ID: 1090262489

View in Genome Browser
Species Human (GRCh38)
Location 11:125331509-125331531
Sequence CACAGGCACCTGTCCACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 229}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090262483_1090262489 27 Left 1090262483 11:125331459-125331481 CCTTAATACAAGATGTCAGCTGT 0: 1
1: 0
2: 0
3: 17
4: 206
Right 1090262489 11:125331509-125331531 CACAGGCACCTGTCCACACTTGG 0: 1
1: 0
2: 1
3: 21
4: 229
1090262488_1090262489 -9 Left 1090262488 11:125331495-125331517 CCGCAGAAATCACTCACAGGCAC 0: 1
1: 0
2: 2
3: 39
4: 338
Right 1090262489 11:125331509-125331531 CACAGGCACCTGTCCACACTTGG 0: 1
1: 0
2: 1
3: 21
4: 229
1090262485_1090262489 -2 Left 1090262485 11:125331488-125331510 CCCAGCACCGCAGAAATCACTCA 0: 1
1: 0
2: 0
3: 12
4: 121
Right 1090262489 11:125331509-125331531 CACAGGCACCTGTCCACACTTGG 0: 1
1: 0
2: 1
3: 21
4: 229
1090262486_1090262489 -3 Left 1090262486 11:125331489-125331511 CCAGCACCGCAGAAATCACTCAC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1090262489 11:125331509-125331531 CACAGGCACCTGTCCACACTTGG 0: 1
1: 0
2: 1
3: 21
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090262489 Original CRISPR CACAGGCACCTGTCCACACT TGG Intronic
901161257 1:7177927-7177949 CAGAGGCTCCTCTCCACACACGG + Intronic
902239509 1:15079205-15079227 CACAGGCGCCTATGGACACTGGG - Intronic
904002164 1:27345010-27345032 CACAGACACATGTGCACACGCGG - Exonic
904439792 1:30522811-30522833 CACTGGCCCCAGTCCAGACTGGG + Intergenic
905091655 1:35435183-35435205 CACAGGCTCCTCTCCAGGCTGGG + Intronic
905405826 1:37731773-37731795 CACAAGCACCCACCCACACTCGG + Intronic
906522993 1:46478195-46478217 CACACACACCTGTGCACACACGG - Intergenic
908111429 1:60902477-60902499 CACAGTCATGTGTCCACACCTGG + Intronic
908232238 1:62117127-62117149 CACAAGTCCCTGTGCACACTTGG - Exonic
911190916 1:94947666-94947688 CACAAGCATTTGTCCACACAGGG - Intergenic
912971617 1:114289269-114289291 CACGGGCCCCTTTCCACTCTGGG + Intergenic
915479555 1:156175589-156175611 CACTGGCACATGCCCACTCTGGG - Exonic
915737827 1:158095746-158095768 GACAGACAGCTGTCCACAGTGGG - Intronic
916119211 1:161512818-161512840 CACAGGCCCCTATCACCACTGGG - Intronic
916128973 1:161594477-161594499 CACAGGCCCCTATCACCACTGGG - Intronic
916138891 1:161676341-161676363 CACAGGCCCCTATCACCACTGGG - Intronic
920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG + Intronic
921247033 1:213255162-213255184 CACAGGCATGGGACCACACTTGG - Intronic
921456622 1:215379783-215379805 CACTGACACCTGTCCACAGAGGG + Intergenic
1062763551 10:45362-45384 CACTGGAACCTGCCCACACCTGG - Intergenic
1063330700 10:5156096-5156118 CACCTGGACATGTCCACACTTGG + Intergenic
1063410469 10:5833099-5833121 GACAGGCCCCTGACCACACCCGG + Intronic
1064009999 10:11727987-11728009 CACTGGGACCTCTCAACACTGGG + Intergenic
1064351505 10:14581574-14581596 CACCGGCAGGTGTCCACACCAGG + Intronic
1065045853 10:21747183-21747205 CTCTGCCAACTGTCCACACTCGG - Intergenic
1065673594 10:28149894-28149916 CACACGCATCTGTCTGCACTAGG + Intronic
1066242761 10:33554008-33554030 AACAGGCACCTGTCTGCACAAGG + Intergenic
1066526431 10:36284156-36284178 CACTGACACCTGTCCACCCGGGG - Intergenic
1067525349 10:47035241-47035263 CACAGTCACCTGGCCCCACTGGG - Intergenic
1068581675 10:58747834-58747856 CACAGGCAGCTGGCCAGATTTGG - Intronic
1070596740 10:77837976-77837998 CAGGGGCACCACTCCACACTCGG - Intronic
1073164410 10:101432266-101432288 TACAGGCACACGACCACACTTGG + Intronic
1073597880 10:104818085-104818107 CACACACACCTGTGCACACTTGG + Intronic
1075324884 10:121523395-121523417 CCCAGGGACCTGTCCACAGCGGG + Intronic
1075855062 10:125622855-125622877 CACTGCCACCTGGCCACTCTGGG - Intronic
1076247952 10:128962166-128962188 CACAGGCTCCTTTCCACATGGGG - Intergenic
1076444444 10:130502574-130502596 AACAGGCTCTTGTCCACACTGGG - Intergenic
1076675777 10:132147051-132147073 CACATGCGCATGTGCACACTTGG + Intronic
1076705583 10:132299644-132299666 CAGAGACACCCGTCCCCACTAGG + Intronic
1077153705 11:1082350-1082372 CACGGACACCTGTACACACCGGG + Intergenic
1077214171 11:1388472-1388494 CCAAAGCACCTGTCCACTCTCGG - Intergenic
1077362508 11:2146947-2146969 CGCAGGCTCCTGACCACAATGGG + Intronic
1077473784 11:2776950-2776972 CACAGACACCAGTTCACACCTGG - Intronic
1079361050 11:19770561-19770583 CAGAGGCACCTGGCAACCCTTGG + Intronic
1079432239 11:20403534-20403556 CACAGGCACATGCACACACAGGG - Intronic
1079561986 11:21833051-21833073 AACATGCACCAGTACACACTTGG + Intergenic
1080967112 11:37225294-37225316 CACAGGCGTCTCTGCACACTTGG - Intergenic
1081556971 11:44173168-44173190 GACAGGCATCTCTCCTCACTGGG + Intronic
1084089402 11:66870263-66870285 CACAGGCTCCTGTCCCAACACGG + Intronic
1084599538 11:70136636-70136658 GACAGGCACCTGACCTCACCAGG - Intronic
1084951228 11:72666678-72666700 CACAGGCATCTGTATACACAGGG + Intronic
1085273015 11:75281438-75281460 AACAGGCACCTGAGCAGACTGGG + Intronic
1085347327 11:75776649-75776671 CACAGGAAGCTGTCTCCACTTGG - Intronic
1085838565 11:79983225-79983247 AACAGGCACCTTTTCACACTAGG - Intergenic
1086439166 11:86811347-86811369 CACAGACACCTGACCCCACTCGG - Intronic
1088711949 11:112516286-112516308 CACAGACACTTGTGCCCACTGGG + Intergenic
1089209694 11:116791740-116791762 CAGAGGGCCCTGTCCACCCTGGG - Intronic
1089362748 11:117901837-117901859 CGCTGGCATCTGCCCACACTGGG + Intronic
1090262489 11:125331509-125331531 CACAGGCACCTGTCCACACTTGG + Intronic
1090823851 11:130369508-130369530 CACAGGGACATGTCCATTCTAGG + Intergenic
1093929515 12:24941459-24941481 CACATACATCTTTCCACACTTGG - Intronic
1094255076 12:28414611-28414633 CACAGGCATTTGATCACACTTGG + Intronic
1098261347 12:68674571-68674593 CACATTCACCTGTTGACACTTGG + Intergenic
1101348009 12:103904190-103904212 GACAAGCACTTGGCCACACTGGG - Intergenic
1102614843 12:114144668-114144690 CACAGGCAGCTGACAACACCTGG - Intergenic
1104979153 12:132565583-132565605 CACAGGCACATACACACACTCGG - Intronic
1106103997 13:26718146-26718168 CACAGGGACTGGCCCACACTGGG - Intergenic
1109992701 13:70080259-70080281 TAAAGACACCTGTCAACACTTGG + Intronic
1112479362 13:99759473-99759495 CAAAGCCACCTCTCCAGACTTGG - Intronic
1113104397 13:106757670-106757692 CACAGGCACCTGACCAAACGTGG - Intergenic
1113213012 13:108003966-108003988 CGCAGACACCTGTCCACAGAGGG - Intergenic
1119662231 14:76460244-76460266 ACCAGGCACCTGTCCTCAGTGGG + Intronic
1120250286 14:82054762-82054784 TACAGGCACCTGTCACCACCCGG + Intergenic
1121885797 14:97541699-97541721 CACATGCACGTCTACACACTAGG - Intergenic
1125520785 15:40346850-40346872 CAGAGGCACCTGCCAACACTAGG + Intergenic
1126532875 15:49730955-49730977 CACAGGAACCTATGCACACCAGG + Intergenic
1127968750 15:63942981-63943003 CAGTGGCACCTGTCTTCACTTGG - Intronic
1127987267 15:64083510-64083532 CTCAGGCACCTTTCCAGGCTAGG + Intronic
1128420899 15:67490831-67490853 CACAGGCTGCTGGCAACACTCGG + Intronic
1129341798 15:74891184-74891206 CCCAGGCCCTTGTCCAGACTCGG - Intronic
1132574437 16:658038-658060 CACAGGAACCTGGCCGCACGTGG - Intronic
1132685221 16:1159295-1159317 CACAGGCTCCTGTGCCCACCGGG - Intronic
1132853942 16:2036537-2036559 GCCCCGCACCTGTCCACACTGGG + Intronic
1132872035 16:2119625-2119647 CACATGGACCTGTCCACCCAGGG + Intronic
1133312523 16:4859319-4859341 CACGGGCACGTGTCCTCATTAGG - Intronic
1134007720 16:10829116-10829138 CCCTGGCCCCTGTCCAGACTGGG + Intergenic
1135106506 16:19654349-19654371 GACAGGCACGTGTCCTCACTAGG + Intronic
1136385774 16:29925291-29925313 CACAGGTCCCTGTACACTCTAGG - Intronic
1137550137 16:49431865-49431887 CACAGTGCCCTGGCCACACTTGG + Intergenic
1137624621 16:49899947-49899969 CTCAGGGACCTGTCCCCTCTCGG - Intergenic
1139321480 16:66117839-66117861 CACAAGCACGTGTAAACACTCGG + Intergenic
1141596139 16:85098000-85098022 CACAGGCTCAAGTGCACACTGGG + Intergenic
1142151304 16:88513634-88513656 CACACACACCTGGCCACACCTGG - Intronic
1142188258 16:88705104-88705126 CACAGGCGCCTGCCCACGCTGGG - Intronic
1142771323 17:2099234-2099256 CACAGACACCTGGACACACTCGG + Intronic
1142897012 17:2987144-2987166 CACAGGCAGCAGGCCAGACTTGG + Intronic
1145368534 17:22286882-22286904 CCCAGGCACCTCTGCACTCTTGG + Intergenic
1146207976 17:30921372-30921394 CACATACACATGTCCACACCAGG - Intronic
1146798524 17:35800094-35800116 CACAGAATCCTGTCCACTCTGGG - Intronic
1147218550 17:38914883-38914905 CACAGGCAAATGTGCACACGTGG + Intronic
1149444241 17:56701214-56701236 CCCTGGCAGCTGTCCACACTTGG + Intergenic
1151174958 17:72280307-72280329 CTCATGCACATGTGCACACTGGG + Intergenic
1151280912 17:73073395-73073417 TTCAGGCACCAGGCCACACTGGG + Intronic
1151758887 17:76089689-76089711 CACAGCCACCTGCCCACCCTGGG - Intronic
1151929048 17:77219296-77219318 CCCAGGCACCTGCACAGACTCGG - Intergenic
1152956460 18:45693-45715 CACTGGAACCTGCCCACACCTGG - Intergenic
1154305433 18:13227410-13227432 CACAGGCACCTGAGCACATCAGG + Intronic
1156538708 18:37888780-37888802 CACAGGCACCTCTCAGCACGTGG - Intergenic
1156651622 18:39233224-39233246 CACAGGCACCCACCCACACCTGG - Intergenic
1157519427 18:48335085-48335107 CACAGGCAGCTGTCACCACCAGG + Intronic
1157590835 18:48835770-48835792 CACAGTCCCCTCTCCACACCTGG - Intronic
1159762651 18:72448062-72448084 TACAGGCACATGCCCACATTCGG + Intergenic
1160322216 18:77906353-77906375 CACAGGCACCCGCACACTCTTGG + Intergenic
1160743339 19:698037-698059 CACAGGCACCTGCCACCACCAGG + Intergenic
1160893023 19:1389347-1389369 CACATGCATGTGTCCACACAAGG - Intronic
1161039447 19:2102161-2102183 CGCAGGCAGCTCTCAACACTTGG + Exonic
1162029798 19:7912475-7912497 CACAGGCCCCCCTCCCCACTTGG + Exonic
1163826817 19:19528705-19528727 CAGAGGCACCTGGCCAATCTTGG - Intronic
1164056122 19:21623504-21623526 CCCAGGCCCCATTCCACACTGGG + Intergenic
1164260495 19:23564924-23564946 TCCTGGGACCTGTCCACACTGGG - Intronic
1164281049 19:23769132-23769154 CCCTGGGACCTGTCCACAGTGGG + Intronic
1164311564 19:24050685-24050707 CCCTGGGACCTGTCCACAGTAGG + Intronic
1165069232 19:33246195-33246217 CACAGGCACATGGGCCCACTTGG - Intergenic
1165074548 19:33273611-33273633 CACAGGGACGTGCCCACACACGG - Intergenic
1166928287 19:46284720-46284742 TACTGACACCTGTACACACTGGG - Intergenic
1167604892 19:50476406-50476428 CACTGGCACCCGTCCGCACCTGG - Exonic
1168262143 19:55201623-55201645 CACAGGGAGCTGTCCACATCAGG + Intronic
1168475662 19:56673406-56673428 CACAGGCACCCACCCACACCAGG - Intergenic
925144476 2:1571674-1571696 GACAGAGAGCTGTCCACACTTGG + Intergenic
925500262 2:4495877-4495899 CACAGGCTACATTCCACACTTGG + Intergenic
928140881 2:28727932-28727954 AACAGGCTCCTGGCCACATTTGG - Intergenic
931258866 2:60599336-60599358 CACAGGCACCTGCCTGCACCTGG - Intergenic
931794730 2:65698541-65698563 TACAGGCACCTGCCACCACTTGG + Intergenic
932304517 2:70692468-70692490 CACAGGCTTCTGTCTGCACTCGG - Exonic
934968289 2:98742451-98742473 TACAGGCACCTGACCACGCCCGG - Intergenic
936517062 2:113187545-113187567 CACCCGGACCTGTTCACACTGGG - Intronic
936588876 2:113783867-113783889 GGCATGCACCTGTGCACACTAGG - Intergenic
937034866 2:118772622-118772644 CACAGGCACATGTGCGCACACGG - Intergenic
937233226 2:120414312-120414334 CCCACGCACCTGTCAACACCTGG - Intergenic
937906233 2:127054237-127054259 CACAGGCTCCCGCCCACACCAGG + Intronic
938070863 2:128307466-128307488 CACAGGCCCAAGTCCACACATGG + Intronic
938459794 2:131490158-131490180 CACAGGCCCCTGATCACACCTGG + Intronic
943787260 2:191891801-191891823 TACAGGCTCCTGTCCCCATTAGG - Intergenic
943856241 2:192796085-192796107 CACAGACACATGCGCACACTGGG - Intergenic
944236141 2:197443006-197443028 CATAGGCACATTTTCACACTGGG - Intergenic
945220276 2:207476527-207476549 CACAGGCCTCAGTCCACTCTTGG - Intergenic
948514925 2:238497920-238497942 CACAGGCACCTTTGCACATGGGG + Intergenic
1169419539 20:5448963-5448985 TACAGGCAGCTGACCAGACTCGG + Intergenic
1169675922 20:8154765-8154787 CACAGAGAACTGTCCACACAAGG - Intronic
1169901766 20:10560253-10560275 TACAGTCCCCTGGCCACACTGGG + Intronic
1170059170 20:12241508-12241530 CACATGCTCCTGTCCCCAGTAGG - Intergenic
1170605072 20:17869756-17869778 CTCAGGCACCTCTTCCCACTGGG + Intergenic
1171252886 20:23662903-23662925 AAAAGGGAGCTGTCCACACTTGG - Intergenic
1172795722 20:37535871-37535893 CACAGGGGCCTGCCCACACTTGG - Intergenic
1176193604 20:63825983-63826005 CAAAGGCAGCTGTCAACACCGGG + Intronic
1176254266 20:64142659-64142681 CACAAGCACCTGTCCTCACCTGG - Intergenic
1177393625 21:20507141-20507163 CACAGGCACCAGTCCTGACAAGG + Intergenic
1177440639 21:21118857-21118879 CACAGTCACCTGAAAACACTGGG - Intronic
1179393326 21:41013806-41013828 AACAGGCAGCTGGCCAAACTTGG + Intergenic
1179541532 21:42086089-42086111 CGCAGCGCCCTGTCCACACTGGG - Intronic
1179634389 21:42697977-42697999 CACCTGCACCTGACCACAGTGGG + Intronic
1180160783 21:45997885-45997907 CACTGGCTCCTGGCCACAGTCGG + Intronic
1181178415 22:21051013-21051035 TACAGGCACATGTCACCACTTGG - Intronic
1182431781 22:30303136-30303158 CACAGGCACGTCACCACACGTGG - Intronic
1183964609 22:41434323-41434345 CACAGGCACCCACCCACACCAGG - Exonic
1184187141 22:42872300-42872322 CACAGGCCCCTGCCCACCCCTGG - Intronic
1185215102 22:49594268-49594290 CACAGGGCCCTGTCCACACAAGG + Intronic
950490939 3:13304608-13304630 CCCACCCACCTGTCCTCACTTGG + Intergenic
953407549 3:42666916-42666938 CACAGGCTCCTATCCCCAGTGGG - Intergenic
953475374 3:43201542-43201564 CACAAGCACCTGTGGGCACTTGG + Intergenic
953771311 3:45780253-45780275 ACCAGGCACCTGTGAACACTTGG + Intronic
954710705 3:52503899-52503921 CCCAGGCACCTGTGCTCACCTGG - Exonic
955391305 3:58524366-58524388 CACAGGCTCCATGCCACACTAGG - Intronic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
957121827 3:76103616-76103638 CACAGACACCTGTGGATACTGGG + Intronic
957653223 3:83035706-83035728 CCCAAGCACCTTTCCACTCTTGG - Intergenic
960531713 3:118772850-118772872 CCTAGGCCCCTGACCACACTTGG + Intergenic
961604146 3:128081409-128081431 CCCTGGCCCCTGTCCACTCTAGG - Exonic
961605078 3:128087640-128087662 CACAGCCACCAGTGAACACTGGG + Intronic
965751026 3:171975198-171975220 CACAGGCACCTCTACTCAATTGG - Intergenic
967694856 3:192518470-192518492 CATAGGCATCTGTTCACTCTTGG + Intronic
968357875 3:198122553-198122575 CACCGGAACCTGCCCACACCTGG + Intergenic
969613454 4:8239419-8239441 CACAGGCACATGCACACACACGG + Intronic
977476096 4:97511866-97511888 CACAGGTATCTCTCTACACTAGG - Intronic
979214297 4:118144319-118144341 CACAGGCACCTGCCACCACACGG + Intronic
980748806 4:137060342-137060364 CACAGGCCCAGGTCCACACCAGG + Intergenic
980835480 4:138186602-138186624 CACAGGACCCTCTTCACACTAGG - Intronic
985440577 4:189980537-189980559 CACTGGAACCTGCCCACACCTGG - Intergenic
985722452 5:1496871-1496893 CCCAGGCACCTGAGCACCCTGGG - Intronic
985730536 5:1544968-1544990 CACCTGCACCTCTACACACTTGG + Intergenic
986715368 5:10519865-10519887 CACAGGCTCCTGCACACAATAGG - Intronic
986737651 5:10680061-10680083 CCCAGGCAGCTGTGCACACCAGG + Exonic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
996278178 5:121694024-121694046 CCTAGGGACCTCTCCACACTTGG + Intergenic
998184596 5:139968620-139968642 CAGCGCCAGCTGTCCACACTGGG + Intronic
999249686 5:150175273-150175295 CACTGGCACATGGCCAGACTGGG + Intronic
999325627 5:150641598-150641620 AACAAGCAGCTGTCCACAGTGGG + Intronic
999422323 5:151455712-151455734 CCCGGGCAGCTGTCCTCACTTGG - Intronic
1001961676 5:175883606-175883628 CACAGGCCCCTGACCGCACAGGG + Exonic
1003456135 6:6284493-6284515 AAAAGGCCCCTGTCCACCCTGGG + Intronic
1005640772 6:27793937-27793959 CACAGGCACCGTTCTACACGTGG - Intergenic
1006637807 6:35473191-35473213 CTGAGCCACCTGTCCACAGTAGG - Intergenic
1008381285 6:50842026-50842048 CACAGATACCTGGCCACACCTGG - Intronic
1015080129 6:129214180-129214202 CAAATGCACCTGTCCTAACTTGG - Intronic
1016380087 6:143468829-143468851 CACTGGGGCCTGTCGACACTGGG - Intronic
1017474809 6:154779427-154779449 CTCAGGTTCCTCTCCACACTCGG - Intronic
1017674337 6:156797827-156797849 CCCAGGCACCTCTCCTCACCAGG - Intronic
1018920139 6:168166856-168166878 CACAGGCATCTGTCCTAGCTGGG + Intergenic
1019183818 6:170209385-170209407 CACAGGCACCTGCATACAATTGG + Intergenic
1019263119 7:93424-93446 GACCAGTACCTGTCCACACTTGG - Intergenic
1022308666 7:29174442-29174464 GACAGGAACCTGTCCAGACAAGG + Intronic
1022335114 7:29414845-29414867 CCCAGGCTCCTGTCCTGACTTGG + Intronic
1023273445 7:38492195-38492217 CACAGCCACATGACCACACCTGG - Intronic
1024255384 7:47536926-47536948 CACGGGCACCAGTGCACACCCGG + Intronic
1029362594 7:100098273-100098295 CACAGGCACCTGATCACTCTAGG + Exonic
1034085041 7:148314781-148314803 CAGAGGCATCTGACCACACGGGG - Intronic
1035068810 7:156126218-156126240 CACAGGTACCTGTCGGCATTGGG + Intergenic
1035989787 8:4476991-4477013 CACAGCCACCTGTCCATCCTAGG - Intronic
1038516627 8:28193111-28193133 CACAGCCACCAGCTCACACTGGG - Intergenic
1039080329 8:33727846-33727868 AACAGGCACCAAGCCACACTTGG - Intergenic
1039458801 8:37726656-37726678 CAGAGGCACCTGTGCAGACCAGG + Intergenic
1039901841 8:41758266-41758288 CTCAGGCTCCTGTGCACACCTGG - Intronic
1042061670 8:64824600-64824622 CACATGCACCTCACCACATTTGG + Intergenic
1042792720 8:72626247-72626269 CACAGGCCACAGTCCACCCTAGG + Intronic
1042999894 8:74745125-74745147 TACAGGCTCCTGACCACACCTGG - Intronic
1045353372 8:101362629-101362651 CCCACACACCTGTCCACCCTTGG + Intergenic
1045464894 8:102460821-102460843 CACAGTCACATGGCCCCACTCGG + Intergenic
1046213964 8:111117477-111117499 CACACTCCCCAGTCCACACTTGG - Intergenic
1047870503 8:129077128-129077150 AACACACACATGTCCACACTCGG - Intergenic
1048976930 8:139678379-139678401 CACAGCCCCGTGTCCACCCTAGG + Intronic
1049586967 8:143436766-143436788 CACAAGCCCCTGTGAACACTTGG + Intergenic
1050263375 9:3864529-3864551 CAAAGGTACCTGACCACACTTGG - Intronic
1052740340 9:32386184-32386206 CACAGGAACCCCTACACACTTGG - Intronic
1053362318 9:37497503-37497525 CACAGGCAGCAGGCCAGACTTGG - Intronic
1057144162 9:92747346-92747368 CCCAGGCCCCTGGCTACACTGGG + Intronic
1060784533 9:126440081-126440103 CTCAGGCATCTGTCCAAACCAGG - Intronic
1060799390 9:126534063-126534085 CCCATGCACCTGTCCACAAAGGG - Intergenic
1061510658 9:131059053-131059075 TACAGGCACCTAACCACACCTGG - Intronic
1061736038 9:132659851-132659873 AAAAGGCAACTGCCCACACTTGG + Intronic
1062242940 9:135549618-135549640 CCCCTGCACCTGTCCCCACTCGG + Exonic
1062276921 9:135735660-135735682 CACAGGCCTCTGTACTCACTGGG + Intronic
1062361897 9:136192365-136192387 CACCCGCTCCTGTCCACCCTTGG + Intergenic
1062515289 9:136930869-136930891 CACAGGCACACCACCACACTCGG + Intronic
1062572773 9:137193236-137193258 CAGAGGCCCCTGTTCACAGTGGG - Intronic
1062711209 9:137976097-137976119 CACAGACCCCAGCCCACACTGGG - Intronic
1062741746 9:138179097-138179119 CACTGGAACCTGCCCACACCTGG + Intergenic
1185751314 X:2611657-2611679 CACAGGGACCTGTGCACACAAGG + Intergenic
1185751689 X:2615421-2615443 CACAGGGACCTGTGCATACAAGG + Intergenic
1192410030 X:70925943-70925965 CACAGCTACCTTTCCCCACTAGG - Exonic
1199401231 X:147401266-147401288 TAAAGGCACATGTGCACACTCGG - Intergenic
1200251832 X:154558077-154558099 CACAGGCCCCAGTCCACACCCGG - Intronic
1200265935 X:154646339-154646361 CACAGGCCCCAGTCCACACCCGG + Intergenic