ID: 1090259965

View in Genome Browser
Species Human (GRCh38)
Location 11:125312475-125312497
Sequence CTGCTCTCCTGGGGCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090259965_1090259973 16 Left 1090259965 11:125312475-125312497 CCTGCTGTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 5
3: 47
4: 398
Right 1090259973 11:125312514-125312536 ATCAGGAATATTCCATAAGGTGG 0: 1
1: 0
2: 0
3: 13
4: 135
1090259965_1090259974 23 Left 1090259965 11:125312475-125312497 CCTGCTGTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 5
3: 47
4: 398
Right 1090259974 11:125312521-125312543 ATATTCCATAAGGTGGTGTGTGG 0: 1
1: 0
2: 1
3: 9
4: 142
1090259965_1090259972 13 Left 1090259965 11:125312475-125312497 CCTGCTGTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 5
3: 47
4: 398
Right 1090259972 11:125312511-125312533 TGAATCAGGAATATTCCATAAGG 0: 1
1: 0
2: 1
3: 14
4: 243
1090259965_1090259971 -1 Left 1090259965 11:125312475-125312497 CCTGCTGTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 5
3: 47
4: 398
Right 1090259971 11:125312497-125312519 GACAGGCTGTGAGGTGAATCAGG 0: 1
1: 0
2: 2
3: 19
4: 194
1090259965_1090259970 -10 Left 1090259965 11:125312475-125312497 CCTGCTGTGCCCCAGGAGAGCAG 0: 1
1: 0
2: 5
3: 47
4: 398
Right 1090259970 11:125312488-125312510 AGGAGAGCAGACAGGCTGTGAGG 0: 1
1: 1
2: 3
3: 55
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090259965 Original CRISPR CTGCTCTCCTGGGGCACAGC AGG (reversed) Intronic
900159224 1:1215652-1215674 CTGCTCTCCTGGGGCCTAAGTGG + Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900661797 1:3788367-3788389 CTCCTCTCTGGGGGCAGAGCCGG - Intronic
900893302 1:5465240-5465262 CTGCTCTCCTGGAGTGCAGCTGG + Intergenic
901195331 1:7437011-7437033 CAGCCCCTCTGGGGCACAGCTGG + Intronic
901203768 1:7482411-7482433 TTGTGCTCGTGGGGCACAGCTGG - Intronic
901207697 1:7506225-7506247 CTGCTCTCCTTTGCCACACCTGG - Intronic
901632187 1:10653369-10653391 CTGCTCACCTGGGTCAAAGGTGG + Exonic
901764166 1:11489407-11489429 CAGCTTTGCTGGGACACAGCAGG - Intronic
901953869 1:12770251-12770273 CTGTGCTCCTGGGGCACGGTGGG + Intergenic
902379683 1:16046842-16046864 CTGCTTTCCAGGGGCTCCGCTGG + Intronic
902406878 1:16189192-16189214 CTGCTTGGGTGGGGCACAGCGGG - Intergenic
902642623 1:17776432-17776454 CTGTACACCAGGGGCACAGCGGG - Intronic
903602917 1:24555597-24555619 CTGGGCTCCTGGGATACAGCTGG + Intergenic
903642355 1:24868632-24868654 CTGATCTCCTGGGGCTCTGGTGG - Intergenic
904445148 1:30566409-30566431 ATGCTCTCCAGGGGCCCGGCTGG - Intergenic
906390925 1:45415384-45415406 GTGCTCTCCTGAGCCACAGAAGG - Intronic
906611912 1:47209471-47209493 CTGGGCTCCTGCGGCTCAGCTGG + Intergenic
906778735 1:48553221-48553243 CTGCTGAGCTGGGGCCCAGCTGG - Intronic
907320583 1:53599715-53599737 ATGGTCTCCTGGGGCAGAGATGG + Intronic
907321633 1:53606371-53606393 GAGCACTCCTGGGGCACAGAGGG - Intronic
907526819 1:55058568-55058590 CTCCTCATCTGGGGCGCAGCGGG - Exonic
910237244 1:85048388-85048410 GGGCTCACCTGGGGGACAGCGGG + Exonic
911065763 1:93786450-93786472 CTGCTCTCCATGGTCTCAGCTGG - Intronic
911239382 1:95448891-95448913 CTACTCTACTGTGGCCCAGCTGG + Intergenic
911735864 1:101335880-101335902 CTGATCACTTGGGGCACAGAGGG - Intergenic
914676059 1:149908395-149908417 CTGCGCTCCTGGGGGACTTCAGG + Intronic
915165382 1:153945477-153945499 CTGTTCTCTGGGGGAACAGCAGG - Intronic
915419217 1:155766234-155766256 CTGGCCTCAGGGGGCACAGCAGG + Exonic
916219665 1:162431384-162431406 CTGCTCCCCTGGGGCTCAGTGGG - Intergenic
916486045 1:165259588-165259610 CTGCTCTCTTGGTGGACAGGAGG - Intronic
917790689 1:178496899-178496921 CTGCTCTCCTTCTGCGCAGCAGG - Intergenic
918339447 1:183555929-183555951 ATGATTTCCTGGGGCACAGTGGG - Exonic
918435861 1:184512144-184512166 CTGCCCTCCTTGCTCACAGCAGG + Intronic
919741553 1:200984128-200984150 CCCCTTTCCTGAGGCACAGCAGG + Intronic
919856537 1:201709893-201709915 CAGCTCTCCAGAGACACAGCAGG + Intronic
920210896 1:204327500-204327522 GCGCTCTCCTGGGCCTCAGCGGG - Intronic
921295165 1:213694478-213694500 CTGATATCCTGGGGTTCAGCAGG + Intergenic
923071688 1:230570986-230571008 TTGTTCTCTTGGGGCACATCGGG + Intergenic
1062772739 10:115963-115985 CTGCCTACCTTGGGCACAGCAGG + Intergenic
1063144768 10:3287053-3287075 CTGCTATAGGGGGGCACAGCAGG - Intergenic
1063441386 10:6075921-6075943 GTGCTGTCCTGGTGCACAGGTGG - Intergenic
1064945871 10:20789064-20789086 TTGCTCTCCTGGAGCACCGAGGG + Intronic
1065088701 10:22207595-22207617 CTGCTGGCCTGGAGCTCAGCTGG + Intergenic
1065468566 10:26052521-26052543 CTAATCTCCTAGGGCACACCAGG + Intronic
1065796485 10:29312792-29312814 CTGTTCTGCTGGGGCAGAGCTGG + Intronic
1066209610 10:33224025-33224047 CTGCACTCCTGGAGCAAAGTGGG + Intronic
1066443318 10:35459323-35459345 CTGCACTCCTGGGCCACATGCGG - Intronic
1067012199 10:42724759-42724781 CTGGCCTCCTGGGGCACCCCTGG + Intergenic
1067311396 10:45117134-45117156 CTGGCCTCCTGGGGCACCCCTGG - Intergenic
1067443856 10:46328339-46328361 CTGTTCTCTTGGGGCTTAGCAGG - Intronic
1069607762 10:69750408-69750430 CTCCTCTCCTGTGGGACAGGGGG + Intergenic
1071284956 10:84136041-84136063 CTCCTCTCCTGGGCCACAACTGG + Intergenic
1073496833 10:103899260-103899282 CTGCTCCTCTGGTGGACAGCAGG + Intronic
1073834598 10:107426485-107426507 CTGCTCCTCTGGGGCCCTGCAGG + Intergenic
1074666422 10:115731236-115731258 CTGCTTTCCTGCCCCACAGCAGG + Intronic
1074752836 10:116603325-116603347 CTGCCATTCTGGGGCAGAGCTGG + Intronic
1075396734 10:122133112-122133134 CTGATCTCCTGGGACAGAGCTGG + Intronic
1075647839 10:124108130-124108152 CTGCTCCTCTGGGCCTCAGCTGG - Intergenic
1076252331 10:128994506-128994528 CTCCAGTCCTGGGGCCCAGCAGG + Intergenic
1076616511 10:131758836-131758858 CTGCTCTCCGGGGCCAGGGCTGG - Intergenic
1076815521 10:132912935-132912957 CTCCTCTGCTGGGACACAGAGGG + Intronic
1076864695 10:133160880-133160902 CTGGCCTCCTGGGGCCCGGCAGG - Intronic
1077387260 11:2275946-2275968 CGGCTCCCCGGGGGGACAGCAGG - Intergenic
1077413473 11:2414031-2414053 CAGCTCTCCTCGAGGACAGCTGG + Intronic
1079017483 11:16881540-16881562 CTGCTCCCCTTGGCCACAGTGGG - Intronic
1081585014 11:44378282-44378304 CTGGTCTGCTGGGGCTCAGCTGG + Intergenic
1081663518 11:44903028-44903050 GTGCCCTCCTGGGACACAGTAGG - Intronic
1084185100 11:67467385-67467407 CTGCTCTCCTGCCACCCAGCTGG - Exonic
1084502887 11:69545353-69545375 CTGCTCACTTTGGGCACAGTGGG - Intergenic
1085266057 11:75238778-75238800 CTCCTTTCCTGGGGGGCAGCAGG + Intergenic
1085299261 11:75448986-75449008 CTGCTCTCATTGGCCACCGCGGG - Exonic
1086500208 11:87445076-87445098 CAGCTCTCAAGGGGCAGAGCTGG + Intergenic
1087356334 11:97098445-97098467 CTGACCTCCTGGGGCTGAGCAGG + Intergenic
1089183988 11:116602562-116602584 CTGTTCTCCTGGGACCCAGCTGG + Intergenic
1089354388 11:117840353-117840375 CTCATCTCCTGGGGCCCTGCAGG + Exonic
1089665257 11:120014037-120014059 CTGGAAACCTGGGGCACAGCTGG - Intergenic
1089857098 11:121555454-121555476 CTCCTCTCCAGAGGCTCAGCTGG - Intronic
1090164923 11:124536585-124536607 CTGCACTACTGTGGCCCAGCAGG + Intergenic
1090259965 11:125312475-125312497 CTGCTCTCCTGGGGCACAGCAGG - Intronic
1090550434 11:127813776-127813798 CTGCTCCCATGGGGCAGGGCAGG - Intergenic
1090598288 11:128342921-128342943 CTTGTCACCTGGGGCACAGAGGG - Intergenic
1091157085 11:133383984-133384006 ACACTCTCCTGGGGCACTGCCGG - Intronic
1091360907 11:134977914-134977936 CAGATGGCCTGGGGCACAGCAGG - Intergenic
1092350606 12:7752635-7752657 CTGCACTCCTGGGTGACAGAGGG + Intergenic
1093339505 12:17954952-17954974 CTTCTCTCCTGTTGCTCAGCAGG + Intergenic
1096061996 12:48709220-48709242 CTGCACTCCTGGGCAACAGAGGG + Intronic
1097977262 12:65700397-65700419 CTACTGTACTGTGGCACAGCAGG - Intergenic
1098226067 12:68326171-68326193 CTGCTCTCTTATGTCACAGCTGG - Intronic
1098490002 12:71064516-71064538 CTGCTCTCCTGGAGCACTGGGGG - Intronic
1101984557 12:109435622-109435644 GTGTTCACCTGGCGCACAGCAGG - Intronic
1102248153 12:111368254-111368276 AAGATCTCCAGGGGCACAGCTGG + Intronic
1103716709 12:122949442-122949464 CTGCTCCCATGGGGGTCAGCAGG - Intronic
1104704593 12:130933808-130933830 CTGCTCTCATGAGTCACAGCAGG + Intergenic
1105255873 13:18743867-18743889 CTCCTTACCTGGGGGACAGCAGG - Intergenic
1105507490 13:21023062-21023084 CTGCCCCCCTGGGGCTCTGCAGG - Intronic
1106400547 13:29425816-29425838 CTTCTCTTCTTGGGCACAGAGGG - Intronic
1106414277 13:29533379-29533401 ATGCACTCCTGGGGTGCAGCTGG + Intronic
1107016647 13:35712707-35712729 CTCCTCACCTGGCCCACAGCAGG + Intergenic
1107686543 13:42906112-42906134 CTGCTCTGCTGGGGAGCTGCAGG + Intronic
1108121522 13:47193156-47193178 GCCCTCTTCTGGGGCACAGCAGG + Intergenic
1110179569 13:72599181-72599203 AGGCTCTCCTTGGACACAGCAGG - Intergenic
1112299507 13:98217390-98217412 CTGCTCTCCTGGGGGGCTTCTGG - Intronic
1113246011 13:108396237-108396259 TGGCTCTCCTGGGGCACATAGGG - Intergenic
1113784515 13:112995508-112995530 CTGCTCTCCTGGGGCAGAAGTGG - Intronic
1113816568 13:113175802-113175824 CTGCTCTCCTAAGTCACACCCGG - Intergenic
1113905715 13:113818284-113818306 GGGCTCTCCTGGGGCCCAGGGGG + Intergenic
1114293773 14:21311074-21311096 CTCCTCTGGTGAGGCACAGCTGG - Intronic
1115985830 14:39103031-39103053 CTCCGCTCCTGGGGGACCGCAGG - Exonic
1116489760 14:45492207-45492229 CTGCTCTACTGTGGCTGAGCTGG + Intergenic
1116817576 14:49598474-49598496 CTGCTCTCCGGAGGCACACCTGG - Intronic
1119771970 14:77225610-77225632 ATGCTTTCCTGGGGTACAGTTGG + Intronic
1121014471 14:90539949-90539971 CTGCACTCATGGGCCACAGAGGG - Exonic
1121081731 14:91114153-91114175 CTGCTCTCCTGCGCCACGGGGGG - Intronic
1121317707 14:92971935-92971957 CTGCCCTCCTGGGACACTGATGG + Intronic
1121734869 14:96211232-96211254 CTGCACTCTTAGAGCACAGCAGG - Intronic
1122010992 14:98746828-98746850 CTGCTATCCTGTGGCATGGCAGG + Intergenic
1122313730 14:100813431-100813453 CTGCTCTCCTGTGGCTCAGCAGG + Intergenic
1122362339 14:101174916-101174938 CTCCTCTGCTGGGCCCCAGCCGG + Intergenic
1122828910 14:104386055-104386077 CTGCTGTCCAGAGGCACCGCTGG + Intergenic
1123448308 15:20345109-20345131 CAGCCCCCCTGGGGCCCAGCCGG - Intergenic
1123908747 15:24945876-24945898 CTGCTTTCCTGTGGGACAGATGG + Intronic
1124222288 15:27861333-27861355 TTTCTCTCCTGGGGCACTGCAGG - Intronic
1125344207 15:38702499-38702521 ATTCTCTCCTGGGGCTCTGCAGG - Intergenic
1125477985 15:40060496-40060518 ATGCTCACCAGGGGCAGAGCAGG + Intergenic
1127805121 15:62512089-62512111 CTGCTGTCCTGGGTCACAGCTGG + Intronic
1128768358 15:70264777-70264799 CTGCACTCCTGGGACACTCCTGG - Intergenic
1129253417 15:74320737-74320759 CTGCGCTCCTGAGACACAGAGGG - Intronic
1129449226 15:75640644-75640666 CGGCTCTCCTGGGGCTGACCTGG + Intronic
1129691351 15:77715431-77715453 CTGCTCTGCTTGGACACTGCTGG - Intronic
1129726121 15:77902692-77902714 CTGCTCTGCTGTGGCACAAGGGG - Intergenic
1130610582 15:85357204-85357226 CTGCGCTCCTGGGCGACAGTGGG + Intergenic
1130991685 15:88879434-88879456 CCTCTCTCCTGGGACTCAGCTGG + Intronic
1131132667 15:89910111-89910133 CTGTTCTCATGGGGTACAGGAGG + Intronic
1131368889 15:91863298-91863320 CTTCTCTCCAGGGGTACAGGAGG + Intronic
1131387762 15:92021364-92021386 TTGCCCTCATGGGGCACAGCAGG - Intronic
1131511685 15:93052568-93052590 CTGCTCCCCTGGCCCACAGATGG - Intronic
1131961258 15:97792412-97792434 CTTCTCTCCTGGGTCAGAGGGGG - Intergenic
1132801874 16:1758571-1758593 CTGCTCTCTGGCTGCACAGCAGG + Intronic
1133019453 16:2960776-2960798 CACCTCTCCTGGGTGACAGCTGG - Intergenic
1133232395 16:4372803-4372825 CTCCACCCCTGGGCCACAGCAGG - Intronic
1133344735 16:5062329-5062351 GGGCTCTCCTGGGGCAAGGCTGG - Intronic
1133772005 16:8872182-8872204 CTGCACTCCTGGGCAACAGAGGG + Intergenic
1133834085 16:9351128-9351150 CTCCTCTGCTGGCCCACAGCAGG + Intergenic
1134140120 16:11711181-11711203 CTGCTCTACTGAGGTGCAGCAGG - Intronic
1136076921 16:27823536-27823558 CTGGTCTCCAGGAGGACAGCAGG + Intronic
1136288270 16:29257064-29257086 CTGGGCTCCTGGACCACAGCGGG - Intergenic
1137427776 16:48394309-48394331 CTGTGCCTCTGGGGCACAGCTGG - Intronic
1138693816 16:58792760-58792782 CTGAGCTCCTGGGGCAGGGCTGG - Intergenic
1140256956 16:73345871-73345893 CTGCTTCCCTAGGGCACAGATGG + Intergenic
1140979542 16:80093623-80093645 CTGCTTTCTTGGGGCAAACCTGG - Intergenic
1141556215 16:84838433-84838455 CTGGGCTCCTCGGGCAGAGCTGG - Exonic
1141575942 16:84963692-84963714 CACCTCTCCTTGGGCAGAGCGGG - Intergenic
1141668859 16:85480915-85480937 CTGCTCCCTGGGGGCACCGCCGG - Intergenic
1141852809 16:86658912-86658934 CTGCTCTGTTGGGAAACAGCAGG + Intergenic
1141903492 16:87007707-87007729 CTGCTTCCCTGGGGCCCAACTGG + Intergenic
1142093941 16:88229819-88229841 CTGGGCTCCTGGACCACAGCGGG - Intergenic
1142505890 17:362943-362965 CCAGTCCCCTGGGGCACAGCTGG + Intronic
1142605169 17:1077531-1077553 CCTCTCTCCTGCGGCCCAGCAGG - Intronic
1142987359 17:3704257-3704279 AATCTCTCCTGGGGCACAGAAGG + Intergenic
1143018035 17:3901971-3901993 CTGCTCGTTTGGGGCAGAGCTGG + Intronic
1143029536 17:3960125-3960147 CTGCTATCCTGAGGAGCAGCAGG + Intronic
1144701468 17:17343634-17343656 CTGCCACCCTGGGGCAGAGCCGG - Intronic
1144834209 17:18148481-18148503 CTGGTCACCTGGGGCGCAGCAGG - Exonic
1146080402 17:29774902-29774924 CTGCTCTCCTGAGCTACAGAAGG - Intronic
1148146211 17:45366695-45366717 CGCCTCTCCTGGGGCTCAGCAGG - Intergenic
1148320719 17:46749867-46749889 CTGCTCTCCTGTGGCAATGTTGG - Exonic
1148796025 17:50197172-50197194 CTGCTCACCTGAGGCCCAGGAGG + Exonic
1148844210 17:50519172-50519194 CTGGTCTCAGGTGGCACAGCTGG + Intronic
1148973936 17:51510316-51510338 CTGGACTCATGGTGCACAGCAGG - Intergenic
1149550799 17:57537967-57537989 CTGCTTCCGTGGGCCACAGCAGG - Intronic
1149773873 17:59342215-59342237 CTGGTCCCCCAGGGCACAGCTGG - Intronic
1150209948 17:63436395-63436417 CTGCCCTCTTTGTGCACAGCTGG - Intronic
1150417169 17:64997006-64997028 TTGCTGCCCTGTGGCACAGCAGG - Intergenic
1150794492 17:68226916-68226938 TTGCTGCCCTGTGGCACAGCAGG + Intergenic
1151315433 17:73318990-73319012 CAGCTCTGCTGGAGAACAGCCGG + Intergenic
1152340482 17:79721472-79721494 CAGCCCTCCTGGGGCCCAGCCGG + Intergenic
1152429083 17:80237451-80237473 CTGCTTTCATGGGTCACTGCTGG + Intronic
1152544258 17:80992658-80992680 CTGACCCCCCGGGGCACAGCCGG + Intronic
1152961048 18:80332-80354 CTGTTCACCTGTGGCCCAGCGGG - Intergenic
1154071844 18:11159794-11159816 CTGCTGTCCTGGGGCGCTGTGGG - Intergenic
1154381034 18:13850030-13850052 CTTCCCTTCTGGGGCACAGCAGG + Intergenic
1154494399 18:14945043-14945065 CAGATGGCCTGGGGCACAGCAGG + Intergenic
1154501532 18:15000082-15000104 CGGCTTACCTGGGGCGCAGCGGG + Intergenic
1154501846 18:15001253-15001275 CTGCACACCTGGGACACAGAGGG - Intergenic
1155184743 18:23377223-23377245 CTGCAGTCCTGGGCCATAGCAGG - Intronic
1155605408 18:27600218-27600240 CTGCTCTCCTTGTGCTCAGCAGG - Intergenic
1156396189 18:36702145-36702167 TTGCTCTCCTGGGGGACATTTGG + Intronic
1156474769 18:37398520-37398542 CCTCACTCCTGGGCCACAGCAGG - Intronic
1156490736 18:37494498-37494520 ATGCTCTCCTGGGGACCAGTAGG - Intronic
1159620932 18:70637578-70637600 GTGCTATCCTGGCTCACAGCAGG + Intronic
1160146711 18:76371429-76371451 CTGCTCCCCTTGGGGATAGCTGG + Intronic
1160196538 18:76759829-76759851 ATGCTTCCCTGGGGCCCAGCTGG - Intergenic
1160235207 18:77080388-77080410 CTCCTCACCTGGGGCCCTGCTGG + Intronic
1160335129 18:78031774-78031796 GTGGTCTCCTGGGGCCCAGCTGG - Intergenic
1160707158 19:535056-535078 CGGCCCTCCTGGGCCACAGCAGG - Intronic
1160993944 19:1873289-1873311 CTGGTCCCCTGGGGAGCAGCTGG + Intergenic
1161222240 19:3123061-3123083 CTGCTCCCCCAGGGCACCGCCGG - Exonic
1161318596 19:3630832-3630854 CTTCTATCATGGGGGACAGCGGG + Exonic
1161370692 19:3909335-3909357 CTGCTGTCCTGGCGGACTGCAGG - Intronic
1162050199 19:8028365-8028387 CTGCTCTCCTGGGTCAATGCAGG + Intronic
1163369333 19:16893328-16893350 CTCATCTCCAGGGTCACAGCCGG - Exonic
1163463782 19:17454911-17454933 CTGCCCACCTGGGGCAGAGGAGG + Intronic
1164921670 19:32093153-32093175 ATGCTCTCCTGGGCCTCACCAGG + Intergenic
1165015187 19:32875458-32875480 CCTCTCTGCTGGGTCACAGCTGG - Intergenic
1165333676 19:35154933-35154955 CTCCTCTCCTGGGCTACAGTGGG + Exonic
1165855983 19:38879500-38879522 CTGATCTCCTGCTGCACCGCAGG - Exonic
1167250504 19:48396373-48396395 CTGCCCTCCTGGGCCTCAGTAGG + Intronic
1167639808 19:50674605-50674627 CTGCTCTAGGGGGGCACTGCAGG - Intronic
1168137023 19:54359055-54359077 CTGGGCTGCTGGGGCACAGCGGG - Intronic
1168161058 19:54510074-54510096 CTGGGCTGCTGGGGCACAGCGGG + Intronic
1168404242 19:56102712-56102734 CTGCGCTCCTGGGCCACCCCTGG + Intronic
1168501147 19:56894614-56894636 CTGCTCTCCTGGGCCAGACCTGG + Intergenic
1168528364 19:57106365-57106387 CGTCTCCCCTGGTGCACAGCAGG - Intergenic
925060430 2:886008-886030 CAGATCTGCTGGGGCCCAGCCGG + Intergenic
925250713 2:2434839-2434861 GTGCTCTCCTCAGGCACTGCGGG + Intergenic
926323633 2:11766002-11766024 CTGCTCTCTGGGGCCTCAGCTGG + Intronic
935806054 2:106748672-106748694 CTAGTGTCCTGGGGCACATCGGG - Intergenic
937234695 2:120423586-120423608 CTCCTCTCCTTGGCCAGAGCGGG + Intergenic
937265460 2:120612279-120612301 CTTCCCTCCTGGGGAAAAGCGGG - Intergenic
937335400 2:121059355-121059377 CTGGGCTCCTGGGGCAGAGGTGG + Intergenic
937681008 2:124644738-124644760 CTGTTCTCCTGGGAGACAGCAGG - Intronic
938421960 2:131153419-131153441 CAGCTCTCCTGGGGCCCAGGAGG - Intronic
938500714 2:131830264-131830286 CGGCTTACCTGGGGCGCAGCGGG + Intergenic
938501027 2:131831422-131831444 CTGCACACCTGGGACACAGAGGG - Intergenic
938710846 2:133975254-133975276 CTGCTCCAGTGGGGCTCAGCTGG - Intergenic
939529247 2:143336694-143336716 CTCCTCTCCTAGGGCATACCTGG - Intronic
941274605 2:163475141-163475163 CTGCAGTTCTGGGGCAAAGCTGG - Intergenic
941714410 2:168748902-168748924 CTGCTTCCCTGGGGCACTGCAGG - Intronic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
948167304 2:235872993-235873015 CTGCCCTCCTGGGGCACGGCTGG - Intronic
948192201 2:236068384-236068406 CTCCTCTCCTCTGGCACTGCTGG + Intronic
948217113 2:236240016-236240038 CTGCTGTCCTGTGGTACACCTGG - Intronic
948431726 2:237923141-237923163 CAGCCTTCCTGGGGAACAGCGGG - Intergenic
948445731 2:238031298-238031320 CTGCTCCCCTGGGGCTCAGATGG + Intronic
948982074 2:241499502-241499524 CTGGCCTCCTAGGGCACAGCAGG + Intronic
949047790 2:241880104-241880126 CTGCACTCCTGGATCACACCTGG - Intergenic
1169996959 20:11569261-11569283 CAGGTCTGCTGGGGAACAGCTGG + Intergenic
1170991136 20:21303060-21303082 CTGCTCTGCCGGGGCTCCGCCGG - Intergenic
1171195449 20:23194116-23194138 CTTATCTCCTGGGCCACATCAGG + Intergenic
1171205860 20:23280388-23280410 ATGGTTTCCTGGTGCACAGCAGG - Intergenic
1171311587 20:24149407-24149429 CTGCTCACCAGGGACACACCCGG - Intergenic
1171458214 20:25283607-25283629 CAGCTCTCCAGGGGCAAAGAGGG - Intronic
1172126101 20:32626234-32626256 CTGGTCTCCTGGGGCGCTCCGGG - Intergenic
1172630987 20:36378042-36378064 GGGCTCTCCTGGGGGACAGCTGG - Intronic
1172662955 20:36579951-36579973 CTGCTTTCCTGGAGCAGAGGCGG + Intronic
1172778826 20:37423710-37423732 CCCCTCTCCTGGCGCACAGGAGG + Intergenic
1173199447 20:40943888-40943910 CGGCTCTCCTGTGCCACAGAAGG + Intergenic
1173454363 20:43190838-43190860 CTGCTGTCCTGGGAGGCAGCTGG + Intergenic
1173844990 20:46182617-46182639 CTGCCCTCCTGGGCAGCAGCTGG + Intronic
1173866268 20:46314322-46314344 CAGCCCTCCTGGTGCTCAGCAGG - Intergenic
1174139513 20:48403317-48403339 TTTCTCTCCTGGGGCTCAGGGGG - Intergenic
1174216283 20:48919158-48919180 CTGCTATTCTGTGGCTCAGCTGG + Intergenic
1174645884 20:52085034-52085056 CTGACCTCCTGGAGCACAGCCGG - Intronic
1175743641 20:61437832-61437854 CTGTTTTCCAGGGGCACATCTGG - Intronic
1175814414 20:61876116-61876138 GTCCTCTCCTTGGACACAGCCGG - Intronic
1175924354 20:62464748-62464770 CTGCTGTGCTGGAGCAAAGCAGG + Exonic
1175941650 20:62540097-62540119 CCTCGCTCCTGGGGCACAGCAGG - Intergenic
1175986814 20:62768155-62768177 CTGATCGCCTGGGGCTCAGCTGG - Intergenic
1176177751 20:63736717-63736739 GTGCCCTCCTGGGGGGCAGCTGG + Intronic
1176388625 21:6152067-6152089 CTGCCTGCCAGGGGCACAGCCGG - Intergenic
1177234898 21:18375832-18375854 CTGCTCTCCGTAGGCACAGGAGG - Intronic
1177459749 21:21395295-21395317 CTGAACTCCTGGCCCACAGCCGG + Intronic
1178198846 21:30379665-30379687 CTTCTCTCCTGTGGCTCTGCAGG - Intronic
1179146270 21:38770702-38770724 GGGATCTCCTGGGGCAGAGCTGG + Intergenic
1179159247 21:38878540-38878562 CAGCTCTCTTGGGTAACAGCAGG - Intergenic
1179734847 21:43386181-43386203 CTGCCTGCCAGGGGCACAGCCGG + Intergenic
1180147693 21:45930437-45930459 CTGCTCTCCTGGGGCAGGGCTGG - Intronic
1181029118 22:20141508-20141530 CTGCTCGCCTGGTCCACAGAAGG - Exonic
1181043865 22:20205475-20205497 CTCCTCTCCTGGGGCTAAGGAGG - Intergenic
1181311708 22:21948484-21948506 CAGCTCTGCTGGGGCATGGCTGG - Intronic
1181381577 22:22508710-22508732 AGGCGCTCCCGGGGCACAGCCGG + Exonic
1181570867 22:23767366-23767388 CTGCTCACCTGCTGGACAGCAGG + Exonic
1181867412 22:25869653-25869675 CTGCTCTCCAGGAGCCCACCAGG + Intronic
1182037830 22:27213397-27213419 CTGGTGTCCTGGGGTCCAGCAGG + Intergenic
1182391959 22:30005422-30005444 CTGCTCCTCTTGGGCACTGCTGG + Intronic
1182655694 22:31888133-31888155 CTGCTCACCTGGGAAGCAGCAGG + Intronic
1183418717 22:37697675-37697697 CTGATCCCCTGGAACACAGCAGG + Exonic
1183424960 22:37734512-37734534 CTGATGTCCTGGGGGGCAGCGGG - Exonic
1183669599 22:39264665-39264687 CTCCACTTCTGGGTCACAGCTGG - Intergenic
1184278043 22:43421477-43421499 CTGCTCCTCTGGGGCAAAGACGG + Intronic
1184334392 22:43844824-43844846 CTGCTCCCCTGGGCCGTAGCAGG - Intronic
1184426576 22:44412276-44412298 CTCCTCTCCTGGGGAATAGGAGG + Intergenic
1184652587 22:45925917-45925939 CAGCCATCCTGGGCCACAGCAGG - Intronic
1185119199 22:48955795-48955817 GTGCCGTCGTGGGGCACAGCGGG - Intergenic
1185310091 22:50149509-50149531 CAGCACCCCGGGGGCACAGCAGG - Intronic
949302238 3:2597560-2597582 CACCTTTCCTGGGGAACAGCTGG - Intronic
950713457 3:14830647-14830669 CTCCTCTTCTGGGGCTCAGCTGG - Intronic
952456343 3:33475972-33475994 ATGCTCTCCAGGGGCCCAACTGG + Intergenic
952748298 3:36802829-36802851 CTGCACTCCTGGGCGACAGATGG - Intergenic
953407412 3:42666304-42666326 CTGCTGTCCTGGGGGAGAGAAGG + Intergenic
953884850 3:46709384-46709406 CTGGTCTCCAGGGGCAGGGCTGG - Intronic
954096222 3:48330920-48330942 CTGCTCAACTGGGGCATAGTAGG + Intergenic
954114793 3:48460506-48460528 CTGCTCCGCTGTGGCACACCAGG - Exonic
954397982 3:50303104-50303126 CTGCCCTCCTGGAGCCCTGCAGG - Exonic
956467801 3:69536253-69536275 CCGCTCTCCTGGGGACCATCAGG + Intronic
956849087 3:73211924-73211946 CTGCTCTCCTGTGTACCAGCTGG + Intergenic
957270645 3:78026141-78026163 CCGCTCTACTGGGGCATGGCTGG - Intergenic
957767728 3:84648046-84648068 GTGGTCTACTGGGGCAGAGCTGG - Intergenic
960171787 3:114470937-114470959 CTGATCTCCTGGAGCAGACCTGG + Intronic
961508781 3:127388675-127388697 CTGGTCTCCGTGGGCTCAGCTGG - Intergenic
962276564 3:134019029-134019051 CTGCTCCCCTTGGTCACAGCTGG + Intronic
962290885 3:134135404-134135426 CTGCTCTGCTGGAGGCCAGCCGG - Intronic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
962864313 3:139434670-139434692 CTGCTCTCCCTTGGCACATCAGG + Intergenic
962866431 3:139451459-139451481 CTCCTCTCCTGGGGCAGACAGGG - Intergenic
963354826 3:144197848-144197870 CTACTCTACTGTGGCAGAGCTGG + Intergenic
965028673 3:163335404-163335426 CTGCACCCCTGAGGCACTGCAGG + Intergenic
967217481 3:187222799-187222821 CAGTTCTCATGGTGCACAGCTGG + Intronic
968485630 4:859693-859715 CTTCTCTCCTGGAGGTCAGCCGG - Exonic
968492831 4:899653-899675 TTGCTGTCCTGGGGCATGGCGGG - Intronic
968502877 4:959335-959357 CTTCCCTTGTGGGGCACAGCTGG - Exonic
968514112 4:1009365-1009387 CTGCGCGCCTGGGGCTCACCGGG + Intergenic
969183831 4:5461168-5461190 GTGCTCTCCTAGGTCACAGATGG - Intronic
969688211 4:8688735-8688757 GTGCACTCCAGGGGCACAGCTGG - Intergenic
971187663 4:24396085-24396107 CACATCTCCTGGGGCAGAGCCGG + Intergenic
982361500 4:154524013-154524035 CTGCTCTGCTGGAGCCCAGATGG + Intergenic
983930601 4:173449468-173449490 CTGGTCTCCCAGGGCATAGCTGG + Intergenic
984122130 4:175758755-175758777 GTCCTCTACTGAGGCACAGCAGG + Intronic
985012069 4:185593065-185593087 CTGCTCACCTGGAGCAGAACAGG - Intronic
985777298 5:1851476-1851498 CTGGCCCCCTGGGGAACAGCGGG + Intergenic
986544446 5:8880096-8880118 CTGCTCCCCTGTGGCTGAGCTGG + Intergenic
986789298 5:11144509-11144531 CTTGTCTCCTGGGGCACAAAGGG + Intronic
988707053 5:33736782-33736804 GTGATCTGCTGGGGAACAGCAGG + Intronic
990466847 5:56078875-56078897 CTGATTTCCTGGGGCACCTCAGG - Intergenic
991433514 5:66572592-66572614 CTGCTCTCCTGAGCTACAGAAGG - Intergenic
992406440 5:76461900-76461922 CTCCACTCCTGAGTCACAGCTGG + Intronic
993535612 5:89082092-89082114 CTTCTCTCCTGAGAAACAGCTGG - Intergenic
993623261 5:90192787-90192809 CTACTCTGCTGTGGCAGAGCCGG - Intergenic
994005897 5:94836848-94836870 CTGCTTTCCTGGGACACATATGG - Intronic
996040018 5:118798961-118798983 CTTCTCTCCTGGGGCTGGGCTGG - Intergenic
997272912 5:132556927-132556949 CCGCTCTCCTGGGGCACGCCGGG - Exonic
997335669 5:133107420-133107442 CTGCTTTGCAGGGGCACAGGGGG + Intergenic
997402451 5:133612845-133612867 GTGCTCTCCAGGCGCACAGGGGG + Intergenic
997527412 5:134562277-134562299 CTCCTCGCTTGGGGCAGAGCAGG - Exonic
997587216 5:135050578-135050600 CGGTTCTCCGGTGGCACAGCGGG - Intronic
998050315 5:139026983-139027005 CTGCTCTCCTTAGGCAAGGCAGG - Exonic
1001965731 5:175908645-175908667 CTGCTGTGCTGGGGCAGGGCTGG + Intergenic
1002094574 5:176823457-176823479 CGTCTCTCCTGGGCCACGGCTGG - Intronic
1002105629 5:176878222-176878244 CTGACCACCTGGGGCACTGCAGG + Exonic
1002251214 5:177930551-177930573 CTGCTGTGCTGGGGCAGGGCTGG - Intergenic
1002451282 5:179320196-179320218 CTGCTGCCCAGGAGCACAGCAGG - Intronic
1002959744 6:1903883-1903905 CTACTCTCCTGAAGCACATCTGG + Intronic
1003524957 6:6889869-6889891 ATGGTCTCCTGGGGTATAGCAGG + Intergenic
1004691504 6:17996229-17996251 CTGCCAACCTGGGGCACAGATGG - Intergenic
1005136063 6:22570470-22570492 CTGCCATCCTGGGGCCCGGCAGG - Exonic
1005957575 6:30675084-30675106 CTGTTTTCCTGGGTCACAACTGG + Intergenic
1006514391 6:34538033-34538055 CTGCTCCCCTGGAGGACAGAGGG - Exonic
1006583015 6:35087472-35087494 CTGCTGTACTGAGCCACAGCTGG + Intronic
1006643433 6:35500152-35500174 CTACTCCCCTGGGGCACCCCAGG - Exonic
1007651944 6:43427996-43428018 CTGCGCTGCTGCCGCACAGCTGG - Exonic
1007709231 6:43811334-43811356 TGGCACCCCTGGGGCACAGCTGG - Intergenic
1007973817 6:46079935-46079957 CTGTCCTCCTGGGGCTCACCTGG + Exonic
1010381576 6:75231679-75231701 CTTGTGTCCTGGGGCAGAGCTGG - Intergenic
1010413947 6:75592380-75592402 AGGCTCTCCAGGGGCCCAGCTGG + Intergenic
1012475435 6:99611563-99611585 CTGCTCTCCTTGGACTCAGTTGG + Intronic
1013125482 6:107180206-107180228 AGGCTCTCCTGGTGCACAGGTGG + Intronic
1013274314 6:108569713-108569735 CTGCAGTCCTAGGGCACATCTGG - Intronic
1013888865 6:115001749-115001771 CTGCTGAACTGGGGCACAGAAGG - Intergenic
1016363460 6:143291736-143291758 CTGCTTTCCTTGAACACAGCAGG - Intronic
1016701391 6:147058221-147058243 CTGCCCTCATGGGGCACTCCTGG + Intergenic
1017604771 6:156122308-156122330 CTGCTCTGCGGGGGCTGAGCTGG - Intergenic
1018065635 6:160123449-160123471 CTGCTTGCCTGGAGCAGAGCAGG + Intronic
1018329042 6:162708205-162708227 CAGTTTTCTTGGGGCACAGCTGG - Intronic
1019300738 7:302244-302266 CTGCTATCCTGGGCCTGAGCTGG + Intergenic
1019434620 7:1015620-1015642 CTGCTCTCCTGGGTCAGTCCTGG - Intronic
1019850414 7:3550477-3550499 CAGCTCTTCTGGGCCACTGCTGG + Intronic
1020141357 7:5613789-5613811 CTGCACACATGGGTCACAGCAGG + Intergenic
1020260518 7:6528412-6528434 CAGCTGGCCTGTGGCACAGCTGG + Intronic
1020713187 7:11635106-11635128 CTGCGCTTCTGGTGAACAGCTGG - Intronic
1020769674 7:12373432-12373454 CTGCTCTCCTTGAGCAGGGCAGG + Intronic
1021633788 7:22671424-22671446 CTGCTCTGCTTGGGCACCTCTGG - Intergenic
1022990840 7:35705559-35705581 CTTATTTCCTGGGGCACAGCTGG - Intergenic
1023592711 7:41796350-41796372 CTGCTCTCCTAGGGCAGAGGTGG - Intergenic
1024648133 7:51385593-51385615 CTGCTGTGCTGGGGGAAAGCTGG + Intergenic
1024757298 7:52549952-52549974 CTGCTGTCCAGGGTCAAAGCTGG - Intergenic
1025970134 7:66315514-66315536 TTGACCTCCTGGGGCACAGAAGG + Intronic
1026947798 7:74327551-74327573 CTGCTCTCCTGGGGCTGGGAAGG - Intronic
1029345534 7:99975950-99975972 TGGTTCTCCTGGGGGACAGCAGG + Exonic
1029346251 7:99980821-99980843 CGGGTCTCCTGGAGGACAGCAGG - Intergenic
1030200287 7:106896173-106896195 CGCCTCTCCTTGGGTACAGCAGG + Intronic
1031060422 7:117045380-117045402 CTGCTCTCCTTGGATACACCAGG + Intronic
1032264853 7:130363520-130363542 CTGCTGTCCTGGGGCAGGGTTGG + Intronic
1033274347 7:139959916-139959938 CTGCTCCCATGGAGCAGAGCTGG - Intronic
1033414870 7:141152707-141152729 CTTCTCCCCTTGGACACAGCTGG + Intronic
1033416693 7:141167836-141167858 CTGCTTCCCTGGGGCACAACGGG - Intronic
1034003432 7:147442495-147442517 CTACTCTCCTGTGGCTGAGCTGG + Intronic
1034207081 7:149326916-149326938 ATGCTCTCCTGGGGCTCAACTGG - Intergenic
1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG + Intergenic
1034985336 7:155509756-155509778 CTGCTTTCTTTGGGAACAGCTGG + Intronic
1035216225 7:157369454-157369476 CTTCTCTTCTGGGGCACACGAGG + Intronic
1035300018 7:157891059-157891081 GTCCTCTCCTGGGTCACACCTGG + Intronic
1035631198 8:1107678-1107700 CAGCTCTGCTGGGACAGAGCAGG - Intergenic
1035682269 8:1496659-1496681 CTGCTCCCCTGTGGCCCAGAGGG - Intergenic
1037772558 8:21811074-21811096 CTTCTCTCCTGGGGCCCAGGAGG - Intronic
1039895918 8:41716400-41716422 CAGGTCTCATGGGGCCCAGCTGG + Intronic
1041383702 8:57278387-57278409 CTGCGCTGCTGGGGCCCAGAGGG - Intergenic
1042352060 8:67787419-67787441 ATGCTCTCCTGAGTCTCAGCAGG + Intergenic
1042945674 8:74152422-74152444 CAGCTTTCCTGAGCCACAGCTGG + Intergenic
1043579451 8:81695527-81695549 CTGCTCTCCTGGAGCTTAGTGGG + Exonic
1045567971 8:103340499-103340521 GTGGTCTCCTGGGCCACAGCTGG - Intergenic
1047566106 8:126046378-126046400 CTGCTACCCTGGGGCGGAGCAGG - Intergenic
1048396612 8:134020075-134020097 CTGCTCTTCTGGAGCCCAGGTGG - Intergenic
1048779155 8:137982391-137982413 TGGCTGTCCTGGGGCACCGCAGG - Intergenic
1048921352 8:139233291-139233313 AGGCTCTCCAGGGGCCCAGCTGG - Intergenic
1049162240 8:141104940-141104962 CTTCTCTCCAGAGGCTCAGCAGG - Intergenic
1049190559 8:141285109-141285131 CTCCTCTCCAGCGGCCCAGCGGG + Intronic
1049322217 8:142002586-142002608 CTTCTCTCCTCGGCCACTGCTGG + Intergenic
1049372764 8:142275564-142275586 CTGCGCTCCTGGTGCCCAGGTGG - Intronic
1049591518 8:143464996-143465018 CTGCCCTCCTGGGCTTCAGCAGG - Intronic
1049612683 8:143562723-143562745 CCGGGCTCCTGGGGAACAGCTGG + Exonic
1049687646 8:143945307-143945329 CGCCTCTCCTGGGCCACGGCAGG + Intronic
1053351171 9:37414346-37414368 CTGCTCTTCTGGGGAGCAGAGGG - Intergenic
1056841154 9:89998993-89999015 CCTCCCTCCTGGGGCACAGCTGG - Intergenic
1057798197 9:98172961-98172983 ATGCTCTGCTGTGACACAGCGGG - Intronic
1059322388 9:113479806-113479828 CTGCTCTGCTGGGGCCAAGAAGG - Intronic
1059399468 9:114059774-114059796 CTGAGCTCCTTGGGCACAGCAGG + Intergenic
1059441144 9:114307559-114307581 ATGCTCACCTGGGGCTCGGCAGG + Intronic
1059484091 9:114613625-114613647 CTCCTCACCTGGCCCACAGCAGG - Intronic
1060223225 9:121775221-121775243 AGGCTTTCCTGGGGCCCAGCGGG - Intronic
1060743761 9:126116597-126116619 CTGCTTTCATGGGACACCGCTGG + Intergenic
1061041977 9:128145610-128145632 CAGCTCTCCTTGGTCACGGCAGG - Intergenic
1061191729 9:129086241-129086263 CTGCTATCCTGGGGAACAGCGGG - Exonic
1061506021 9:131032274-131032296 CCTCTCCCCTGGGGCACACCTGG - Intronic
1061861345 9:133470086-133470108 CTGCCACCCTGGGGCTCAGCTGG - Exonic
1062311753 9:135941768-135941790 CTGCTGTCCGGGGGCAGAGCTGG - Intronic
1062386072 9:136311998-136312020 CTGTTCTTCGGGAGCACAGCAGG - Intergenic
1062394924 9:136348954-136348976 TGCCTCGCCTGGGGCACAGCTGG - Intronic
1062476519 9:136730381-136730403 GTCCTCTCCTGGGTCTCAGCAGG - Intergenic
1062498642 9:136843097-136843119 CTGCACACCTGGGACACAGAGGG + Intronic
1062498967 9:136844265-136844287 CGGCTTACCTGGGGCGCAGCGGG - Intronic
1062737114 9:138143655-138143677 CTGTTCACCTGTGGCCCAGCGGG + Intergenic
1185609475 X:1385994-1386016 CAGCACCCCTGGGGCACAGAGGG - Intergenic
1186849907 X:13569895-13569917 CTGCTCTCCTGGGTGGCAGGTGG + Exonic
1187526784 X:20061504-20061526 CTCTTCTCCCTGGGCACAGCAGG - Intronic
1187528388 X:20074268-20074290 CTGCTCTCCTGGGAGAGAGGAGG + Intronic
1188220596 X:27536791-27536813 CCGTTCTCCTGGTGCACAGGCGG + Intergenic
1188581357 X:31717905-31717927 CTGTTGCCCTGGGCCACAGCTGG - Intronic
1189063938 X:37785921-37785943 CTTCCCTCCTGGGTCACAGGAGG - Intronic
1189186937 X:39062918-39062940 CTCATCTCCTGGGCCTCAGCTGG + Intergenic
1190630516 X:52381204-52381226 CTCCTCTACTGAGACACAGCTGG + Intergenic
1192437659 X:71152956-71152978 CTGAGCTCCTGGGGCCCAGTGGG - Intronic
1193194854 X:78619680-78619702 CTACTCTACTGTGGCAGAGCTGG + Intergenic
1194203600 X:90984128-90984150 CTGCTCTCCTCGGAGCCAGCAGG - Intergenic
1195290039 X:103423677-103423699 CTGCCCTGCTGTGGCAGAGCTGG + Intergenic
1198765411 X:140075119-140075141 CAGCAATCCTGGGGCACAGGAGG - Intergenic
1198771769 X:140138321-140138343 CAGCAATCCTGGGGCACAGGAGG - Intergenic
1199774663 X:151000320-151000342 TTTCTCTCCTGGGGCACTGGAGG + Intergenic
1200064052 X:153496379-153496401 CAGCTCTCCTGGGGTGCGGCTGG - Intronic
1200167833 X:154049570-154049592 CTGCTCTCCTGTACAACAGCAGG - Intronic
1200549431 Y:4559567-4559589 CTGCTCTCCTCGGAGCCAGCAGG - Intergenic