ID: 1090263452

View in Genome Browser
Species Human (GRCh38)
Location 11:125339227-125339249
Sequence GTGGGTAATAACCCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090263450_1090263452 -8 Left 1090263450 11:125339212-125339234 CCTGCCTCAGAGGATGTGGGTAA 0: 1
1: 0
2: 0
3: 16
4: 207
Right 1090263452 11:125339227-125339249 GTGGGTAATAACCCTGCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1090263446_1090263452 16 Left 1090263446 11:125339188-125339210 CCTCGCACTTCTGTTTAATAGCT 0: 1
1: 0
2: 0
3: 8
4: 136
Right 1090263452 11:125339227-125339249 GTGGGTAATAACCCTGCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1090263445_1090263452 20 Left 1090263445 11:125339184-125339206 CCGTCCTCGCACTTCTGTTTAAT 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1090263452 11:125339227-125339249 GTGGGTAATAACCCTGCTGCTGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090263452 Original CRISPR GTGGGTAATAACCCTGCTGC TGG Intronic
905485826 1:38295716-38295738 GTGGGTATTTACCATGCCGCAGG - Intergenic
905801489 1:40846790-40846812 GTGGGTGAAATCCCTGTTGCAGG - Intergenic
907807444 1:57835771-57835793 TTAAGTAGTAACCCTGCTGCAGG - Intronic
909326645 1:74359723-74359745 GTGGAGAAAAACCCTGCTGTAGG - Intronic
912272075 1:108221498-108221520 GTGGGTCAGAACCCTGCTACTGG + Intergenic
915355809 1:155254809-155254831 GTGGGTAAGGCCCCTGGTGCTGG + Exonic
1062981381 10:1725596-1725618 GTGGGTAATTCCCCCGCTGTGGG - Intronic
1063475043 10:6320894-6320916 GTGGGAAATCACCTTGCTGAAGG + Intergenic
1063789434 10:9425380-9425402 GTGAGTAATAAACCTTCTGATGG - Intergenic
1070169759 10:73924017-73924039 GCTGGTGATGACCCTGCTGCAGG + Intergenic
1070304403 10:75231056-75231078 GGGGGAAAAAAGCCTGCTGCTGG - Exonic
1070924213 10:80207493-80207515 GTGGGTTATTACCCTGGTGGGGG + Intergenic
1073368856 10:102968575-102968597 GTGAGTTATAACCATGCTACTGG + Intronic
1073879453 10:107963620-107963642 GTGTGTAGTAAACCTGCTACAGG - Intergenic
1074394560 10:113086969-113086991 GGGGGTAATAAACCTCCTACAGG + Intronic
1082332809 11:51242170-51242192 GTGGTGAACAACCCTGCTGATGG + Intergenic
1083941337 11:65897697-65897719 GTGGGTAAGAGCCCAGCTGCTGG - Intronic
1090263452 11:125339227-125339249 GTGGGTAATAACCCTGCTGCTGG + Intronic
1098633981 12:72758008-72758030 GTGTGCTATAGCCCTGCTGCTGG - Intergenic
1103939868 12:124495771-124495793 GTGTGTGATGTCCCTGCTGCCGG - Intronic
1111009402 13:82292392-82292414 TTGGGTAAAAACTTTGCTGCAGG - Intergenic
1114526182 14:23367985-23368007 GTGGGAAATAAGGCTGCTTCTGG + Intergenic
1121892165 14:97604514-97604536 GTGGATAATAACACTGCATCAGG + Intergenic
1122073401 14:99219984-99220006 GTGGGTAATAAACCTGAGGGCGG - Intronic
1125422646 15:39519914-39519936 CTGGGTAGGAACGCTGCTGCTGG - Intergenic
1133101012 16:3479812-3479834 GTGGTTATGAAGCCTGCTGCTGG - Intronic
1133893494 16:9903606-9903628 GTGGCCAATAAGCCTGATGCAGG - Intronic
1141100848 16:81196537-81196559 GTGGGTTATAAGCCAGATGCAGG - Intergenic
1141888241 16:86908056-86908078 CTGGGTGATATCACTGCTGCTGG + Intergenic
1142155310 16:88530244-88530266 GTGGGCAAGGACCCTGCTGGAGG - Intronic
1142194551 16:88733430-88733452 GTCGGTGATGAACCTGCTGCTGG - Exonic
1144187450 17:12809841-12809863 GTGGGAGATAAAGCTGCTGCTGG + Intronic
1149879064 17:60269475-60269497 GTGGGTTATCAGCCTGTTGCAGG - Exonic
1155167854 18:23245864-23245886 GGGGGTTCTAACCCTGCAGCAGG - Intronic
1158392218 18:57052941-57052963 CTGGGTGACAGCCCTGCTGCAGG - Intergenic
1165314346 19:35045602-35045624 AAGGGAAATAGCCCTGCTGCTGG + Intronic
1166054185 19:40278896-40278918 GTGGGTGAGAACCCTGCTCTTGG - Intronic
1167348564 19:48961771-48961793 GGGGGTAATAAACCTCCTTCGGG + Exonic
927146256 2:20168447-20168469 GTGGGGACTGACCCAGCTGCTGG + Intergenic
927805611 2:26144034-26144056 GTGGGGAATATACCTGCTGGTGG - Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
929913873 2:46117345-46117367 GTGGCTAATAATCCTGCTTTGGG + Intronic
931737129 2:65206057-65206079 GGGGGAAAAAAGCCTGCTGCTGG - Intergenic
934681700 2:96288362-96288384 GTGGGAAATCACTTTGCTGCTGG + Intronic
938127587 2:128685658-128685680 GAGGGTAAGATCCTTGCTGCAGG - Intergenic
938614038 2:132979318-132979340 GTGGAGGAAAACCCTGCTGCTGG - Intronic
938987094 2:136587331-136587353 GTGAGTTATAACCTTTCTGCTGG + Intergenic
943079545 2:183241784-183241806 GTGCCTAATTACCCTGGTGCAGG - Intergenic
945052398 2:205836474-205836496 CTGAGTAATAACCTTGCTGATGG + Intergenic
946190542 2:218005553-218005575 GTGTGTAATGACCCTGTTCCAGG + Intergenic
948834485 2:240619606-240619628 GTGGGGAAAATCCCTGCTGGAGG + Intronic
1170161736 20:13320145-13320167 GTAAGCAATAACCCTGCTGAGGG + Intergenic
1172632785 20:36390467-36390489 GTGGTTAATGACCCTGCAGGAGG - Intronic
1174650793 20:52123519-52123541 GTGGGTCATAATCCTTTTGCTGG - Intronic
1177418549 21:20826128-20826150 GTAGGTAATAACTCTGGTTCTGG + Intergenic
1180006257 21:45022257-45022279 GTGTGTAAGACCCCTGGTGCTGG - Intergenic
1182551591 22:31103758-31103780 GGTGGGGATAACCCTGCTGCTGG - Intronic
1183704318 22:39467519-39467541 GTGGGCAGGAGCCCTGCTGCTGG + Intronic
1185199950 22:49495158-49495180 GTGGGTGAGCACCCTGTTGCTGG - Intronic
953792911 3:45962185-45962207 GTGGGGAAAACCCCAGCTGCTGG + Intronic
955248852 3:57257041-57257063 GTGGTAACTTACCCTGCTGCTGG - Exonic
960005302 3:112775473-112775495 GTGGGTAAAATCCCTGCCTCTGG + Intronic
967568747 3:191002614-191002636 AAGAGTAATAACCCTGCTACTGG - Intergenic
989792403 5:45421360-45421382 GTTGTTAAAAACCATGCTGCTGG - Intronic
993308467 5:86298492-86298514 GTGGGTCAGAACCCTGCTACTGG - Intergenic
994325895 5:98444127-98444149 GTAATTAATACCCCTGCTGCTGG - Intergenic
994674245 5:102801580-102801602 GTGGGTTATAACGCTTCTGAAGG - Intronic
1002438180 5:179246284-179246306 GTGGGTTTTAACCCATCTGCTGG + Intronic
1003052718 6:2794339-2794361 GTGGGTTATAAGCCTTCTGAGGG + Intergenic
1007090753 6:39183390-39183412 CTGGGTAATAACACTGTTGTGGG + Intergenic
1012855899 6:104501357-104501379 TTGGGAAATCTCCCTGCTGCAGG - Intergenic
1013178869 6:107701243-107701265 GTTGGTAGCAGCCCTGCTGCAGG + Intergenic
1018564405 6:165136600-165136622 GAGGGCAATGACCCTGCAGCAGG - Intergenic
1018564438 6:165136770-165136792 GAGGGCAATGACCCTGCAGCAGG - Intergenic
1022496526 7:30856386-30856408 GTGGGGAAGAACCCTGCTTGAGG - Intronic
1028272307 7:88807601-88807623 GTGGATGATAATCCTGGTGCTGG + Intronic
1036207553 8:6816056-6816078 GTGGGACATAGCCCTGCTCCTGG - Intronic
1037493600 8:19418633-19418655 GTGAGTAATTACCCTGCAGATGG - Intronic
1048892066 8:138957000-138957022 GGGGGAAACAACCCTGATGCTGG + Intergenic
1051371584 9:16363842-16363864 GTGGATAATTACTCTGCTCCTGG - Intergenic
1051618724 9:19031084-19031106 ATGAGTCATAACCCTACTGCAGG + Intronic
1059581344 9:115551755-115551777 GTAGAGAATAACCCTACTGCAGG - Intergenic
1189992782 X:46610408-46610430 GTGGGTAAGAACCATGCAACAGG + Intronic
1190570001 X:51770966-51770988 GTGGGAAATAACCCTCTTTCAGG + Intergenic
1195466383 X:105183563-105183585 GTGTGCAATGGCCCTGCTGCTGG + Intronic