ID: 1090262054

View in Genome Browser
Species Human (GRCh38)
Location 11:125328197-125328219
Sequence GATCCCACAATGGCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090262054_1090262059 23 Left 1090262054 11:125328197-125328219 CCTGCTCTGGCCATTGTGGGATC 0: 1
1: 0
2: 2
3: 24
4: 215
Right 1090262059 11:125328243-125328265 CATCACACACACATTGTAGGTGG 0: 1
1: 0
2: 0
3: 18
4: 235
1090262054_1090262058 20 Left 1090262054 11:125328197-125328219 CCTGCTCTGGCCATTGTGGGATC 0: 1
1: 0
2: 2
3: 24
4: 215
Right 1090262058 11:125328240-125328262 CAGCATCACACACACATTGTAGG 0: 1
1: 0
2: 4
3: 13
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090262054 Original CRISPR GATCCCACAATGGCCAGAGC AGG (reversed) Intronic
902549612 1:17211595-17211617 CAGCCCACAAATGCCAGAGCTGG + Intronic
902995415 1:20221195-20221217 GATTGCACACTGGGCAGAGCTGG + Intergenic
903649808 1:24915742-24915764 GATACCAGGGTGGCCAGAGCAGG + Intronic
903809135 1:26024955-26024977 GATCTGAAATTGGCCAGAGCCGG + Intronic
905487219 1:38310554-38310576 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
905993858 1:42363979-42364001 GAACTCTCAATGGCCAAAGCTGG + Intergenic
906157238 1:43620870-43620892 GTTCACAGACTGGCCAGAGCAGG + Exonic
909173366 1:72322515-72322537 GGTCCCCCAATGGCAAGTGCAGG - Intergenic
915034960 1:152914139-152914161 GAGCTCACAATGGCCAAAGCTGG - Intergenic
915190445 1:154146201-154146223 GAGCCCCCAGTGGCCAAAGCTGG + Intronic
916511796 1:165478735-165478757 GAGTTCCCAATGGCCAGAGCTGG - Intergenic
916735239 1:167601754-167601776 AAGCCCACCAGGGCCAGAGCAGG - Intergenic
919676118 1:200385193-200385215 CTTCCCACAATGTCCAGGGCAGG - Intergenic
922687754 1:227659416-227659438 GTTCACACCATGGCCAGAGATGG + Exonic
924080222 1:240388422-240388444 GATCCCACAAGGTCCAGTGTTGG - Intronic
1064416532 10:15154835-15154857 GGTCCAAGAATGGCAAGAGCAGG - Intronic
1064480287 10:15733827-15733849 GAGCTCCCAATGGCCAGAGCTGG + Intergenic
1066213891 10:33267090-33267112 CATGTCACAATGGCCGGAGCAGG - Intronic
1071456941 10:85858162-85858184 CAGCCCACAATGGTCAGAGCTGG - Intronic
1074047882 10:109855444-109855466 GAGCCCTCAGTGGCCAAAGCTGG + Intergenic
1074525857 10:114262647-114262669 GGCCCCACAATGGGCACAGCAGG + Intronic
1075380465 10:122014630-122014652 GAAGCCACAGTGGGCAGAGCAGG - Intronic
1076425133 10:130362382-130362404 GTTCTCACAGAGGCCAGAGCAGG + Intergenic
1076821523 10:132942305-132942327 GATCCCTCGAGGGCCACAGCCGG - Intronic
1076841520 10:133048251-133048273 GAGCTCACCAGGGCCAGAGCGGG + Intergenic
1077102641 11:828982-829004 TATCCCCCACTGCCCAGAGCTGG + Intronic
1077239135 11:1501583-1501605 GATGCCACCATGGCCAGTGCCGG - Intergenic
1083774739 11:64888862-64888884 GATCCCACAAAGGCCTGCGAGGG - Intergenic
1083830869 11:65232776-65232798 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1083896609 11:65623252-65623274 CAGCCCTCAATGTCCAGAGCAGG + Intronic
1085052549 11:73387346-73387368 GATCCCTCAAAGGACAGAGGAGG + Intronic
1086141084 11:83501288-83501310 CAGCCCACAATGGCCACAGTAGG + Intronic
1089006471 11:115095548-115095570 GAGCCTGCAATGGCCAAAGCTGG + Intergenic
1089353002 11:117831975-117831997 ACTCCCACAAAGGCCAGAGCTGG - Intronic
1090262054 11:125328197-125328219 GATCCCACAATGGCCAGAGCAGG - Intronic
1091789745 12:3264967-3264989 GATAGGACAATGGCCAGAGCTGG - Intronic
1094345912 12:29469068-29469090 GAGCTCACAATGGCCAAAGCTGG + Intronic
1095265418 12:40150982-40151004 GAAACCACTATGGCCAAAGCTGG + Intergenic
1099457884 12:82886106-82886128 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1099563085 12:84203847-84203869 GAACTCCCAATGGCCAAAGCTGG - Intergenic
1101226672 12:102694542-102694564 CACCCCACTGTGGCCAGAGCTGG - Intergenic
1101891652 12:108721783-108721805 CATCTTATAATGGCCAGAGCTGG - Intronic
1101914750 12:108887405-108887427 GATCACCCAATGCCCTGAGCTGG - Intronic
1105250912 13:18697959-18697981 GATCCCACCAGGGCCGCAGCAGG - Intergenic
1105452651 13:20513972-20513994 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1105855997 13:24372487-24372509 GAACTCCCAATAGCCAGAGCTGG - Intergenic
1107271265 13:38619889-38619911 GATCCATCAATGACCAAAGCTGG + Intergenic
1108378567 13:49836179-49836201 GAGCTCCCAATGGCCAGAGCTGG - Intergenic
1117019413 14:51554158-51554180 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1117372434 14:55090826-55090848 CATCCCACAAGGAACAGAGCAGG + Intergenic
1118974543 14:70665433-70665455 GATCCCACCATGGAGAGAGAGGG + Intronic
1120716111 14:87842365-87842387 GAACTCCCAATGGCCAAAGCTGG - Intronic
1121238620 14:92412015-92412037 GATCCCGCCATGCCCACAGCGGG - Intronic
1122355783 14:101122149-101122171 GATCCCAAAATAGCCTCAGCTGG - Intergenic
1122403915 14:101486617-101486639 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1124005832 15:25794828-25794850 GATTCCACAAAGGCCATTGCAGG + Intronic
1124057595 15:26256460-26256482 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1125722757 15:41853041-41853063 GCTCCCACCATGGGCAGGGCAGG + Intronic
1126904490 15:53349693-53349715 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1127580617 15:60336089-60336111 GAACTCCCAATGGCCAAAGCTGG + Intergenic
1128807996 15:70547634-70547656 GAGCTCCCAGTGGCCAGAGCTGG + Intergenic
1130927920 15:88398917-88398939 CATCCCACCATGGCCTGAGACGG + Intergenic
1131051280 15:89349689-89349711 GAACCCACACTGGCCCCAGCAGG + Intergenic
1131391659 15:92054125-92054147 GAGCCCCCAGTGGCCAAAGCTGG - Intronic
1132280344 15:100608494-100608516 GATCCCTCAATAGCCAAAGAGGG - Intronic
1133438827 16:5803408-5803430 GTTCCCACACTGACCAGATCCGG + Intergenic
1135056683 16:19237863-19237885 CACCCCACTATGGCCAGAGCAGG + Intronic
1136993873 16:35174215-35174237 GACGCCACAATGCACAGAGCAGG - Intergenic
1137770351 16:51011492-51011514 GAGCCCAGCATGGCTAGAGCAGG - Intergenic
1138140715 16:54566365-54566387 GATACCTCATTGGTCAGAGCTGG - Intergenic
1138428120 16:56950177-56950199 GACCCCACAACCTCCAGAGCCGG - Intergenic
1139303160 16:65962178-65962200 GATCCCACAATGGACTCAGAAGG - Intergenic
1139352456 16:66345692-66345714 GAGCCCAGAATGGACAGAGAAGG + Intergenic
1140407005 16:74717789-74717811 GGCCCCAGAATGGCCTGAGCAGG + Intronic
1140894189 16:79310699-79310721 GAGCCCAAAATGGCCACAGAGGG - Intergenic
1142602159 17:1058844-1058866 AAGCCAACAAAGGCCAGAGCCGG - Exonic
1145779862 17:27555434-27555456 GAACTCCCAATGGCCAAAGCTGG - Intronic
1147050502 17:37790778-37790800 CATCCCAAGATGGCCAAAGCAGG + Intergenic
1147771411 17:42870567-42870589 GATCTCCCAATGGCCAAAGTTGG - Intergenic
1148858603 17:50592518-50592540 GATGCCACTAAGACCAGAGCAGG + Intronic
1149297229 17:55271992-55272014 GATCCCACAATAGCCACAACAGG - Intronic
1150369344 17:64623008-64623030 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1150535995 17:66041688-66041710 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1151179354 17:72315025-72315047 GAACTCCCAATGGCCAAAGCTGG - Intergenic
1151229180 17:72670671-72670693 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1154437933 18:14360955-14360977 GATCCCACCAGGGCCGCAGCAGG + Intergenic
1155056190 18:22185656-22185678 TTCCCCACAATGGCCACAGCAGG - Intronic
1155117617 18:22784531-22784553 GATACCACAGTTGCCAGTGCAGG + Intergenic
1155785542 18:29895253-29895275 GAGCTCACAATGGCCATATCTGG + Intergenic
1155841039 18:30643028-30643050 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1156607534 18:38684678-38684700 GAGCCAACAATGGCCAAAGTTGG + Intergenic
1157635843 18:49153574-49153596 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1158545448 18:58392362-58392384 TAGCTCACTATGGCCAGAGCAGG - Intronic
1160377234 18:78422267-78422289 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1163443547 19:17333822-17333844 GATCCCAGAGTGGCCTGACCCGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1165152808 19:33770955-33770977 GAATCCACAGTGGCCAGAACTGG + Intronic
1165875533 19:39004076-39004098 GATCTCTCAATGGCCAAATCTGG + Intronic
1166744937 19:45137086-45137108 GATGCCACAATGGGCAGGGAAGG - Intronic
1167120991 19:47516404-47516426 GAACTCCCAATGGCCAAAGCTGG + Intergenic
1167506493 19:49873561-49873583 GCTCCCACAGAGGCCAGGGCAGG - Intronic
925031057 2:650069-650091 GAGGCCACAGTGGACAGAGCTGG - Intergenic
925966140 2:9068131-9068153 GAGCCCCCAATGTCCAAAGCTGG - Intergenic
927198288 2:20563139-20563161 TAGCCCCCAATGGCCTGAGCAGG - Intronic
928508184 2:31975776-31975798 GAACCCACAATGTCCAGAGTTGG + Intronic
929139803 2:38656828-38656850 GATGCCACCATGTCCACAGCAGG - Intergenic
930660672 2:54049762-54049784 GAGCTCCCAATGGCCAAAGCTGG - Intronic
930786075 2:55272653-55272675 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
932720632 2:74136807-74136829 AATTCCCCAATGGTCAGAGCAGG + Intronic
933972612 2:87482324-87482346 GTTCCCACAATGGTAAGGGCTGG - Intergenic
934939197 2:98488086-98488108 GAGCCCCCAGTGGCCAAAGCTGG - Intronic
935198095 2:100832384-100832406 GAGCCAACAATTGCCAGGGCAGG - Intronic
936321118 2:111467856-111467878 GTTCCCACAATGGTAAGGGCTGG + Intergenic
937147252 2:119658307-119658329 GGGCTCCCAATGGCCAGAGCTGG - Intronic
939121156 2:138118626-138118648 GGTCCCACATTGGACAGTGCAGG - Intergenic
947074126 2:226323278-226323300 GAACTCCCAATGGCCAAAGCTGG + Intergenic
948006391 2:234611407-234611429 GAGCCCCCAGTGGCCAAAGCTGG + Intergenic
948454061 2:238096659-238096681 GCTGCCAGAATGGCCAGTGCTGG + Intronic
1170638776 20:18133325-18133347 GATCTCCCAACGGCCAAAGCGGG + Intergenic
1170817872 20:19730032-19730054 GACCCCAAAATGGGGAGAGCTGG + Intergenic
1170933338 20:20789086-20789108 GAGCTCCCAATTGCCAGAGCTGG + Intergenic
1171104378 20:22418585-22418607 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1172937629 20:38631687-38631709 GCTCCCACAAAGGCCAGGACAGG + Intronic
1174081053 20:47970968-47970990 GCTCCCAAGAGGGCCAGAGCTGG + Intergenic
1174940577 20:54921953-54921975 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1175834844 20:61986676-61986698 GAGCTCATGATGGCCAGAGCCGG + Intronic
1179948817 21:44698213-44698235 GGTCCTACAATGGCCAGAGGAGG - Intronic
1181828555 22:25539964-25539986 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1184404750 22:44293467-44293489 CATCCCACAATGCACAGAGTGGG + Intronic
1184517030 22:44968911-44968933 GAGCCCCCAGTGGCCACAGCTGG - Intronic
1184973304 22:48043206-48043228 GATGCCTCAAAGGCCAGAGCAGG - Intergenic
1185420085 22:50730371-50730393 GATCCCGCCATGCCCAGAGCCGG + Intergenic
949581134 3:5389580-5389602 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
951050012 3:18083754-18083776 GTTCCCAAAATTGCCAAAGCAGG - Intronic
951178526 3:19630960-19630982 TATCCTACAATGGCCACAGGTGG - Intergenic
951218528 3:20045978-20046000 GATCACACAAGTGGCAGAGCTGG - Intronic
952667236 3:35921973-35921995 GAGGCCACAATGGGCAGGGCTGG + Intergenic
952865542 3:37852984-37853006 GATCCCACCATGGCCATGGGAGG - Intergenic
952980163 3:38727800-38727822 GACCCCACCATGACCAGAGTGGG + Intronic
955404571 3:58617946-58617968 GAGCCAACAAGTGCCAGAGCTGG - Intronic
955569882 3:60293253-60293275 GATTCCCCAATGGTCAGAACTGG - Intronic
959079365 3:101783741-101783763 GTTTCCACAATGGCCAGAGAGGG - Intronic
959748725 3:109808269-109808291 GATTCCTCAAAGGCCACAGCAGG + Intergenic
961495928 3:127291371-127291393 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
962400886 3:135057848-135057870 GCTCCCACAATGGCCTGAGCAGG - Intronic
962449451 3:135500370-135500392 TATACCTCAATGGCCAAAGCTGG - Intergenic
962701983 3:138009324-138009346 GGTCCCACAAAGGCCAGAGGAGG - Intronic
963315442 3:143753734-143753756 GATCCCAGAAAGGCTAGGGCTGG - Intronic
964944095 3:162197453-162197475 GACCTCTCAATGGCCAAAGCTGG - Intergenic
965743855 3:171904643-171904665 GCACCCACAATGCCCAAAGCAGG + Intronic
966077760 3:175958802-175958824 GAGCTCACAATGGTCAGAGATGG - Intergenic
966523066 3:180894230-180894252 GAGCTCTCAATGGCCAAAGCTGG - Intronic
967077785 3:186020135-186020157 GAACTCCCAATGGCCAAAGCTGG - Intergenic
969114912 4:4865440-4865462 GAACCCAGATTTGCCAGAGCCGG - Intergenic
969142860 4:5094959-5094981 GAGCCCACAGTGCCCAGGGCAGG - Intronic
969239191 4:5888181-5888203 CAGCCCACAAAGGCCAGCGCGGG + Intronic
969435247 4:7185696-7185718 CAACCTACATTGGCCAGAGCTGG + Intergenic
969566050 4:7978850-7978872 CATCCCCCAGTGGCCAGAGAAGG - Intronic
970575459 4:17422705-17422727 GATACGACAATGGGCAGAGCAGG - Intergenic
971099905 4:23454291-23454313 GATCTCCCAACGGCCAAAGCTGG - Intergenic
971728908 4:30350552-30350574 GATGCCAGCATGGCCAGAGCAGG - Intergenic
972262000 4:37418200-37418222 GAGCTCCCAATGGCCAAAGCTGG + Intronic
972368158 4:38395106-38395128 TATCCCACAATCGCAAGAGAGGG + Intergenic
972380975 4:38520122-38520144 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
973660728 4:53103862-53103884 GAGCTCCCAATGGCCAAAGCTGG + Intronic
978101828 4:104850819-104850841 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
978288883 4:107113380-107113402 GAGCCCACAATGGTCACAGCTGG + Intronic
979629702 4:122886659-122886681 GAGCTCCCAATGGCCAAAGCTGG - Intronic
980731320 4:136827610-136827632 GATCCCACCATGGGCAGAGGAGG - Intergenic
981989901 4:150905882-150905904 GATCACACAATTGCTTGAGCAGG + Exonic
982139355 4:152303092-152303114 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
982284176 4:153717195-153717217 GAGCTCCCAATGGCCAAAGCTGG - Intronic
985614893 5:914083-914105 AAACCCACAGTGGGCAGAGCTGG - Intronic
988328901 5:29809021-29809043 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
991040407 5:62169293-62169315 GATCTCAGAGTGGCCAGAGGTGG - Intergenic
991435175 5:66590805-66590827 GAGCTCTCAATGGCCAAAGCTGG - Intergenic
994113706 5:96038157-96038179 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
996238890 5:121170505-121170527 GATCTTAATATGGCCAGAGCAGG + Intergenic
997040909 5:130252735-130252757 GAGCTCTCAATGGCCAAAGCTGG + Intergenic
997289116 5:132712355-132712377 GATCTCATAATAGCCAAAGCTGG + Intronic
997654830 5:135546986-135547008 GAACCCACAGTGCCCAGAGCTGG - Intergenic
1000626129 5:163540999-163541021 GATCTCCCAATGGCCAAATCTGG + Intergenic
1001870321 5:175148694-175148716 GATCTCCCAATGGCTAAAGCTGG + Intergenic
1002322145 5:178382553-178382575 TACCCCACCATGGCCAGAGTGGG + Intronic
1002605611 5:180381179-180381201 GTTACCATAATGGCCAGAGGAGG + Intergenic
1003312996 6:4985647-4985669 GAGCTCCCAATGGCCACAGCTGG + Intergenic
1004084237 6:12428896-12428918 GTTCCCACATTGGCCATAGGAGG + Intergenic
1005002058 6:21251620-21251642 GATCTCCCAATGGCCAAAGCTGG - Intergenic
1007748300 6:44056708-44056730 TATCCCTCAATGGACAGAGGAGG - Intergenic
1008182864 6:48354752-48354774 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1008914832 6:56775721-56775743 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1012047173 6:94292056-94292078 GATCTCCAAATGGCCAAAGCTGG + Intergenic
1013145771 6:107389970-107389992 GAGCTCCCAATGGCCAAAGCTGG + Intronic
1015800011 6:137051203-137051225 GAGCTCACAATGGCAAAAGCTGG - Intergenic
1016841949 6:148533654-148533676 GATGCCACAAAGGCCAGAATCGG - Intronic
1018094096 6:160369921-160369943 GATGACCCAATGGCCAGGGCAGG + Intronic
1019514485 7:1433734-1433756 GGTCCCAGCAGGGCCAGAGCAGG - Intronic
1019664343 7:2243941-2243963 GGTCCCACAGTAGCCACAGCAGG + Intronic
1021563985 7:21998797-21998819 GAGCTCCCAATGGCCAAAGCTGG + Intergenic
1021667171 7:22995547-22995569 GAACACCCAATGGCCAAAGCTGG + Intronic
1021804234 7:24339295-24339317 GGTCCCACTATGGCCTGGGCAGG + Intergenic
1022046413 7:26625771-26625793 GCGCCCAGAATGCCCAGAGCTGG - Intergenic
1022790760 7:33686730-33686752 GATCCCACACAAGGCAGAGCTGG - Intergenic
1023025300 7:36044400-36044422 GAGCTGACAATGGACAGAGCAGG + Intergenic
1023086341 7:36573265-36573287 GATACCAAAATGGCCTGAGTTGG - Intronic
1023192420 7:37597054-37597076 GTTCACACAGTGGCCAGAGATGG - Intergenic
1023861463 7:44219812-44219834 CAGTCCACACTGGCCAGAGCTGG - Intronic
1023896694 7:44439655-44439677 GAAGCCACAATGGCCAGAGCTGG + Intronic
1028604613 7:92642293-92642315 GTCACCACAAAGGCCAGAGCTGG - Intronic
1029727586 7:102417547-102417569 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1031479789 7:122264930-122264952 GAGCTCACAATGGCCAAAGCCGG + Intergenic
1034325282 7:150224944-150224966 GATCACCCAGTGGCCAAAGCTGG - Intergenic
1034767920 7:153744302-153744324 GATCACCCAGTGGCCAAAGCTGG + Intergenic
1034820327 7:154211214-154211236 CATCCCACATTGGCCACATCTGG - Intronic
1035769384 8:2134723-2134745 GAGCTCCCAAGGGCCAGAGCTGG - Intronic
1036694744 8:10967265-10967287 GATCCCACAGTTGCCATAGGAGG - Intronic
1036697872 8:10990492-10990514 GCTCCCACCAGGGCCAGAACAGG - Intronic
1039002732 8:32999329-32999351 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1039507330 8:38061365-38061387 GATGCCACACTGGCCAAGGCAGG - Intergenic
1045578647 8:103453777-103453799 TATGCCACATTGGCCAGAACAGG - Intergenic
1045970413 8:108073507-108073529 GTTCACAGAATGGCCAGAACTGG - Intronic
1046666590 8:117010339-117010361 GCTCCCACAGTGTCCAGAACAGG + Intronic
1047134824 8:122065129-122065151 GATCCCACCATGGCAAGCCCTGG - Intergenic
1048531903 8:135257294-135257316 GATCCCACCAGGGCCTGATCAGG + Intergenic
1050224818 9:3441619-3441641 GAGCTCTCAATGGCCAAAGCTGG + Intronic
1052915063 9:33918830-33918852 GATCCTAGGATGGCCAGAGTAGG + Exonic
1055926044 9:81510727-81510749 GAGCTTCCAATGGCCAGAGCTGG + Intergenic
1056436029 9:86576875-86576897 GATCCTACAGAGGCAAGAGCAGG + Intergenic
1056777004 9:89520414-89520436 GAGCACAGAATGGCAAGAGCAGG + Intergenic
1057841917 9:98493161-98493183 GAGCTCCCAATGGCCAAAGCTGG - Intronic
1059193787 9:112351757-112351779 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1059499965 9:114743880-114743902 GATCATCCAATGGCCAAAGCTGG - Intergenic
1061511013 9:131060984-131061006 GAACCCAGAATGCCCAGAGATGG - Intronic
1062180268 9:135187649-135187671 GTTCACACAACTGCCAGAGCGGG + Intergenic
1062478221 9:136740081-136740103 GACCCTAAAATGGCCAGAGCTGG - Intronic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1188995879 X:36884692-36884714 GAGCTCACAATGGCCAAAGGAGG - Intergenic
1190304827 X:49075994-49076016 CATCTCAGAATGGACAGAGCTGG + Intronic
1191060362 X:56289198-56289220 GAGCTCCCAATGGCCAAAGCTGG - Intergenic
1192734549 X:73836877-73836899 GACCTCCCAATGGCCAAAGCTGG + Intergenic
1194606504 X:95985440-95985462 GATCCCCCTCTGGCTAGAGCTGG + Intergenic
1198778305 X:140205521-140205543 GAGCTCCCAATGGCCAAAGCTGG - Intergenic