAGCAGGACCCTGG - Intronic
961339540 3:126208754-126208776 CTGGGCGAGGAGCTGGGACACGG + Intergenic
961796890 3:129415540-129415562 AAGGGCTCTGAGCTGCAGCAGGG - Intronic
961887425 3:130105493-130105515 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
962369152 3:134806386-134806408 CTGGGACTTGAGCTGGAGCTGGG - Intronic
962522351 3:136209074-136209096 CTGAGCTTTGAGAGGGAGCATGG + Intergenic
962527356 3:136248771-136248793 CCTGGCTATGAGCTGGATCTGGG + Intergenic
966610886 3:181867122-181867144 CTGGGCTATGAGCTGATGCATGG + Intergenic
967109505 3:186281267-186281289 CTGGGCTAAGGGCTGGACCATGG - Intronic
967203827 3:187101320-187101342 CTGGGCTCTGAGGCTGAGCAAGG + Intergenic
967818277 3:193817036-193817058 CTAGGCTCTCAGCTGGAGGATGG - Intergenic
967963388 3:194942443-194942465 CTGGGCAGTGAGCTGGTGGAGGG - Intergenic
968601374 4:1511578-1511600 CTGGGCGCTGAGCTGGGGCGCGG - Intergenic
968622719 4:1610961-1610983 CAGGGCTGTGCCCTGGAGCAGGG - Intergenic
968724803 4:2241872-2241894 CTGGGCGAGGAGCTGGGGCGGGG - Intronic
968958047 4:3728932-3728954 CTTGGGTTTGAGCTGGTGCAGGG + Intergenic
968996549 4:3949411-3949433 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
969487440 4:7480176-7480198 CTGGGCTTTGCCCTGAAGCAGGG + Intronic
969505461 4:7584254-7584276 GTGGCCTCTGAGTTGGAGCAGGG + Intronic
969757451 4:9159271-9159293 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
969817411 4:9696807-9696829 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
970223012 4:13829789-13829811 ATGGGCTAAGACATGGAGCAAGG + Intergenic
977577192 4:98687678-98687700 CTGGGCGATGAACAGGAGAATGG - Intergenic
978068472 4:104436101-104436123 CTAAGCTAAGAGCTGGAGCATGG - Intergenic
978249134 4:106610053-106610075 CTGGGCTAGCATCTGGGGCAGGG - Intergenic
979319822 4:119310305-119310327 TTTGGCTATCAGCTGGAACATGG - Intergenic
981579816 4:146239929-146239951 CTGGACCCTGAGCAGGAGCAAGG - Intergenic
982862291 4:160468127-160468149 ATAGGATATGAGCTGGAGCCTGG - Intergenic
985003097 4:185505033-185505055 AGGGGCTATGAGCAGGAGCACGG - Intronic
985887273 5:2689204-2689226 CGGGGCTATGGGCTGGTACATGG + Intergenic
988002288 5:25363576-25363598 CTGGGCTCTGAGCTGGTACTAGG - Intergenic
988331625 5:29849184-29849206 CCGGGCTATGAGCAGATGCATGG + Intergenic
991440890 5:66647689-66647711 CTGTGCTATGTTCTGGAGCTGGG - Intronic
992956478 5:81914781-81914803 AAAGGCTCTGAGCTGGAGCAAGG + Intergenic
994452065 5:99955688-99955710 CAGGGCTATCAGCTGCAGAAAGG - Intergenic
994887520 5:105583261-105583283 CTGGGCTCTGGGCTGGTGCTGGG - Intergenic
996535186 5:124570310-124570332 CTGGGATCTGAGCTTGGGCAGGG + Intergenic
998166489 5:139847360-139847382 CTAGGCTTGGAGCTGGAGCTGGG - Intronic
998386032 5:141757673-141757695 CTTTTCTAGGAGCTGGAGCAGGG + Intergenic
998402595 5:141855776-141855798 CTGGGCAGGGAGCTGGGGCAAGG - Intronic
998758670 5:145407990-145408012 CTGGGCTCTGGGCTGGTGCTGGG - Intergenic
999285380 5:150391439-150391461 CTGGGGTGAGGGCTGGAGCAGGG - Intronic
1001014496 5:168127985-168128007 CAGGGCTAGGAGCTTGCGCAGGG + Intronic
1001924660 5:175627386-175627408 CAGGGCTATGGGAAGGAGCAAGG + Intergenic
1002302733 5:178266724-178266746 CTGAGCTGTGAGCAGGAGCAGGG - Intronic
1002476332 5:179468679-179468701 CTGGGAGCTGAGCTGGGGCAGGG - Intergenic
1002512855 5:179733841-179733863 CTGTGCTGTGAGCAGGATCAGGG + Intronic
1002840532 6:901459-901481 GTGTGCTAGGAGCTGGAGAAAGG - Intergenic
1003971941 6:11308182-11308204 TTGGGTTATGGGATGGAGCAGGG + Intronic
1005244181 6:23862536-23862558 CTGGGCTCTGAGCTGGTACTGGG - Intergenic
1006067802 6:31474947-31474969 CAGGGCTTTGAGCCTGAGCAGGG + Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1006680677 6:35795057-35795079 CCGGGAGATGCGCTGGAGCAGGG + Exonic
1007373524 6:41442096-41442118 CTGGACTATGAGAGGGAGGAGGG - Intergenic
1007413822 6:41680389-41680411 ATGGGCTTTGAGATGGAGCACGG + Intergenic
1007478526 6:42135090-42135112 TTGGGCTGTGAGCTTGAGCTGGG + Intronic
1010055366 6:71558159-71558181 CTGGGCTCTGGGCTGGTGCTGGG + Intergenic
1011146089 6:84218364-84218386 CTGGCCTATGAGGACGAGCACGG - Intronic
1011555422 6:88567442-88567464 CTGGGCTTTGTTCTGGAGCCTGG + Intergenic
1011616884 6:89205627-89205649 CTTGGAGGTGAGCTGGAGCACGG + Intronic
1014406453 6:121057900-121057922 CTAGGTGATAAGCTGGAGCAGGG - Intergenic
1015880818 6:137868145-137868167 GTGGGGTAGGGGCTGGAGCAGGG - Intronic
1016775071 6:147896349-147896371 CTGGACTCTGAGCTGGGGCTGGG + Intergenic
1017629438 6:156382315-156382337 CATGGCTATGAGATAGAGCAGGG + Intergenic
1019292808 7:258566-258588 CTGGGCTGGGAGCTGGGCCATGG - Intronic
1019337274 7:491387-491409 CTGGTTTCTGAGCTGGAGCCTGG - Intergenic
1019799857 7:3080264-3080286 CCGGGCTCTCTGCTGGAGCATGG - Intergenic
1019923940 7:4180176-4180198 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923946 7:4180201-4180223 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923951 7:4180226-4180248 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019923957 7:4180251-4180273 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923968 7:4180301-4180323 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923973 7:4180326-4180348 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923979 7:4180351-4180373 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1019923985 7:4180376-4180398 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923990 7:4180401-4180423 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019923994 7:4180426-4180448 CTGGGCATAGAGCTGGAGCTGGG - Intronic
1019924006 7:4180476-4180498 CTGGGCATAGAGCTGGAGCCAGG - Intronic
1019924015 7:4180526-4180548 CTGGGCATAGAGCTGGAGCCGGG - Intronic
1020320830 7:6937826-6937848 CTGGGCTGTGAGGGGGAGGAGGG + Intergenic
1020519778 7:9171228-9171250 CTGGGCTGTGAGTTCGAGAAAGG - Intergenic
1024262495 7:47582525-47582547 CTAGGCTATGAGCTACAGGAGGG - Intronic
1024641801 7:51335061-51335083 CTGGGAGCTGAGCTAGAGCAGGG + Intergenic
1024952417 7:54878311-54878333 CTGGGGTATGAGTGGGAGCTGGG + Intergenic
1028501905 7:91528090-91528112 CTGGGCTCTGAGCTGGTACTGGG - Intergenic
1029479078 7:100802190-100802212 CTGGGGCAGGAGCTGGAGCAGGG - Intergenic
1030072201 7:105707467-105707489 CTGGGCTATGGGCTGAACCCTGG + Intronic
1030172568 7:106618533-106618555 CCAGGCTATGATCTGGACCAAGG - Intergenic
1030202434 7:106918946-106918968 ATGGACAATGAGCTGAAGCAGGG + Intergenic
1031528470 7:122849925-122849947 CTGGGCCAGGAGCTGGGGCCTGG - Intronic
1032800100 7:135310873-135310895 CTATGCTATGATCTGCAGCAGGG + Intergenic
1032957420 7:136987201-136987223 CTGTGCTATGTGCTGGAGCAGGG - Intronic
1034590283 7:152132532-152132554 CTGGGCACTGAGCTGGAGCACGG + Intergenic
1035591417 8:817763-817785 CTAGGCTCTGAGCTGGTGCTGGG + Intergenic
1036380694 8:8234599-8234621 CTGGGCTGTGAGGGGGAGGAGGG - Intergenic
1036848880 8:12188035-12188057 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1036870241 8:12430313-12430335 CTGGGCTGTGAGGGGGAGGAGGG + Intronic
1037319642 8:17630911-17630933 CTTTGCTCTGAGCTGCAGCATGG + Intronic
1039968215 8:42299231-42299253 CAAGGCTATGAGCAGGAGCGGGG - Intronic
1039978000 8:42383495-42383517 CTGTGCAATGTGCTGGTGCAGGG + Intergenic
1046484064 8:114862083-114862105 CTGGTTCATGAGCTGGTGCATGG + Intergenic
1046537262 8:115531439-115531461 CTAGGCCATGAGCTGAAGGAAGG + Intronic
1047602982 8:126445780-126445802 CTGGGTTCTGAGCAGGAGCTGGG - Intergenic
1049797103 8:144501833-144501855 CGGGGCTGTGAGCTTGAGCAGGG - Exonic
1053271720 9:36754555-36754577 CTGGGCAATGAGATGGAGATAGG - Intergenic
1053459053 9:38254399-38254421 CTGAGCTGAGGGCTGGAGCAGGG + Intergenic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1056444242 9:86649184-86649206 CTTGCCTATGGGCTGGAGAAAGG - Intergenic
1056911452 9:90704641-90704663 CTTGGTCATGAGATGGAGCAGGG - Intergenic
1057030777 9:91773694-91773716 CTGGCTTATGGGCTGGGGCAAGG - Intronic
1061973295 9:134056052-134056074 ATGGACTGTGAGCTTGAGCAAGG + Intronic
1186972675 X:14865113-14865135 CTAGGCTATGAGATGAAGGATGG - Exonic
1187748096 X:22431647-22431669 CTGGGCTGTGGGCAGGACCATGG + Intergenic
1187802741 X:23082294-23082316 CTAGCTTATGGGCTGGAGCATGG - Intergenic
1188065645 X:25656329-25656351 CTGGGTTAGGAGGTGGAGGAGGG - Intergenic
1188811002 X:34654867-34654889 CTGGGCTATGACTTTCAGCAAGG + Intronic
1189341735 X:40209734-40209756 CTGGGCTTTAAGGTGGAGGATGG - Intergenic
1191934738 X:66414626-66414648 CTTGGCTAGGGGCTGGAGTATGG - Intergenic
1192221927 X:69203295-69203317 CTGGGCTCTGGCCTGGAGGAAGG + Intergenic
1192693653 X:73391529-73391551 GTGGGGCATGGGCTGGAGCAGGG - Intergenic
1193993205 X:88334658-88334680 ATGGGCTAGGAGCAGGAGCGAGG - Intergenic
1194967412 X:100304262-100304284 CTGGGCTATGGGCTGGTACTGGG - Intronic
1195702732 X:107716899-107716921 CTGGGCTCTGCGCTGGAGTCCGG + Intronic
1198212818 X:134531004-134531026 CAGGGGGATGACCTGGAGCAGGG - Intergenic