ID: 1090256131

View in Genome Browser
Species Human (GRCh38)
Location 11:125285936-125285958
Sequence CACATTCAGCAACTTCACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090256126_1090256131 16 Left 1090256126 11:125285897-125285919 CCTGGGTGATGGTGTGCTGCTTT 0: 1
1: 0
2: 1
3: 20
4: 251
Right 1090256131 11:125285936-125285958 CACATTCAGCAACTTCACATTGG 0: 1
1: 0
2: 1
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090256131 Original CRISPR CACATTCAGCAACTTCACAT TGG Intronic
906934099 1:50196558-50196580 CTCTTTGAGAAACTTCACATGGG + Intronic
907803101 1:57791044-57791066 CACATTCAATAAATCCACATTGG + Intronic
908034228 1:60034620-60034642 CTCATTCAGCAATGTCACAGTGG - Intronic
909018025 1:70400617-70400639 CACATTCAGTGATATCACATTGG + Intergenic
909859665 1:80588898-80588920 AACATTCAGCAGCTTAACAGTGG + Intergenic
911419808 1:97626564-97626586 CACATTCAGAAACTATAGATGGG - Intronic
913976187 1:143458322-143458344 CAAATTCAGTAAATTCAGATGGG + Intergenic
914070583 1:144283942-144283964 CAAATTCAGTAAATTCAGATGGG + Intergenic
914108572 1:144682412-144682434 CAAATTCAGTAAATTCAGATGGG - Intergenic
914689937 1:150016807-150016829 CTTGTTCAGCAACATCACATTGG - Intergenic
916712285 1:167422358-167422380 AACATTCAGTAACTTGACAGAGG - Exonic
917160658 1:172053587-172053609 CACAGTGACCAACTCCACATAGG + Intronic
918126328 1:181587386-181587408 CACATTCAGCCACTGAATATGGG + Intronic
918639036 1:186816027-186816049 CACCCTGAGAAACTTCACATAGG - Intergenic
919127582 1:193414647-193414669 CACGTTCAGTGACATCACATTGG + Intergenic
920081834 1:203380302-203380324 CACACTCAGTGACTTCACTTTGG - Intergenic
924295474 1:242582755-242582777 CACATTCAGTGACTTTGCATTGG - Intergenic
924833163 1:247619653-247619675 AAAATTCAGCAACTTCAGTTTGG - Intergenic
1064778944 10:18811731-18811753 CACAAACAGCCAATTCACATAGG + Intergenic
1067312517 10:45127396-45127418 CACATTCATCCGCTTCACCTTGG + Intergenic
1070636433 10:78132017-78132039 CACATTCAGTGATATCACATTGG - Intergenic
1070965755 10:80529340-80529362 CACTGTCAGCAACTTCTCACAGG + Exonic
1072004326 10:91228798-91228820 CACCATCAGCAACATCACCTGGG + Intronic
1072804056 10:98413164-98413186 CACATTGAGCAACCTCATCTTGG + Intronic
1074292098 10:112145422-112145444 CACACTCAGCAACTTAGCATAGG - Intergenic
1075063790 10:119275179-119275201 CACAGTCAGGAACTTCACTCTGG - Intronic
1079500064 11:21093143-21093165 CACAGTCAGTGATTTCACATTGG - Intronic
1081200459 11:40208845-40208867 CACATTCACCGACTTCAACTCGG + Intronic
1083321223 11:61848232-61848254 CACGTGCAGCATGTTCACATCGG - Exonic
1085276775 11:75305486-75305508 CACATTCAGTGACTTCACACTGG + Intronic
1087722762 11:101685324-101685346 CACTTTCAGAAACTTGACTTTGG + Intronic
1088581222 11:111318722-111318744 CAAATTCAGGAAGTTGACATTGG + Intergenic
1090256131 11:125285936-125285958 CACATTCAGCAACTTCACATTGG + Intronic
1090699614 11:129281817-129281839 CACATTCAGTTATTTAACATTGG - Intergenic
1093668217 12:21839853-21839875 CTCATTCAGAATTTTCACATGGG + Intronic
1093869375 12:24269452-24269474 CAAAATAAGAAACTTCACATAGG - Intergenic
1094585540 12:31774237-31774259 CAGATGCAGCAACTTCAGGTAGG - Intergenic
1098245807 12:68516570-68516592 CACATTCAATAACATCACATTGG + Intergenic
1099000072 12:77168970-77168992 CACCTCCACCTACTTCACATTGG - Intergenic
1099648852 12:85397926-85397948 CACATTCTGCAATTTGAAATAGG - Intergenic
1100454548 12:94739857-94739879 CACATTCAGAAACTGCTAATGGG + Intergenic
1101377387 12:104182934-104182956 CCCATTAAGCCACTTCAAATAGG + Intergenic
1101844973 12:108356015-108356037 CACATGCAACAACTTCTTATAGG + Intergenic
1103249718 12:119489092-119489114 CACATTCAGTGACATCACATGGG + Intronic
1104269702 12:127272136-127272158 CACACTCTGCATCCTCACATAGG - Intergenic
1105223055 13:18351443-18351465 CAAATTCAGTAAATTCAGATGGG - Intergenic
1106918000 13:34536020-34536042 CTTACTCAGCAACTACACATTGG + Intergenic
1107312237 13:39091674-39091696 CTCAATAAACAACTTCACATAGG + Intergenic
1108060305 13:46526390-46526412 CACATCCAGCGTCTTCCCATGGG + Intergenic
1111837528 13:93407090-93407112 CACATAAAGAAACTTAACATTGG - Intronic
1112023430 13:95391669-95391691 CACAGTCATAAACTTTACATGGG + Intergenic
1112139157 13:96619039-96619061 AATCTTAAGCAACTTCACATTGG - Intronic
1112961439 13:105132210-105132232 GACATGCAGGACCTTCACATTGG - Intergenic
1113035551 13:106044050-106044072 TAAATTCAGAAACTTAACATGGG + Intergenic
1116538765 14:46070224-46070246 CAAATTCAGCAAATTAATATTGG - Intergenic
1116660397 14:47702820-47702842 CATTTTCAGCAACTTCTCAGTGG + Intergenic
1117053055 14:51881425-51881447 CAGATGTAGCAACTTTACATGGG - Intronic
1118671273 14:68130325-68130347 CACATTAAGCAGATTCACAGAGG - Intronic
1118732744 14:68680285-68680307 CACAGTCAGTAACATCACATTGG - Intronic
1119037439 14:71242220-71242242 CAGATTCAGGGACTACACATTGG + Intergenic
1122187487 14:100012085-100012107 TACATTCAGCAACTTCATAATGG + Intronic
1130615678 15:85405072-85405094 CACATTAAGAAACTTCACAATGG - Intronic
1130803243 15:87289637-87289659 CACAAGCAACAACTTCACCTAGG - Intergenic
1130942369 15:88522010-88522032 CACATTGAGTAATGTCACATTGG - Intronic
1132920746 16:2390197-2390219 CACATTCAGTAATTTCACTCTGG - Intergenic
1137947132 16:52744397-52744419 CACATTCAGTGACATCACATTGG - Intergenic
1143054548 17:4153136-4153158 CAGATTGAACAACTCCACATAGG + Intronic
1143452787 17:7045902-7045924 AACATTCAGCAACTTAAGTTTGG + Intergenic
1146838847 17:36135510-36135532 TTCACTCAGCAACTTGACATTGG + Intergenic
1147316451 17:39623170-39623192 CCCATTCAGTAAATTCACATTGG - Intergenic
1148830435 17:50427187-50427209 CACTTTCAGCAACATCAGATGGG + Intronic
1149699389 17:58642806-58642828 CAGTTTCTCCAACTTCACATGGG + Intronic
1151089560 17:71422140-71422162 CACATTAAGGAACTTCTCTTTGG - Intergenic
1153431876 18:5026424-5026446 TGCACTCAGGAACTTCACATTGG - Intergenic
1157167088 18:45367655-45367677 CAATTTCAGTAACCTCACATTGG + Intronic
1157541955 18:48517088-48517110 CACATTCAGGATCTTCCCCTGGG + Intergenic
1160044298 18:75372472-75372494 CACACTCAACAACTTCACCAGGG + Intergenic
1160065432 18:75569846-75569868 CACGTTCAGCGACATCACGTTGG - Intergenic
1167099981 19:47398855-47398877 CACATTCAGCAACAGGACACGGG + Intergenic
1168534530 19:57158055-57158077 CTCACTCAACAACTTCTCATTGG + Intronic
1168566345 19:57427419-57427441 CACTTTCAGCAACTTAACTCTGG - Intronic
925469533 2:4143971-4143993 TTCATTCAGCAACTACCCATTGG - Intergenic
926965733 2:18408564-18408586 CACATTCAGTAATGTCACATTGG + Intergenic
931285197 2:60826228-60826250 CACATTCAGTGATGTCACATTGG - Intergenic
932337674 2:70940166-70940188 GACATCCAGCAACTCCACCTGGG - Exonic
934180885 2:89619313-89619335 CAAATTCAGTAAATTCAGATGGG + Intergenic
934291185 2:91693549-91693571 CAAATTCAGTAAATTCAGATGGG + Intergenic
934851095 2:97701705-97701727 GATATTCAGCTCCTTCACATTGG + Intergenic
935845332 2:107159957-107159979 CACCTTCAGCATCATCACCTGGG - Intergenic
935979819 2:108615642-108615664 CACATTCAGCAATTTCCCAAAGG - Intronic
936869365 2:117115881-117115903 CACATTCATCAAATTCACCCAGG - Intergenic
938139239 2:128782856-128782878 GAGATTCAGCAAGTTCAAATGGG + Intergenic
939046331 2:137254721-137254743 CATATTGAGCAACTTTGCATGGG - Intronic
939468552 2:142589683-142589705 CACATTCAGCAACTAGAGCTGGG + Intergenic
939471026 2:142620075-142620097 CAAATTCAGCAAATTTACTTAGG + Intergenic
939619129 2:144396639-144396661 CACACCAAACAACTTCACATAGG + Intronic
940341718 2:152588486-152588508 CAAATTAAGGAACTTCAGATGGG + Intronic
943540096 2:189203021-189203043 CAAATTCAGTAACTTTCCATTGG + Intergenic
945834131 2:214819246-214819268 CACATTCAGTGACATCACTTTGG + Intergenic
946093246 2:217249275-217249297 CACATTCAGTGACCTCACATTGG + Intergenic
947723801 2:232384665-232384687 AACATGCAGCACCTCCACATTGG - Intergenic
1169234976 20:3923638-3923660 TACATTCAGCAAGTTCAAACAGG - Exonic
1169390039 20:5183071-5183093 AACAATCAGCAATGTCACATGGG - Exonic
1170809714 20:19664376-19664398 CAGATTCAACAAGTTGACATTGG - Intronic
1173054796 20:39601046-39601068 CACTTTCAGTATCATCACATGGG + Intergenic
1176731603 21:10503861-10503883 CAAATTCAGTAAATTCAGATGGG - Intergenic
1177077284 21:16592618-16592640 CGCATTGAGCAAGCTCACATCGG - Intergenic
1177155739 21:17499713-17499735 CAAATTCTGCAACTTCAACTTGG - Intergenic
1177158315 21:17521259-17521281 AACATTCAGAAAGTTCCCATGGG + Intronic
1178408377 21:32344651-32344673 CACGATCAGCCACTTCACACAGG + Exonic
1178484277 21:33007459-33007481 CACATTCAGCAACTTGAAATTGG - Intergenic
1179490579 21:41738831-41738853 CACATTCAGGAAATTAACATTGG - Intergenic
1181907403 22:26210191-26210213 CACATACCACATCTTCACATTGG + Intronic
1182541388 22:31044589-31044611 CACATTCACCAGCTCCACTTCGG - Intergenic
949489885 3:4578993-4579015 CAAAATCAGCAATATCACATGGG - Intronic
949728913 3:7084278-7084300 CAGCTACAGCAACATCACATGGG + Intronic
949760311 3:7463281-7463303 AGCATTCACCAACTTCAGATGGG + Intronic
949850593 3:8416547-8416569 CACATGCACCCACTTTACATAGG - Intergenic
951779978 3:26351831-26351853 CACATGCAGCCACATCTCATAGG + Intergenic
952956044 3:38557922-38557944 TCCATTGAGTAACTTCACATTGG - Intronic
953119330 3:40024460-40024482 GACAGTCAGCAACTTCAGGTAGG + Intronic
955635745 3:61027490-61027512 CACTTGCAGTAAATTCACATTGG + Intronic
955859552 3:63313042-63313064 CACAAACAGCAACTTCATAAGGG + Intronic
956106597 3:65825413-65825435 CGCATTCAGTGACTTCATATTGG + Intronic
956476674 3:69628712-69628734 CATATTCAGCAACTAGACAATGG + Intergenic
957319024 3:78605411-78605433 CACATTCAGTGACTTGAAATTGG + Intronic
957592854 3:82223685-82223707 CATAGTCATCAACTTCACCTAGG - Intergenic
959348923 3:105235804-105235826 CACACAAAGCAACTCCACATTGG + Intergenic
959927468 3:111939585-111939607 GATATTCAGCAACTTCACGCAGG - Exonic
960173714 3:114492821-114492843 CACAATCAGGAAATTAACATTGG + Intronic
960275126 3:115720470-115720492 CACATACAGGATCTTCACATAGG - Intronic
963497138 3:146079684-146079706 CATGTTCAGTAATTTCACATTGG + Intronic
964365630 3:155948344-155948366 CACGTTCAGCTTCTTCACTTAGG + Intergenic
966444809 3:179990246-179990268 CGCATTTAGAAATTTCACATAGG + Intronic
967839345 3:193992276-193992298 CACGTTCAGTGACATCACATTGG + Intergenic
969758180 4:9163719-9163741 CACAATCATCATTTTCACATAGG + Intergenic
971416974 4:26440664-26440686 TACATACAGCAACTTCGCCTTGG - Intergenic
972730995 4:41795101-41795123 CACACTCAGTAACCACACATAGG - Intergenic
975758458 4:77594662-77594684 CACATTCAACAACCTCATTTTGG + Intronic
975847521 4:78540727-78540749 CAGATTCAGGGACTTCATATTGG - Intronic
975871375 4:78782413-78782435 AACATTCAGCTACTTCTCAAAGG + Intronic
975887589 4:78983627-78983649 CAAATTAAGCAATTTCCCATAGG - Intergenic
977659182 4:99563365-99563387 CACCTGCAGCAACTTCCCCTCGG + Exonic
977766057 4:100799046-100799068 CACATCCAGCACCTTCACTCTGG - Intronic
983434089 4:167689533-167689555 CACATTCAGTAATTTGAGATTGG - Intergenic
984267043 4:177507800-177507822 AGCATTCAGTGACTTCACATTGG + Intergenic
984379237 4:178969193-178969215 CATCTTCATCATCTTCACATCGG + Intergenic
984941294 4:184934637-184934659 TACATACAGCAACTTCTCAAGGG + Intergenic
987204865 5:15614607-15614629 CACACTTAGCAGCTTAACATAGG + Intronic
988346240 5:30041693-30041715 CACAGACAGCATCTTCACAGTGG - Intergenic
989110344 5:37901358-37901380 CACATTCTGTGACATCACATCGG - Intergenic
989982059 5:50656815-50656837 CACACTCAGGGATTTCACATTGG - Intergenic
990698424 5:58448798-58448820 CACATTCAGCGACATCACTCTGG + Intergenic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
990810675 5:59719286-59719308 CACATTCAGGGCCATCACATTGG - Intronic
991211876 5:64115323-64115345 CACGTTCAGTGACATCACATTGG - Intergenic
992789295 5:80199091-80199113 CACATTCAAACACTTCACCTTGG + Intronic
993489286 5:88526461-88526483 CACAGTCAGTGACATCACATGGG - Intergenic
998495962 5:142589661-142589683 CACATTCAGCAGCTAAACATTGG - Intergenic
998649655 5:144103814-144103836 CACAATCAGAAACTGCACGTAGG - Intergenic
1001447907 5:171800592-171800614 AACATTGTGCAACTTCACTTCGG + Intergenic
1004059902 6:12183842-12183864 AAACTTCAGTAACTTCACATGGG - Intergenic
1004823767 6:19398629-19398651 AACATTCAGCCAATTCACATAGG + Intergenic
1009523852 6:64718534-64718556 AACATTCAACAACTTCATAAGGG - Intronic
1010302327 6:74275521-74275543 CAGATTCAGCCTCTTCACCTTGG + Intergenic
1011741562 6:90365752-90365774 AACATTCAGCCACTGAACATGGG - Intergenic
1012898980 6:104985063-104985085 CACATTCAGTGATTTCACACTGG - Intronic
1013243499 6:108267350-108267372 CACATTAATCAAGTTCACAAGGG - Intergenic
1015646726 6:135399466-135399488 CAAATTCAGCAGATTCACTTAGG + Intronic
1016755191 6:147677299-147677321 CTCATTCAGGAACTTCAGAGTGG - Intronic
1016997827 6:149973236-149973258 CACATACTGCATCTTCCCATTGG + Exonic
1017202301 6:151768553-151768575 CAAAGTCAGGAAATTCACATAGG - Intronic
1017235571 6:152114122-152114144 CCCATTCAACAGCTTCACACAGG - Intronic
1018215771 6:161526179-161526201 CATGTTCAGCAACTTCATGTTGG - Intronic
1018457392 6:163964263-163964285 ACCCTTCAGCAACTTCTCATTGG - Intergenic
1020697206 7:11427909-11427931 TAAAATCAGCAACTTCACTTGGG + Intronic
1023506919 7:40909437-40909459 CACCTTCAGGAACTAAACATTGG - Intergenic
1023827637 7:44020048-44020070 CACATCCACCAACTGCACTTTGG - Intergenic
1027989629 7:85341164-85341186 CACATACAGAATCTTCAGATTGG + Intergenic
1028247302 7:88495917-88495939 GAAATTCAGCAACTTCATACCGG - Intergenic
1033638814 7:143240384-143240406 CACATTCAGTGACATCACACTGG - Intergenic
1033928752 7:146496948-146496970 GAAATTCAGAAACTTCCCATTGG + Intronic
1034103910 7:148474459-148474481 CACATTCATCCACTTGACAAAGG - Intergenic
1034597991 7:152217622-152217644 CAAATTCAGTAAATTCAGATGGG + Intronic
1034889602 7:154828121-154828143 TACATTCAGGAAATTCACACAGG - Intronic
1036922113 8:12866661-12866683 CACTTTCAGTGACTTCACGTTGG + Intergenic
1038189625 8:25308104-25308126 CACTATAAGCAACTGCACATCGG - Intronic
1038276958 8:26129395-26129417 TACATTCACCAACATCACACAGG + Intergenic
1038505348 8:28079686-28079708 CACATTCAGCAGCCTCTAATAGG + Intronic
1039181498 8:34871834-34871856 CATAATCATCAACTTCAAATGGG + Intergenic
1042425953 8:68649048-68649070 TATATTCAGCAGCTTCCCATGGG + Intronic
1047721828 8:127647892-127647914 CACAGTCAGGAAATTGACATTGG - Intergenic
1048184319 8:132225627-132225649 CAATTTCAGTCACTTCACATGGG + Intronic
1048289297 8:133168136-133168158 CACTTTCAGAAACTTAAAATGGG - Intergenic
1048679693 8:136826552-136826574 CATATTCAGTGACGTCACATGGG + Intergenic
1050095198 9:2057474-2057496 CCCATTCAAAAACTTCCCATGGG - Intronic
1050158173 9:2689898-2689920 CATTTTCAGCATCTTCACAGTGG - Intergenic
1050835133 9:10067915-10067937 CAGGTTCAGTAACATCACATGGG - Intronic
1051730203 9:20133870-20133892 CATATTCAGATACTTCTCATAGG - Intergenic
1053566642 9:39259275-39259297 AAAATTCACCAAGTTCACATTGG + Intronic
1053832421 9:42097133-42097155 AAAATTCACCAAGTTCACATTGG + Intronic
1054130502 9:61359729-61359751 AAAATTCACCAAGTTCACATTGG - Intergenic
1056989194 9:91394106-91394128 CACATTAAACCACTTCACATTGG + Intergenic
1057391287 9:94643289-94643311 CACATACTCCAACTTCACATGGG + Intergenic
1057418563 9:94888456-94888478 CAAAACCAGCAAATTCACATTGG + Intronic
1058190976 9:101915223-101915245 CACAATCAGGAAATTGACATTGG + Intergenic
1059366619 9:113791383-113791405 TACATTCACCAACTTGACATAGG - Intergenic
1061713985 9:132507259-132507281 CTCATTCAGCAACTCCACGAAGG - Intronic
1061758594 9:132833857-132833879 CGCAATTAGCAACTTCACATGGG + Intronic
1189680981 X:43515627-43515649 CACTTTCAGCAACATCACTTTGG + Intergenic
1192733905 X:73830081-73830103 CACAATAAGAAAATTCACATAGG + Intergenic
1194353517 X:92852707-92852729 TTCATTCTGTAACTTCACATGGG + Intergenic
1198777345 X:140194311-140194333 CACATTCAGTGAGGTCACATTGG + Intergenic
1200661878 Y:5969780-5969802 TTCATTCTGTAACTTCACATGGG + Intergenic
1201063810 Y:10070324-10070346 CTCCTTCTGCCACTTCACATCGG - Intergenic
1201543017 Y:15129871-15129893 CATCTTCAGCAACTTCATTTAGG + Intergenic