ID: 1090254383

View in Genome Browser
Species Human (GRCh38)
Location 11:125273097-125273119
Sequence CCCGGAGAGACTGGCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 190}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090254368_1090254383 24 Left 1090254368 11:125273050-125273072 CCTGCCTAAAAGCCCGCCCAGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 190
1090254369_1090254383 20 Left 1090254369 11:125273054-125273076 CCTAAAAGCCCGCCCAGTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 190
1090254377_1090254383 2 Left 1090254377 11:125273072-125273094 CCAGGGTGAGAGGCCGCTTGTCA 0: 1
1: 0
2: 0
3: 8
4: 86
Right 1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 190
1090254374_1090254383 11 Left 1090254374 11:125273063-125273085 CCGCCCAGTCCAGGGTGAGAGGC 0: 1
1: 0
2: 1
3: 33
4: 274
Right 1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 190
1090254375_1090254383 8 Left 1090254375 11:125273066-125273088 CCCAGTCCAGGGTGAGAGGCCGC 0: 1
1: 0
2: 2
3: 4
4: 138
Right 1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 190
1090254372_1090254383 12 Left 1090254372 11:125273062-125273084 CCCGCCCAGTCCAGGGTGAGAGG 0: 1
1: 0
2: 1
3: 37
4: 270
Right 1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 190
1090254376_1090254383 7 Left 1090254376 11:125273067-125273089 CCAGTCCAGGGTGAGAGGCCGCT 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090254383 Original CRISPR CCCGGAGAGACTGGCTGTGC TGG Intronic
900571973 1:3363102-3363124 CCAGGGGAGGCTGGCTGTGATGG - Intronic
900887735 1:5427377-5427399 CCCAGAGAGACAGTCTGAGCTGG - Intergenic
901491305 1:9597690-9597712 CCCAGAGACACTGGCTTTCCTGG + Intronic
901759790 1:11463287-11463309 CCAGGCCAGACAGGCTGTGCAGG + Intergenic
901811927 1:11772238-11772260 ACCAGAGAGCTTGGCTGTGCAGG + Exonic
901931412 1:12598106-12598128 CATGTAGAGACTGGATGTGCGGG - Intronic
902856435 1:19209913-19209935 CCCGGGGAGACTGGCTTGCCTGG - Intronic
903374084 1:22854832-22854854 CCCAGAGGGACTGACTCTGCTGG + Intronic
904298801 1:29541046-29541068 TCAGGAGAGACTGGATGTGCGGG - Intergenic
905315109 1:37077556-37077578 CCTGGAGGGACTGGGTGTGAGGG + Intergenic
905898716 1:41566557-41566579 TCCTAAGAGACTGGCTGTGGAGG - Intronic
906263804 1:44412940-44412962 TCCGGAGAGAAAGGCTGTGCTGG - Intronic
906901934 1:49844851-49844873 CCTAGAGAGCCTGGCAGTGCTGG + Intronic
910208941 1:84774748-84774770 CCCAGAGAGGCCGGCTGTGGAGG + Intergenic
913115672 1:115694422-115694444 AATGGAGAGACTAGCTGTGCAGG + Exonic
915348371 1:155209311-155209333 CCTGGACAGCCTGGCCGTGCTGG + Exonic
922418514 1:225443475-225443497 CACGGAGTGAGTGGCTGAGCTGG + Intergenic
922866280 1:228863892-228863914 CCAGGTGAGAGGGGCTGTGCGGG + Intergenic
922891138 1:229062650-229062672 CCCAGGGAGACTGGGAGTGCTGG - Intergenic
1065359089 10:24872266-24872288 CAGGGAGAGGCTGGGTGTGCAGG + Intronic
1070697654 10:78574744-78574766 CCTAAAGAGAATGGCTGTGCGGG + Intergenic
1070991067 10:80732616-80732638 CACGGAGGGACTGGCTGTTGTGG + Intergenic
1071994197 10:91130883-91130905 CCCAGAGGGGCTGGCTGTGGGGG - Intergenic
1075129574 10:119726356-119726378 CCCGGTGAGGCTGGCGGTGCGGG + Exonic
1075413294 10:122244704-122244726 CCCAGAGAGATTGGCAGTTCAGG + Intronic
1075673891 10:124282548-124282570 GCCTGAGGGAATGGCTGTGCAGG - Intergenic
1076201861 10:128565626-128565648 CCCGGACAGAGTGGGTGAGCTGG - Intergenic
1076731084 10:132439210-132439232 CCCAGTGAGTCTGGCTGTCCCGG + Intergenic
1077237289 11:1487875-1487897 CCTGGAGAGTGTGTCTGTGCTGG - Intronic
1077409035 11:2395043-2395065 CCAGGTGAGCCTGGGTGTGCAGG + Exonic
1078256618 11:9664127-9664149 CGCGGAGGGGCTGGCTGGGCAGG + Exonic
1079759576 11:24311290-24311312 CCAGGAGAGACAGACAGTGCAGG - Intergenic
1083791599 11:64989538-64989560 CCTGGAGAGAGCGGCTGAGCTGG + Exonic
1085266525 11:75240935-75240957 CCCGGAGCGGCTGGCAGTCCCGG - Exonic
1085651278 11:78270979-78271001 CCCTGTGATAGTGGCTGTGCAGG + Intronic
1090254383 11:125273097-125273119 CCCGGAGAGACTGGCTGTGCTGG + Intronic
1091685065 12:2555659-2555681 CCCGCAAAGACTGCCTGTGAGGG - Intronic
1093926521 12:24913730-24913752 TCCAGACAGACAGGCTGTGCTGG - Intronic
1096100922 12:48970070-48970092 CGCGGTGAGCCTGGCTGGGCGGG - Exonic
1097864638 12:64549687-64549709 TCAGGAGAGAGAGGCTGTGCTGG - Intergenic
1099693124 12:85986205-85986227 CAGGGAGAGCCTGGCTGTTCAGG - Intronic
1102004376 12:109579884-109579906 CACCGAGCGCCTGGCTGTGCTGG + Exonic
1104096166 12:125559983-125560005 CCCAGAGAGGCTGGCAGCGCTGG - Intronic
1104683621 12:130769420-130769442 CCAGTAGAGAATGGCAGTGCTGG - Intergenic
1108074618 13:46666956-46666978 CCAGGAGAGAGTGCCAGTGCGGG + Intronic
1109968193 13:69729200-69729222 CCAAGTGAGTCTGGCTGTGCTGG + Intronic
1112506476 13:99979299-99979321 CCGGGAGAGGCTGCCTGAGCCGG + Intergenic
1113491701 13:110697350-110697372 CATTGAGAGACTGGCAGTGCTGG - Intronic
1113803220 13:113096963-113096985 CCCAGAGCGCCTGGCCGTGCGGG + Exonic
1114183179 14:20382117-20382139 CAAGGAGAGACTGGGTGTGGTGG - Intronic
1117844439 14:59896214-59896236 CCCAGAAAGACTGGCAGAGCTGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1117963796 14:61187427-61187449 CCCAGAGATCCTGGCTTTGCTGG + Intergenic
1119516602 14:75253253-75253275 CCTGGAGAGCCCTGCTGTGCCGG - Intronic
1119539444 14:75428626-75428648 CCCGCGGAGATGGGCTGTGCGGG + Intronic
1122721391 14:103724376-103724398 CAAGGACAGACGGGCTGTGCTGG - Intronic
1124635294 15:31361139-31361161 CTCGTAGAGCCTGGCTGTGGGGG + Intronic
1124653099 15:31487175-31487197 ACGGGTGAGCCTGGCTGTGCTGG - Exonic
1124890185 15:33725446-33725468 CCGCCAGAGACTGCCTGTGCAGG + Intronic
1126403499 15:48299054-48299076 CCAGGTGTGACTGGCTCTGCTGG - Intronic
1129851829 15:78797984-78798006 CCCGGAGAGGCTGGCACAGCGGG - Exonic
1130251168 15:82301107-82301129 CCCGGAGAGGCTGGCACAGCGGG + Intergenic
1131093682 15:89642358-89642380 CCCGGATACGCTGGCTGTGCTGG + Exonic
1131191245 15:90318673-90318695 TCTGGAGAGACAGGCTGGGCTGG - Intergenic
1132721731 16:1319891-1319913 CCCAGACTGCCTGGCTGTGCTGG + Intronic
1132976140 16:2712080-2712102 CATGGAGGGACTGGCTGGGCGGG - Intergenic
1133125088 16:3641426-3641448 CCCAGAGGGCCTGCCTGTGCTGG - Intronic
1135629388 16:24023864-24023886 ACAGCAGAGCCTGGCTGTGCTGG - Intronic
1135768040 16:25194921-25194943 TCCGGACAGACAGGCCGTGCAGG - Intergenic
1136508233 16:30720239-30720261 CCCGGCGAGAGAGGCGGTGCCGG - Exonic
1136630043 16:31484741-31484763 GCCGGTGAGACGGGCTGGGCCGG + Exonic
1139344832 16:66296272-66296294 CCTGGACAGACTGGCTGATCCGG + Intergenic
1140218181 16:73024829-73024851 ACCAGAGGGTCTGGCTGTGCCGG + Intronic
1141468266 16:84221443-84221465 CAGGGAGGGCCTGGCTGTGCTGG + Exonic
1141569516 16:84925690-84925712 CCCTGAGAGTCTGGTTCTGCTGG - Intergenic
1142147805 16:88499822-88499844 CCCGGAGAGGCTGGATGGGTGGG - Intronic
1142237896 16:88931271-88931293 CTCTGTGAGCCTGGCTGTGCTGG + Intronic
1143314718 17:6023649-6023671 CCTGCAGAGACTGGCTGTGAAGG + Intronic
1144340879 17:14309532-14309554 CCCAGAGAGGCGGGCTGAGCGGG + Intronic
1145866786 17:28246931-28246953 CCCTGTGTGAGTGGCTGTGCCGG + Intergenic
1147662268 17:42123042-42123064 CCCGGAGGAACTGGTGGTGCAGG + Exonic
1148198643 17:45733129-45733151 CTGGGAGAGCCTGGCTGTGGGGG + Intergenic
1148678177 17:49457170-49457192 CCCACAGAGACTGGATGTGGAGG - Intronic
1148839370 17:50484759-50484781 CTGGGAGGGTCTGGCTGTGCTGG + Exonic
1152508537 17:80769937-80769959 CCCCGTGTGACTGGCTCTGCAGG - Intronic
1153805734 18:8706751-8706773 CCCGGAGGGCCTGGCTGCGGCGG + Intronic
1154048055 18:10926211-10926233 CCGGGGGAGACCGGGTGTGCTGG + Intronic
1155862921 18:30926644-30926666 TCTGGAGAGTCTGGATGTGCTGG - Intergenic
1156456852 18:37299565-37299587 CCAGGAGAGGCTGGCACTGCGGG + Intronic
1160226725 18:77017593-77017615 CCCGGAGAGCCCAGATGTGCAGG + Intronic
1160235163 18:77079903-77079925 CCCGGAGAGAGTTGCAGTACCGG - Intronic
1161082819 19:2319903-2319925 CCCATAGACACTGGCTTTGCTGG - Intronic
1161537733 19:4830733-4830755 CTCTGAGAGACTGGCTGGGAAGG + Intronic
1161999604 19:7734945-7734967 ACTGGAGACACTGGCTGAGCCGG + Intergenic
1162481116 19:10927744-10927766 CCCGGAGAGCCTGGGTCAGCTGG + Intronic
1163157650 19:15448235-15448257 CCCAGAGAGACTGCCTGGCCCGG - Exonic
1165074652 19:33273966-33273988 CCCTCAGAGCCTGGCTGGGCTGG - Intergenic
1167268329 19:48494096-48494118 CCGGGAGAGCCTGGCTGCGAGGG + Exonic
1168227619 19:55007677-55007699 CCAGGAGATACCAGCTGTGCTGG + Intergenic
1168414762 19:56160918-56160940 CCCTGGGAGGGTGGCTGTGCCGG - Intergenic
1168694068 19:58395293-58395315 CCCACAGAAACTGGGTGTGCAGG - Intergenic
925104841 2:1282632-1282654 CCCGGAGGGACGCGCTGTGCGGG - Intronic
927878106 2:26672348-26672370 CACGGAGAAACTGTGTGTGCTGG - Intergenic
929587882 2:43127432-43127454 GCAGGAGAGCCTGGCTGGGCGGG - Intergenic
930860873 2:56071408-56071430 CAGGGAGAGACTGGGTGTGGGGG + Intergenic
932279008 2:70473339-70473361 CCCAGAGAGACTTGGTGAGCAGG + Intronic
937314112 2:120920178-120920200 CCAGGACAGAGTGGCTGTGTTGG - Intronic
937954865 2:127416433-127416455 CCTGGAGCGGCTGCCTGTGCTGG + Intergenic
938121175 2:128635452-128635474 CCCAGAGAGACTGTCTTTGGAGG - Intergenic
938383985 2:130851797-130851819 CCCGGAGAGACTGGCAGAGCAGG - Intronic
939969563 2:148644619-148644641 CGCGGAGAGAGTGGGTGGGCAGG + Intronic
941811097 2:169756799-169756821 CTCGCAGAGGCTGGCTGTGAAGG - Intronic
945094705 2:206208059-206208081 CTCAGAGAGACTGTGTGTGCAGG - Intronic
946484163 2:220084860-220084882 TCCGGAGAGACTGGGTTAGCTGG - Intergenic
946730719 2:222706905-222706927 GCCAGAGAGGCTGGCTGTGGTGG + Intronic
947770579 2:232667200-232667222 CCCCTGGAGCCTGGCTGTGCTGG + Intronic
948693322 2:239720439-239720461 CCCGGAGGGCTTGGCTGGGCAGG + Intergenic
948864893 2:240770239-240770261 CCCTCAGTGAATGGCTGTGCAGG - Intronic
1171009124 20:21498384-21498406 GGCGGAGAGGCTGCCTGTGCAGG - Intergenic
1173925483 20:46778310-46778332 ACCGGCAAGACTGGCTGTTCGGG - Intergenic
1175624212 20:60476932-60476954 CTCTGAGAGACTGGCTTTGAGGG + Intergenic
1175670992 20:60902771-60902793 CCAGGAGAAACTGGCTGTGATGG - Intergenic
1180235895 21:46459182-46459204 GCGGGAGAGCCTGGCTGAGCTGG + Exonic
1180235921 21:46459273-46459295 CCCGGAGTGAGGGGCTGCGCGGG - Intronic
1181089584 22:20463524-20463546 TCTGGAGAGATTGGCTTTGCAGG + Intronic
1182369160 22:29798935-29798957 CGCAGAGAGACTCACTGTGCTGG - Intronic
1182715889 22:32356094-32356116 CCCTGAGAGCCAGGCTGTCCAGG - Intronic
1184856890 22:47151152-47151174 TCCTGCGAGCCTGGCTGTGCGGG + Intronic
1185150295 22:49160423-49160445 CCTGGAGAGACGGGGTGTGTGGG - Intergenic
1185343008 22:50299924-50299946 TCCGGGGAGTCTGGCGGTGCCGG - Intronic
949841578 3:8325963-8325985 CCCGGACAGGCTGGCCGGGCGGG - Intergenic
949950462 3:9224807-9224829 CAGGGAGGGGCTGGCTGTGCAGG + Intronic
950362951 3:12462651-12462673 CCAGGAGAGAGGGGCCGTGCTGG - Intergenic
950664762 3:14488435-14488457 CCCAGGGAGAGGGGCTGTGCTGG - Exonic
953904253 3:46860617-46860639 ACCGGGGAGACTGGCTGGGTGGG - Intronic
954146483 3:48636794-48636816 ACGGGGGAGAGTGGCTGTGCAGG - Exonic
960999779 3:123366446-123366468 GCCACAGAGAGTGGCTGTGCTGG - Intronic
961648230 3:128404061-128404083 CCCGCAGAGTCTGGCTGGGTGGG + Intronic
962133757 3:132710648-132710670 CCGGGAGAGGCTGGCTGAGTAGG - Intronic
963252924 3:143119350-143119372 CCCGGAGAGGTTGGCAGTGTCGG + Exonic
963346517 3:144101627-144101649 CCTGAATAGAGTGGCTGTGCAGG - Intergenic
964368082 3:155970674-155970696 CCAGCAGGGACTGGCTTTGCAGG + Intergenic
968943931 4:3653791-3653813 AGCGGACAGAGTGGCTGTGCTGG - Intergenic
969105161 4:4801885-4801907 GCAGGAGAGCCTGGCTGTGGAGG + Intergenic
969526739 4:7707660-7707682 CCAGGAGGGACTGGTTCTGCTGG + Intronic
977477897 4:97536755-97536777 AGCAGAGAGACTGGCTGTGAAGG - Intronic
979915848 4:126432264-126432286 CCTGGTGAGACTGTCTGTCCTGG - Intergenic
982306351 4:153935217-153935239 CCCTGTGAGACTGGGTGTGGTGG - Intergenic
992479570 5:77137275-77137297 CCAGGAGAGACTGGCCTAGCAGG + Intergenic
996762380 5:126999367-126999389 CCCCAAGGGACAGGCTGTGCAGG - Intronic
997417166 5:133737996-133738018 CCCGGAGAAACAGGCACTGCTGG - Intergenic
998131810 5:139655227-139655249 GCTGGGGAGACTGGCTGTGATGG + Intronic
999386053 5:151155450-151155472 CCCACAGAGACTGGCTATGGGGG - Intronic
1001515698 5:172353928-172353950 CCTGGAGAGAGGGGCTGTGGTGG - Exonic
1002106380 5:176881283-176881305 CGCGGTGAGTCTGGGTGTGCGGG - Exonic
1002564385 5:180101591-180101613 CACTGAGAAAGTGGCTGTGCTGG - Intronic
1002568488 5:180127394-180127416 CCCGGAAAGCCTGGACGTGCGGG - Intronic
1006141385 6:31932010-31932032 CCCGGACAGAGTGGCTGGCCGGG + Intronic
1007927549 6:45662636-45662658 CCCTGAGAGCCTCGCTCTGCTGG + Intronic
1008401545 6:51069154-51069176 CCTGGAGAGACTTTCTTTGCAGG + Intergenic
1009303502 6:62058252-62058274 GCAGGAGAGATTGGCTGTTCAGG - Intronic
1015155304 6:130088160-130088182 CCCAGAAATACTGGCTGTGAGGG + Intronic
1019383516 7:740589-740611 CCAGGAGGGACTGGCGGAGCTGG + Intronic
1019593576 7:1847919-1847941 CCTGGAGAAACCGGCTGTGTAGG - Exonic
1023678085 7:42651760-42651782 GCTGGAGAGACAGGCTGTGGGGG - Intergenic
1024366530 7:48527052-48527074 TCCAGAGAGGGTGGCTGTGCAGG + Intronic
1024497921 7:50069384-50069406 CCAAGAGAAACTAGCTGTGCTGG - Intronic
1026482474 7:70790470-70790492 ACCGGAGAGACCCGCTGGGCAGG + Exonic
1026866138 7:73825168-73825190 TCTGGCGAGACTGGCTGAGCGGG - Intronic
1027354805 7:77344621-77344643 CCAGGAGATACTAGCTGTGATGG - Intronic
1029112730 7:98222103-98222125 CCCGGGAGGACGGGCTGTGCTGG - Intronic
1029439987 7:100582215-100582237 CCCCGAGAGGATGGCAGTGCTGG - Intronic
1034135020 7:148759317-148759339 CTTGGAGAGACTGTCTGTTCAGG + Exonic
1034858641 7:154577367-154577389 CCAGGAGAGACTGCTGGTGCAGG + Intronic
1036415956 8:8548862-8548884 CCCAGAGAGGCTGCCTGAGCAGG - Intergenic
1036566003 8:9938498-9938520 CCTGGAGAGAGTAGCTGTGTGGG - Intergenic
1039840537 8:41289993-41290015 CCTGGTGAGCCTGGCTGTGCTGG - Intronic
1040488100 8:47893542-47893564 CCTGAAGAGAATGGCTGTGGTGG - Intronic
1041726627 8:61023878-61023900 GCCGGAGAGACTGGCTGCTGAGG + Intergenic
1043678376 8:82990592-82990614 CAAGGAGAGAATAGCTGTGCTGG - Intergenic
1045657887 8:104405872-104405894 CCCGGAGCATCTGGCTGTGGCGG - Intronic
1047995028 8:130326483-130326505 CACGAACAGACTGGATGTGCTGG + Intronic
1048766625 8:137851718-137851740 CTCAGAGAGACTGGCTGTGATGG - Intergenic
1048982287 8:139709174-139709196 CCAGGAGAGAGTGGCAGTGATGG + Intergenic
1051174232 9:14347302-14347324 CCCGAAGGCACTGACTGTGCAGG - Intronic
1053351454 9:37416048-37416070 ACCTGAGAGAGTGGCTGAGCTGG + Intergenic
1056250657 9:84744834-84744856 CCCCGACAGTCTGGCTGTGGAGG - Intronic
1056935595 9:90913093-90913115 CCAGGAGAGAGTGGCAGGGCGGG - Intergenic
1060831372 9:126719778-126719800 CCCGTGCAGACTGGCTGAGCTGG - Intergenic
1061485072 9:130916397-130916419 CCCCAAGTGACTGCCTGTGCCGG + Intronic
1061939029 9:133874237-133874259 CCCAGCAAGACTGGCTGGGCAGG + Intronic
1185802252 X:3022807-3022829 CCCTTAGAGACTTGCTGTCCTGG - Intronic
1186561351 X:10617135-10617157 CCCAGAAAGACTACCTGTGCAGG - Intronic
1189267785 X:39730070-39730092 CCCAGGGAGGCTGGCTGAGCTGG - Intergenic
1189333336 X:40155885-40155907 CGCGGAGAGTCCGGGTGTGCTGG - Intronic
1189461915 X:41250067-41250089 CCTGGGTAGACTGGCCGTGCTGG + Intergenic
1192211122 X:69128728-69128750 CCCGGAGCTACTGGCCGTGGAGG + Intergenic
1193577782 X:83224633-83224655 CCTGGAGAGACTTTCTGTGGAGG - Intergenic
1197936031 X:131741265-131741287 CCCAGAAAGACTTGCTGTGGGGG + Intergenic
1198266650 X:135015797-135015819 CCTGATGAGACTGCCTGTGCTGG + Intergenic
1201735896 Y:17261290-17261312 CTTGGAGAGACTGGATGTGGTGG - Intergenic