ID: 1090259204

View in Genome Browser
Species Human (GRCh38)
Location 11:125306478-125306500
Sequence CTGGTAGTACCAGCCTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090259204_1090259207 26 Left 1090259204 11:125306478-125306500 CCATCAAAGGCTGGTACTACCAG 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1090259207 11:125306527-125306549 CCACCATAAAACCCTTAATGTGG 0: 1
1: 0
2: 1
3: 12
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090259204 Original CRISPR CTGGTAGTACCAGCCTTTGA TGG (reversed) Intronic
903930410 1:26858891-26858913 CTGGTAATAATAGGCTTTGAAGG - Intergenic
907000998 1:50856156-50856178 CTGGGAGTACAAGTCTTTAATGG - Intronic
907109629 1:51915015-51915037 CTGGTAGTACCAGGCTCCCAAGG - Exonic
912262947 1:108127217-108127239 CTTGTAGTCCCAGCTATTGAGGG - Intergenic
915993099 1:160537151-160537173 CTGGTGGGATCAGGCTTTGATGG + Intergenic
916013599 1:160728484-160728506 CTGGTAATACCAACATTTAAGGG + Intergenic
917404737 1:174693301-174693323 CAGGTCATACCAGCTTTTGACGG + Intronic
1064632103 10:17327111-17327133 CTGCTAGTCCCAGCCTTTTGTGG - Exonic
1064980701 10:21163634-21163656 TTGGTTGCACCTGCCTTTGATGG + Intronic
1066500007 10:35983812-35983834 TCGGTGGGACCAGCCTTTGATGG + Intergenic
1066951619 10:42124066-42124088 CTTGTAATACCAGCAGTTGAGGG + Intergenic
1069400739 10:68042834-68042856 CTGATATTACCAGCTTTTAAAGG - Intronic
1072679363 10:97495246-97495268 CAGGTAGTGGCAGGCTTTGAAGG + Intronic
1072860433 10:98998458-98998480 CTGGTAGTATCTGCCTAAGAAGG + Intronic
1073572921 10:104596157-104596179 TTAGTAGTGTCAGCCTTTGAGGG - Intergenic
1074048178 10:109858290-109858312 CTGGTAGGATTAGCCTATGATGG - Intergenic
1084837349 11:71812705-71812727 ATGGTAGTACCAGTCTTTGCTGG - Intergenic
1085376655 11:76068794-76068816 CAGGTATTTCCAGCTTTTGAAGG + Intronic
1089931059 11:122312590-122312612 ATGGTAGCACCATCTTTTGAAGG + Intergenic
1090259204 11:125306478-125306500 CTGGTAGTACCAGCCTTTGATGG - Intronic
1093870247 12:24282699-24282721 CTAATAGTACCATCCTTCGAGGG - Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1103107156 12:118238995-118239017 TTGGTAGTACCTGCCCTGGATGG + Intronic
1107204070 13:37760564-37760586 CTTGTAATAAGAGCCTTTGATGG - Intronic
1110220928 13:73072392-73072414 CTGGCAGTGCCAGCCTCTGTGGG - Intronic
1117334413 14:54744695-54744717 CTGGGAGTAGCAGACTTTCAGGG - Intronic
1120578506 14:86216025-86216047 CTGGTATTACCAACCTTGTATGG - Intergenic
1125875148 15:43137728-43137750 CTGGTATGACCAGCCTTCCATGG - Intronic
1130168761 15:81489817-81489839 CTGTTAGTGCCAGGCTTAGAAGG - Intergenic
1132827268 16:1911620-1911642 CTGGTAGAACCTGCGGTTGAAGG + Exonic
1132983200 16:2749727-2749749 CGGGAAGGACCAGCCTTGGAAGG + Intergenic
1136223713 16:28844994-28845016 CTGGTGGTAGCAGCCAATGACGG - Exonic
1147293682 17:39463315-39463337 CTGGAAGTACCTACCTTTGGCGG - Intronic
1148521886 17:48284773-48284795 CTGGGAGGACCTGCCTTTCAGGG + Intronic
1151151157 17:72088480-72088502 ATGGTAGCAGCAGCATTTGACGG + Intergenic
1157775476 18:50392490-50392512 CTTGTAGTCCCAGCCATTCAGGG - Exonic
1157941301 18:51931683-51931705 CTGGAGGTTCCAGCCTATGAGGG + Intergenic
1158132846 18:54172015-54172037 CTATTATTATCAGCCTTTGATGG - Intronic
1160037890 18:75318403-75318425 CTGTTAGTAGGAGCCATTGAGGG - Intergenic
1163244555 19:16085127-16085149 CTGGTAGTCCCAGCCACTCAAGG + Intronic
939549417 2:143595584-143595606 CAGGTAGTACTAGGCTCTGAGGG - Intronic
942465696 2:176205214-176205236 CAGGAAGAAACAGCCTTTGAAGG + Intergenic
942506088 2:176642951-176642973 CAGGCAGTACCAGGCTTTGGTGG + Intergenic
1168920989 20:1536165-1536187 CTGGTTGTTACAGCCTTTTAGGG - Intronic
1172035434 20:32007476-32007498 ATGGCAGTACCTGCCTTGGAAGG - Intergenic
1173924837 20:46773136-46773158 CTGGGAGTCCCTCCCTTTGATGG + Intergenic
1179555015 21:42167650-42167672 ATGGTAGGCCAAGCCTTTGATGG + Intergenic
1181692094 22:24568965-24568987 CTGGTAATCCCAGCATTTCAGGG - Intronic
1182477549 22:30584422-30584444 CTGGTAGTAAATGCCTTTGATGG + Exonic
1182725585 22:32442607-32442629 CAGGCAGTACCAGCTTTTGAAGG + Intronic
1182964884 22:34511548-34511570 CTGGTAGTACCATCATTTCCTGG + Intergenic
1183235277 22:36612136-36612158 CTGGAAGAACCAGCCTGTGTGGG + Intronic
951623985 3:24639880-24639902 CTGGTAGTAGCAGCCAGCGAAGG - Intergenic
953956703 3:47236994-47237016 CTTGTAGTACTAGCCAGTGATGG - Intronic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
966189828 3:177262105-177262127 CTGGTGGTACCACCTGTTGATGG + Intergenic
967878026 3:194280025-194280047 GTGGAAGTCCCAGCCTTCGAGGG + Intergenic
968044691 3:195617419-195617441 CTGGTAATCCCAGTCTTGGAAGG - Intergenic
968060478 3:195723470-195723492 CTGGTAATCCCAGTCTTGGAAGG - Intronic
980550363 4:134327616-134327638 CTGGTAGTAAATGCGTTTGATGG - Intergenic
983018897 4:162649983-162650005 CTGGTATTAATTGCCTTTGAAGG + Intergenic
988085542 5:26470616-26470638 CTGGTAGTCCTAGCCATAGAGGG + Intergenic
988903082 5:35754953-35754975 CTGGTACTTCCAGCCTTCAAAGG + Intronic
992162063 5:74013619-74013641 CTGTTGATTCCAGCCTTTGAGGG + Intergenic
994921806 5:106054833-106054855 CTGGCAGTAATAGCATTTGAAGG + Intergenic
1001155044 5:169265399-169265421 CTCTTAGTACCAGCTTATGATGG - Intronic
1001595339 5:172895289-172895311 ATGGTAGTACCTGCCTTATAGGG - Intronic
1001964969 5:175903630-175903652 CTGGGAGTTCCAGCCTTACATGG - Intergenic
1002251987 5:177935558-177935580 CTGGGAGTTCCAGCCTTACATGG + Intergenic
1009991118 6:70843904-70843926 GAGGTAGTACAGGCCTTTGAAGG + Intronic
1011327718 6:86168699-86168721 CTGTTAATACCAGCATTTTAAGG - Intergenic
1017769591 6:157634856-157634878 CTGGAATGACCAGGCTTTGAGGG - Intronic
1019131802 6:169882410-169882432 CTTGTAGCACGAGCCTTTGAGGG - Intergenic
1019927376 7:4202304-4202326 CTGGTGGGACCAGCCCTTGGAGG - Intronic
1028711123 7:93909671-93909693 CTGCAAGTATCATCCTTTGAAGG + Intronic
1030020676 7:105272585-105272607 CAGGTATTACCAGCATTTAAGGG - Intronic
1032326456 7:130933519-130933541 ATGGTAATGCCAGCCTTTCAGGG + Intergenic
1033361886 7:140643683-140643705 CGTGTAGCACCAGCCTTGGAGGG - Intronic
1034890298 7:154833465-154833487 ATAGTAGTACCAGCCTTGTACGG + Intronic
1037097405 8:15001932-15001954 CTGATGATACCAGCTTTTGAGGG + Intronic
1038248672 8:25882424-25882446 CTGGCTGTACCAGCTTGTGAAGG + Intronic
1039901903 8:41758684-41758706 CAGGAAGAATCAGCCTTTGAGGG + Intronic
1044980068 8:97707787-97707809 CTGGTAGTCCCAGCTATTCAGGG + Intronic
1048505573 8:135017970-135017992 CTGTAAGTACTAGCCTTTGCAGG - Intergenic
1049608083 8:143538957-143538979 CTGGCAGAGCCAGACTTTGATGG + Exonic
1051141764 9:13986710-13986732 CTGGTAGTAAATGCCTTTGATGG - Intergenic
1053112208 9:35471096-35471118 GTGGTAGTACGAGCCTGTGCTGG - Intergenic
1060294402 9:122333425-122333447 CTGGAAGTCCCTGCCCTTGAGGG - Intergenic
1060676749 9:125522199-125522221 ATGGTTGGACCAGCCTTTGCAGG + Intronic
1061809557 9:133154421-133154443 ATGCTAGTACCAGCCTCTTACGG + Intronic
1187502852 X:19854057-19854079 CTGGTATTAGCAGCCTTTGGAGG + Intronic
1189117586 X:38358966-38358988 CTGGTCATACCAGCATCTGAGGG - Intronic
1190189893 X:48268434-48268456 CTGGTTCTCCCAGCCTTAGAAGG + Intronic
1192435107 X:71138226-71138248 CTGGTAGTCCCAGCACTTGGGGG + Intronic
1194791840 X:98160173-98160195 CTGGTAGTACCAGCCTGGGGTGG + Intergenic
1194969249 X:100324879-100324901 CTGGTAGTACCTGCCTTGTGGGG - Intronic
1196354352 X:114772650-114772672 CTGGAATTACTAGCCTTTGTTGG - Intronic
1199810576 X:151344779-151344801 CTGGAAGGTCCAGCCTTTGATGG + Intergenic