ID: 1090265551

View in Genome Browser
Species Human (GRCh38)
Location 11:125350987-125351009
Sequence CTGTTGTACGTGTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090265551_1090265562 13 Left 1090265551 11:125350987-125351009 CCCCCTCCCCACACGTACAACAG 0: 1
1: 0
2: 3
3: 59
4: 268
Right 1090265562 11:125351023-125351045 CTGAACAAAGCGCCGCTGCAGGG 0: 1
1: 0
2: 1
3: 1
4: 64
1090265551_1090265564 20 Left 1090265551 11:125350987-125351009 CCCCCTCCCCACACGTACAACAG 0: 1
1: 0
2: 3
3: 59
4: 268
Right 1090265564 11:125351030-125351052 AAGCGCCGCTGCAGGGGTACCGG 0: 1
1: 0
2: 0
3: 5
4: 52
1090265551_1090265563 14 Left 1090265551 11:125350987-125351009 CCCCCTCCCCACACGTACAACAG 0: 1
1: 0
2: 3
3: 59
4: 268
Right 1090265563 11:125351024-125351046 TGAACAAAGCGCCGCTGCAGGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1090265551_1090265561 12 Left 1090265551 11:125350987-125351009 CCCCCTCCCCACACGTACAACAG 0: 1
1: 0
2: 3
3: 59
4: 268
Right 1090265561 11:125351022-125351044 GCTGAACAAAGCGCCGCTGCAGG 0: 1
1: 0
2: 1
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090265551 Original CRISPR CTGTTGTACGTGTGGGGAGG GGG (reversed) Intronic
900967540 1:5969341-5969363 CTGTGGCACGTGTAGGAAGGCGG - Intronic
900995539 1:6121446-6121468 CTGTGGTGTGTGTGGGGTGGAGG - Intronic
901169521 1:7246506-7246528 CTGCTCTTCTTGTGGGGAGGGGG + Intronic
901850560 1:12012231-12012253 CTGTTGGATGTATGGGGAGCTGG + Exonic
902142671 1:14369994-14370016 CTCATGCACGTGTGGGGAGGTGG - Intergenic
903115509 1:21176202-21176224 CTGATGTTCGGGTGAGGAGGGGG + Exonic
903723972 1:25427437-25427459 CTGGTGAAGGTGTGGGGAGCTGG + Intronic
903760481 1:25694663-25694685 CTGGTGTGTGTGTGTGGAGGGGG - Intronic
903867584 1:26410553-26410575 CAGTTGTGCGTGTGGGGAGGGGG + Intergenic
903891120 1:26571405-26571427 CAGTTCTCAGTGTGGGGAGGTGG - Intronic
906333923 1:44911853-44911875 CTGTTGTGGGTTGGGGGAGGGGG - Intronic
906911676 1:49958688-49958710 CTGTTGTGGGGTTGGGGAGGGGG + Intronic
907325597 1:53636961-53636983 CTGTTGTACGTGAGGGGCTAGGG - Intronic
907470912 1:54673002-54673024 CTGGTGTAGGTCAGGGGAGGAGG - Intronic
908865492 1:68544514-68544536 CTGTTGTAGGGTGGGGGAGGGGG - Intergenic
909780515 1:79540959-79540981 CTGTTGGGGGTGGGGGGAGGGGG - Intergenic
909962966 1:81871081-81871103 CTGTTGGGGGTGGGGGGAGGGGG - Intronic
910346519 1:86245126-86245148 CTGTTGTAGGGTGGGGGAGGGGG + Intergenic
911312772 1:96316387-96316409 CTGGTGTGGGGGTGGGGAGGTGG - Intergenic
911371850 1:97003466-97003488 CTGTGGTACATGGGGGGTGGCGG + Intergenic
911744921 1:101430896-101430918 ATGTTGGAGGTGTGGGGAGAGGG - Intergenic
912413827 1:109494940-109494962 CTGTTGTATGTGTGTGGATAAGG + Intronic
912758056 1:112341279-112341301 CTGTTGTGGGTGGGAGGAGGGGG + Intergenic
913433540 1:118822896-118822918 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
914762959 1:150613770-150613792 CTTTTGTACGTGTGAGCAGGTGG + Intronic
915780561 1:158545322-158545344 ATGTTGTGGGTGGGGGGAGGGGG + Intergenic
915782443 1:158567638-158567660 CTGTTGTGGGTTGGGGGAGGGGG + Intergenic
916981825 1:170145949-170145971 CTGTCATGGGTGTGGGGAGGAGG - Intergenic
917512732 1:175681666-175681688 CTGTTGTACAGGTGGAGACGTGG - Intronic
917783630 1:178427921-178427943 ATGTGATAGGTGTGGGGAGGTGG - Intronic
918855334 1:189747465-189747487 CTGTTGTTGGGGAGGGGAGGGGG + Intergenic
919656435 1:200201443-200201465 CTGTGGTGGCTGTGGGGAGGTGG - Intergenic
919855222 1:201701256-201701278 CTGTTGTGGGGGTGGGGAGCTGG + Intronic
920818138 1:209354800-209354822 TTGTTGTTGTTGTGGGGAGGAGG + Intergenic
921487657 1:215733954-215733976 CTGTTGGAGCTGTGGGAAGGGGG - Intronic
922619307 1:226980504-226980526 CTGTGGTACTTGTGGGCTGGGGG - Intronic
923874959 1:238037258-238037280 CTGTTGTGCGTCGGGGGAGGGGG - Intergenic
1063124907 10:3129115-3129137 CTGATGTATGGGTGGGAAGGCGG + Intronic
1064216784 10:13407037-13407059 CTCATGTAAGTCTGGGGAGGTGG + Intergenic
1064927960 10:20591002-20591024 CTCTTGTGCGTGTGTGGAGGAGG + Intergenic
1065446029 10:25800524-25800546 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1066211318 10:33241630-33241652 CTGTTGTATGTGTGTGGTGGTGG + Intronic
1066578806 10:36857177-36857199 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1067031947 10:42884215-42884237 CTGTTGGGAGTGTGGGGAGTGGG + Intergenic
1068150868 10:53129025-53129047 CTGTTTTATGTGTGTGGTGGGGG + Intergenic
1069224751 10:65929022-65929044 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1069717245 10:70529215-70529237 CAGTTGTACCTGGGGGGGGGGGG - Exonic
1069748865 10:70733121-70733143 ATGTTGCAGGTGTGGAGAGGAGG - Intronic
1070834510 10:79439706-79439728 CTCTTGAACCTGGGGGGAGGTGG + Intronic
1072022162 10:91412850-91412872 CCTTGGTATGTGTGGGGAGGGGG + Intronic
1072637804 10:97188494-97188516 CCGCTGCACGGGTGGGGAGGAGG + Intronic
1073213284 10:101821828-101821850 CTGTTGTAGGTGTTGGGGGTGGG - Intergenic
1074346629 10:112692560-112692582 CTGTTTTTATTGTGGGGAGGTGG + Intronic
1074463727 10:113663846-113663868 CTGTTCTAGGTGTGGGTATGGGG - Exonic
1074627724 10:115211758-115211780 CTGTTGTGGGTGAGGGGAGGGGG - Intronic
1075304900 10:121359149-121359171 CTGTTGAGGGTGTGGGGAGAGGG - Intergenic
1075419746 10:122291873-122291895 GTGTTGGGGGTGTGGGGAGGAGG + Intronic
1076578195 10:131485956-131485978 CTGCTCTACGAGTGAGGAGGAGG - Intergenic
1076620103 10:131781506-131781528 CTGTTGAATGTGTGTGGAAGGGG - Intergenic
1076922557 10:133462143-133462165 CTGTCCCACGTGTGGGCAGGTGG + Intergenic
1078309523 11:10226476-10226498 CTGTTGTGGGGTTGGGGAGGGGG - Intronic
1078718926 11:13865717-13865739 CTGTTGTGGGTTGGGGGAGGGGG - Intergenic
1081326905 11:41756206-41756228 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1081597049 11:44466631-44466653 CTGGTGAAGGTGTGAGGAGGTGG + Intergenic
1082072219 11:47948331-47948353 CTGCTGTAAGTGGGTGGAGGAGG + Intergenic
1084687110 11:70703226-70703248 CTGGTTTACGGGTGAGGAGGGGG + Intronic
1087258096 11:95979445-95979467 CAGGTGTACCTGTGGGGAAGCGG + Exonic
1087452429 11:98342270-98342292 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1088094441 11:106081852-106081874 CTGTTGTGGGTGGGGGAAGGGGG + Intronic
1088832486 11:113549419-113549441 GTGGTGTAGGTCTGGGGAGGGGG + Intergenic
1089339642 11:117748804-117748826 CTGTTGGACGTGGGCAGAGGAGG - Intronic
1089619336 11:119713527-119713549 CTGGGGTAAGGGTGGGGAGGGGG - Intronic
1090265551 11:125350987-125351009 CTGTTGTACGTGTGGGGAGGGGG - Intronic
1093124112 12:15307504-15307526 CTGGTGGGGGTGTGGGGAGGTGG - Intronic
1095074379 12:37898377-37898399 CTGTTGTGGGTTGGGGGAGGGGG + Intergenic
1095556625 12:43513905-43513927 CTGTTGCGGGTGAGGGGAGGGGG + Intronic
1095584447 12:43835568-43835590 CTGTTGGTGGTGTGGGGATGTGG - Intergenic
1095916000 12:47479327-47479349 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1096092457 12:48912175-48912197 CACTTGAACCTGTGGGGAGGAGG + Intronic
1096181247 12:49551696-49551718 GACTTGTACATGTGGGGAGGTGG + Intronic
1096826847 12:54285844-54285866 GTGTTGGAAGTTTGGGGAGGAGG + Intronic
1096938814 12:55317763-55317785 CTGTTGTAAGTGTGATGAGTTGG + Intergenic
1097531607 12:60808722-60808744 CTGTTGGAGGTGGTGGGAGGGGG - Intergenic
1097736850 12:63191953-63191975 CTGTTGTGGGTGGGAGGAGGTGG + Intergenic
1099159140 12:79218524-79218546 CTGTGGTGATTGTGGGGAGGTGG - Intronic
1099423554 12:82494423-82494445 CTGTTGTGGGTGGGGGGAGCGGG + Intergenic
1100580734 12:95937825-95937847 CTGTTCTACGTGTGGGGGACAGG + Intronic
1102042711 12:109810816-109810838 CTGGGGTAGGGGTGGGGAGGAGG + Intronic
1102291203 12:111701579-111701601 CAGTTGTACCTGTGAGGTGGAGG + Intronic
1103327818 12:120133175-120133197 GTGTTGCAGGTGTGGGCAGGAGG + Intronic
1104362268 12:128145023-128145045 CTTTTGTGTGTGTGGTGAGGAGG - Intergenic
1104636865 12:130442939-130442961 GTGTTGTTCGTGTTGGGAGGGGG - Intronic
1104826293 12:131711594-131711616 CTGGTGTTCTGGTGGGGAGGGGG + Intronic
1104854571 12:131895741-131895763 TTGTTATCAGTGTGGGGAGGGGG - Intronic
1105970903 13:25428620-25428642 GTGTTTTAAGTGTGAGGAGGTGG + Intronic
1106972680 13:35161946-35161968 CTGATGTACATGTTTGGAGGAGG + Exonic
1109014536 13:56992801-56992823 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1109110347 13:58310259-58310281 TTCTTGTACGTGTGTGGAGGAGG - Intergenic
1110086264 13:71384707-71384729 CTGCTGTGGGTGGGGGGAGGGGG - Intergenic
1111136158 13:84047023-84047045 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1111578420 13:90189984-90190006 CTGTTGTGGGTGTGGGCAAGAGG - Intergenic
1111580800 13:90220653-90220675 CTGTTGTGGGGGTGGGGAGGGGG + Intergenic
1112012925 13:95307243-95307265 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1112143674 13:96674215-96674237 CTGTTTTACATGGGGGGAGCAGG - Intronic
1112714275 13:102165659-102165681 CTGTTGTGGGTGGGGGGAGGGGG + Intronic
1114077618 14:19169792-19169814 CTGTGGTACCTGGGGGGGGGGGG - Intergenic
1114347742 14:21814484-21814506 CTGTTGTGGGTGGGGGAAGGGGG + Intergenic
1114363788 14:22005147-22005169 CTGTTGTGGGTGGGAGGAGGGGG - Intergenic
1116538545 14:46066534-46066556 CTGTTGTGGGTTGGGGGAGGGGG + Intergenic
1118626522 14:67664402-67664424 CTGTTGCACGTATGGGGATATGG + Intronic
1118728840 14:68652429-68652451 CTGTTGGAGGGCTGGGGAGGGGG - Intronic
1118751221 14:68808962-68808984 CTGGTGTCCTTCTGGGGAGGGGG - Intergenic
1122160889 14:99783138-99783160 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1122186877 14:100006014-100006036 GTGTTGTCGGTGTGGGGGGGGGG - Intronic
1122833925 14:104421772-104421794 CTGGTGGGAGTGTGGGGAGGGGG - Intergenic
1123786633 15:23681336-23681358 CTGTTGGGGGTGGGGGGAGGGGG + Intergenic
1129293732 15:74587930-74587952 CTTTCCTAAGTGTGGGGAGGGGG - Intronic
1129455976 15:75676361-75676383 CTGCTGCATGTGTGGGCAGGTGG - Exonic
1129682282 15:77664585-77664607 CTCAGGTATGTGTGGGGAGGTGG + Intronic
1130138531 15:81202472-81202494 CTGTTGTGGGTGTAGGGAGGGGG - Intronic
1130736941 15:86560286-86560308 CTGTTGCGGGGGTGGGGAGGGGG - Intronic
1130850540 15:87789404-87789426 CTGTTGTGAGTGGGGGGAGGGGG + Intergenic
1132159928 15:99531236-99531258 TTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1132390961 15:101437782-101437804 CTGTTGTCAGTGAGTGGAGGTGG - Intronic
1132573771 16:655645-655667 CTGGAGTCCGTGTGGGGAGCAGG - Exonic
1133321858 16:4919062-4919084 CCGGTGTGTGTGTGGGGAGGGGG - Intronic
1134461566 16:14434094-14434116 CTGGTGTGTGTGTGTGGAGGAGG + Intergenic
1135001200 16:18778362-18778384 CTGTTGTGGGTGGGGGGACGGGG + Intergenic
1136593050 16:31229240-31229262 CTGCTGTTCGTGTGGGAGGGAGG + Intergenic
1137343564 16:47634401-47634423 ATGTTCCATGTGTGGGGAGGTGG + Intronic
1138307912 16:55995108-55995130 CTGTTGGGTGGGTGGGGAGGAGG + Intergenic
1140666869 16:77235937-77235959 CTTTTGTATGTTTGGCGAGGGGG - Intergenic
1141627385 16:85268473-85268495 CTCTTCTATGAGTGGGGAGGGGG + Intergenic
1141867746 16:86762320-86762342 CTGCGGTGTGTGTGGGGAGGGGG + Intergenic
1142217251 16:88835913-88835935 CCGTGGGACGTGTGGGGACGGGG - Intronic
1142298695 16:89243703-89243725 CTGTTGTGTGTGTGTGGTGGTGG + Intergenic
1143159813 17:4862081-4862103 CTGTTCTACTTGTGGAGATGAGG + Intronic
1146627205 17:34443856-34443878 GTGTCGTAGGGGTGGGGAGGAGG - Intergenic
1148754729 17:49967093-49967115 CTGTTGGACGAGAGGGGAGTGGG + Intergenic
1149636763 17:58177196-58177218 CTGGTGTTGGTGTGGGGAGGAGG - Intergenic
1149721147 17:58845762-58845784 CTCTTGAACGTGGGAGGAGGAGG - Intronic
1152287713 17:79422330-79422352 GGGTTGAATGTGTGGGGAGGGGG - Intronic
1153013744 18:564942-564964 GTTGTGTACGTGTGAGGAGGAGG + Intergenic
1154132808 18:11751224-11751246 GTGTTGTACTTGGGGGAAGGAGG - Intronic
1156343563 18:36235278-36235300 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1158819728 18:61145599-61145621 CTGTGGTAGGGGGGGGGAGGGGG + Intergenic
1159558139 18:69966437-69966459 CTGTTGTGGGGGGGGGGAGGGGG + Intergenic
1160344643 18:78123325-78123347 CTGTTGTAAGGGGAGGGAGGCGG - Intergenic
1160523452 18:79522035-79522057 GTGTTTTGTGTGTGGGGAGGGGG + Intronic
1160586901 18:79918060-79918082 TTGTCGTAGGTGTGGGGTGGTGG - Intronic
1161043227 19:2121084-2121106 CTGATGTACCTGTGGGGCAGAGG + Exonic
1162065862 19:8125054-8125076 AGGCTGTACGTGTGTGGAGGTGG + Intronic
1162822184 19:13229691-13229713 CTCTTGAGAGTGTGGGGAGGAGG - Intronic
1164329329 19:24237220-24237242 CTGTTGTGGGTGGGGGAAGGGGG + Intergenic
1165400545 19:35596854-35596876 CTGTTGTACGTGGTTGGAGAGGG + Intergenic
1165489426 19:36114705-36114727 ATGTTGTTACTGTGGGGAGGGGG + Exonic
1166967369 19:46537400-46537422 CTGTTGTCACTGTGGGGAAGTGG + Intronic
1167375495 19:49108750-49108772 CTGTTGAAAGTGGGGTGAGGCGG + Intergenic
1167382022 19:49143765-49143787 CTGTTGTGTGTGTGGGGTGGAGG + Intronic
925671267 2:6311999-6312021 TTGTTGAATGAGTGGGGAGGAGG - Intergenic
926104630 2:10142525-10142547 CCGTTCTACGTGTGGCCAGGCGG + Intronic
927653478 2:24926733-24926755 CTGTTGTGCGGGTGGAGAAGCGG + Intergenic
928419699 2:31128699-31128721 GTGGGGTACTTGTGGGGAGGGGG + Intronic
929147812 2:38722041-38722063 CTGTTCTAGGTGGGGGGGGGGGG - Intronic
929150714 2:38745849-38745871 CTATTGTACATGTGGGGAAAAGG + Intronic
930683009 2:54277592-54277614 CTGTTGTACTTGGGAGGCGGAGG + Intronic
930770682 2:55127745-55127767 CTATTGTACCTCTGTGGAGGGGG + Intergenic
930857432 2:56033736-56033758 CTGTTGTGGGTGGGGGGTGGGGG + Intergenic
932776370 2:74530358-74530380 CTGTTGTTGTTGTGGGGCGGGGG + Exonic
932795602 2:74692548-74692570 CTGTTGGATGTGTGGCAAGGAGG + Intergenic
932901247 2:75702895-75702917 TTCTTGTAAGTGTGGGTAGGAGG - Intronic
934779400 2:96960270-96960292 CTCAGGTAAGTGTGGGGAGGAGG - Exonic
935539994 2:104337662-104337684 CTGTTGTCGGTGGGGGTAGGGGG + Intergenic
935545311 2:104394816-104394838 CTGTTGCAAGTGTGGCAAGGGGG - Intergenic
936667873 2:114618550-114618572 GGGTTGTTGGTGTGGGGAGGCGG + Intronic
936939697 2:117871458-117871480 CTGTTGTGGGTGGGGGAAGGGGG - Intergenic
937802966 2:126102268-126102290 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
938067981 2:128292198-128292220 CTGGTGAAGGTGTGGGGAGAGGG + Intronic
938520257 2:132063021-132063043 CTGTTGGTGGTGGGGGGAGGGGG - Intergenic
939139822 2:138341275-138341297 TTATTGTACCTGTGGGCAGGTGG + Intergenic
940648701 2:156418736-156418758 CTGGTGTACGTTATGGGAGGGGG + Intergenic
941462103 2:165783829-165783851 CTGTTTTATATCTGGGGAGGTGG - Intronic
941726977 2:168871201-168871223 CTGTTGTGGGTTGGGGGAGGGGG + Exonic
942955360 2:181766778-181766800 CTGTTGTGGGGTTGGGGAGGGGG - Intergenic
943291558 2:186078636-186078658 CTGTTGTGGGTGGGGGGAGTGGG + Intergenic
944026944 2:195181885-195181907 CTGTTGTGGGGGTGGGGTGGGGG - Intergenic
945102691 2:206275696-206275718 ATATGCTACGTGTGGGGAGGGGG + Intronic
946384794 2:219376402-219376424 CTCTTGCACCTGTGGGGAGGAGG + Intronic
946541590 2:220689946-220689968 CTGTTGTGTGTGTGGAGTGGGGG + Intergenic
946861104 2:224001139-224001161 CTGTTGTGGGCTTGGGGAGGGGG + Intronic
948063860 2:235062141-235062163 TTGCTGTACGTGGGGAGAGGAGG + Intergenic
948666254 2:239536436-239536458 CTGGTGCAGGTGTTGGGAGGGGG + Intergenic
1168772052 20:421643-421665 CTGCTGTAGGTGTGGGGTGTGGG + Intronic
1169806755 20:9567667-9567689 CTGTTTTAGGTGTGAGGGGGAGG + Intronic
1169961743 20:11167868-11167890 CTGTTGTACATGTGGGGTCTTGG + Intergenic
1171993997 20:31718298-31718320 GTGGTGTGCGTGTGGGGAGAAGG - Intronic
1173840666 20:46154698-46154720 CAGTTGGGCCTGTGGGGAGGAGG + Intergenic
1173960955 20:47072171-47072193 CTGTTGTGCCTGTGGGAAGGAGG - Exonic
1174023644 20:47553545-47553567 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1175909063 20:62395981-62396003 CTGTGAGATGTGTGGGGAGGAGG - Intronic
1178494477 21:33075421-33075443 CTTTTGTGTGTGTGGGGGGGTGG + Intergenic
1179536894 21:42058735-42058757 CTGTTTTAGGTGTCGGGAAGTGG + Intergenic
1180456945 22:15517801-15517823 CTGTGGTACCTGGGGGGGGGGGG - Intergenic
1181007032 22:20018519-20018541 CTCTTGCAAGTGTGGGGAGGGGG - Intronic
1182139296 22:27938934-27938956 CTGTTTTGGGGGTGGGGAGGAGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182722595 22:32415363-32415385 TTGTTGTTTGTTTGGGGAGGTGG - Intronic
1184632164 22:45790380-45790402 CTGGTGTATGTGTGGGGCGGCGG - Intronic
1185060114 22:48602291-48602313 CTGGTGTGCTTGTGGGGGGGTGG - Intronic
949646506 3:6101290-6101312 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
950151228 3:10688970-10688992 CTGGTGTGGGGGTGGGGAGGAGG + Intronic
950919783 3:16682585-16682607 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
953151971 3:40333112-40333134 CTGGTGTACGTGTGAAGTGGAGG - Intergenic
954632993 3:52056892-52056914 CTGTTGTGAATGTGGGGTGGGGG - Intergenic
955422993 3:58758684-58758706 CTGTTGTGGGTGAGGGGAAGGGG - Intronic
956447327 3:69338301-69338323 CTGTTGTGAGTGGGGAGAGGGGG + Intronic
956682143 3:71790768-71790790 CTGGTGTATGTGTGGGGAGGTGG - Intergenic
957041286 3:75337355-75337377 CTGTTTTACGGATGGGGAAGTGG - Intergenic
958107658 3:89098225-89098247 CTGTTGTAGGGTGGGGGAGGGGG - Intergenic
959949174 3:112160416-112160438 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
959962508 3:112314845-112314867 CTGTTTTACATGTGAAGAGGAGG + Intergenic
960618977 3:119621297-119621319 CTTCTGAAGGTGTGGGGAGGTGG - Intronic
963178228 3:142324242-142324264 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
964144502 3:153442733-153442755 GTGTTGTGCTGGTGGGGAGGGGG - Intergenic
965029836 3:163351891-163351913 CTGTTGTGGGTGGGGGCAGGGGG - Intergenic
965177984 3:165361094-165361116 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
965238142 3:166155871-166155893 CTGTTGTAGGGTGGGGGAGGGGG - Intergenic
967003003 3:185354596-185354618 CTGTTATAAGTATGGGGGGGGGG + Intronic
968917474 4:3502887-3502909 CTGTTGAAGATGTGAGGAGGTGG + Intergenic
969162530 4:5273836-5273858 CTGTGGTGGGTGGGGGGAGGGGG + Intronic
970041177 4:11798584-11798606 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
971466408 4:26967816-26967838 CTGTTGGAGGAGGGGGGAGGGGG - Intronic
974459362 4:62167234-62167256 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
975244363 4:72102522-72102544 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
975636678 4:76457186-76457208 CTGTTGGAAGTGGAGGGAGGTGG + Intronic
978781007 4:112554199-112554221 GTGTTGTGGGTGGGGGGAGGGGG - Intronic
980604454 4:135071213-135071235 CTGTTGTGGGAGGGGGGAGGGGG + Intergenic
980723639 4:136728604-136728626 TTGGTGTCCTTGTGGGGAGGTGG + Intergenic
981114162 4:140970466-140970488 ATATTGTATGGGTGGGGAGGGGG - Intronic
981344446 4:143659239-143659261 CTGTTGTTGGTGGGGGTAGGGGG - Intronic
982464320 4:155711202-155711224 TTGTTGTACGAGTGAGGAGATGG + Exonic
982533048 4:156571731-156571753 CTGTTGTGTGTGTTGGGGGGTGG + Intergenic
983928371 4:173426939-173426961 CTGATGTATTTGTGAGGAGGAGG + Intergenic
986463027 5:7992856-7992878 CTTTTGTGCGTGTGGAGAGAGGG + Intergenic
987699401 5:21376526-21376548 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
988081983 5:26426459-26426481 CTGTTGTGGGGGTGGGGGGGAGG + Intergenic
990151268 5:52820367-52820389 CTGTTGTGGGTGGGGGGAGGGGG + Intronic
992949506 5:81844366-81844388 CTGATGAATGTGTGGGGAGTGGG + Intergenic
994576858 5:101589304-101589326 CTGTTGTTGGGGTGGGGAGGGGG + Intergenic
994584219 5:101684998-101685020 CTGTTGTAGTTGGGGGAAGGGGG - Intergenic
997087978 5:130823595-130823617 CTGTTGTGGGTTGGGGGAGGGGG + Intergenic
997681033 5:135750775-135750797 CCCTCCTACGTGTGGGGAGGGGG + Intergenic
998462439 5:142319735-142319757 CATTTGTACCTGTGGGGAGGGGG + Exonic
999484577 5:151983120-151983142 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
999570410 5:152913824-152913846 CTGTTGTGGGTGGGGGGATGGGG - Intergenic
1000119911 5:158187572-158187594 CTGTTGTGTGTGGGGGGAGGAGG + Intergenic
1000397194 5:160788268-160788290 CTGTTGGCCAAGTGGGGAGGAGG - Intronic
1000840502 5:166212111-166212133 CTGTTGGTAGAGTGGGGAGGTGG - Intergenic
1001116589 5:168945735-168945757 TTGTTGCACGTGTTGGGAGGAGG - Intronic
1002762833 6:215056-215078 CTGGTGTATGTGTTTGGAGGTGG - Intergenic
1002893785 6:1362102-1362124 CTGTCGTGGGTGGGGGGAGGGGG + Intergenic
1003172700 6:3732848-3732870 CTGACATACGTGTAGGGAGGTGG - Intronic
1004190634 6:13460659-13460681 CTGTTGGGGGTGTGGGGAGAGGG + Intronic
1008153579 6:47987245-47987267 CTGTTGTGGGTGGGGGGAGGGGG + Intronic
1008495113 6:52125260-52125282 CTTTTGTATTTGGGGGGAGGTGG + Intergenic
1008509250 6:52260911-52260933 CTGCTGTACATGTAGGGAAGTGG - Intergenic
1011596606 6:89022542-89022564 TTGCTGTACTTGTGGGGAGATGG - Intergenic
1012627730 6:101424713-101424735 CTGTTGTGGGTGGGGGGAGAGGG - Intronic
1013681790 6:112532441-112532463 CTGTTGTGGGTGGGGGGACGGGG - Intergenic
1014040797 6:116822705-116822727 CTGTTGTGGGTTGGGGGAGGGGG + Intronic
1014847545 6:126296980-126297002 CTGTTGTAGGTGAGGGGAGAAGG - Intergenic
1017024816 6:150172460-150172482 CTGTGGTGCAGGTGGGGAGGCGG + Intronic
1017515547 6:155152798-155152820 CTGTTGTGTGTGTGTGGTGGTGG + Intronic
1018632485 6:165833355-165833377 CTGTTCTAGGTGTAGTGAGGTGG + Intronic
1021652085 7:22842239-22842261 CTGGTGTATGTGTGTGGCGGGGG - Intergenic
1026848819 7:73712319-73712341 CAGTTGTAGGTGTGGGGGAGTGG - Intronic
1028509202 7:91604025-91604047 CTGGTGTGTGTGTGGGTAGGTGG + Intergenic
1028740717 7:94271258-94271280 CTGTTGTGGGTGAGGGGAGAGGG + Intergenic
1028821322 7:95215117-95215139 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1032999126 7:137483593-137483615 CTGTTGTAAGGGTGGGAAGAAGG - Intronic
1033155197 7:138950866-138950888 CTGATGAAAGTGTGGCGAGGTGG - Intronic
1033198943 7:139351905-139351927 CTCTTAAACATGTGGGGAGGTGG + Intronic
1034371660 7:150603298-150603320 CTGTTGTACATTGGGGGAAGGGG + Intergenic
1035869699 8:3124131-3124153 CCTGTGTGCGTGTGGGGAGGGGG + Intronic
1037987761 8:23300210-23300232 CAGTGTTACGTGTGGGGTGGAGG + Intronic
1038103015 8:24400783-24400805 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1038478612 8:27886252-27886274 CTGTTGACCCTGTGGGCAGGCGG - Intronic
1038588768 8:28816299-28816321 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1038786479 8:30622119-30622141 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1039139536 8:34370572-34370594 ATGTTGTATGTGTGTGGTGGTGG - Intergenic
1040479326 8:47809285-47809307 CTGTGGTTGGTGTGGGGATGAGG - Intronic
1041297267 8:56370889-56370911 CTGTTGTGGGTGGGGGGAGGGGG - Intergenic
1041771885 8:61480845-61480867 CTGTTTTAAGTGTTGGTAGGAGG + Intronic
1042342740 8:67697151-67697173 CTGTTGTACTTGTGGGGGTATGG + Intronic
1043202071 8:77382851-77382873 CTGTCGTGGGTGGGGGGAGGGGG - Intergenic
1043343603 8:79272598-79272620 CTGTTGTGGGGTTGGGGAGGGGG - Intergenic
1044273129 8:90270085-90270107 CTGTTGTGGGTGGGGGGAGTGGG + Intergenic
1045473712 8:102535947-102535969 CTGTAGTACCTGTGGGTGGGCGG - Intronic
1046880050 8:119298025-119298047 CTGTTGTGGGTGTGGGGAGGGGG + Intergenic
1047619182 8:126588889-126588911 CTTTTGTATGACTGGGGAGGTGG - Intergenic
1049575753 8:143388899-143388921 CTGTGCTGCGGGTGGGGAGGAGG + Intergenic
1050400428 9:5247893-5247915 CTGTTGTGCAGGTGGGGTGGGGG + Intergenic
1052054622 9:23890370-23890392 CTGTTGAAGGTGTAGGGAGAGGG - Intergenic
1052814589 9:33091400-33091422 CTGTTGGGGGTGGGGGGAGGGGG + Intergenic
1053458439 9:38250018-38250040 CTGGTGTCGGGGTGGGGAGGGGG + Intergenic
1058643856 9:107112390-107112412 CTGTTGTGTGTGTGGGGAGACGG - Intergenic
1058686093 9:107481088-107481110 ATGTTCTACCTGTGGGGGGGAGG - Intergenic
1058971389 9:110086552-110086574 CTGTTGTACCTGTGGGCATTGGG + Intronic
1060356327 9:122912484-122912506 CTGTTGTAGTGGTGGGGAGTAGG - Intronic
1061441951 9:130611234-130611256 CTCTTGTGCGTGTGGCCAGGAGG - Intronic
1061604031 9:131694944-131694966 CTGTTGTGGGTGGGGGGAGGGGG - Intronic
1061664007 9:132149788-132149810 CTGGTGGAGGTGTGAGGAGGGGG + Intergenic
1061920175 9:133778361-133778383 CTGAGGTAGGGGTGGGGAGGAGG + Intronic
1185568432 X:1114419-1114441 CTGATGTAGTTGTGGGGTGGGGG - Intergenic
1186947225 X:14582213-14582235 CTGTTGTGGGGGTGGGGAGGGGG - Intronic
1188194023 X:27208437-27208459 CTGTTGTGGGGGGGGGGAGGGGG + Intergenic
1189609868 X:42720897-42720919 CTGTTGTGGGTGTGGAGAGGGGG - Intergenic
1190126504 X:47710178-47710200 CTGTTATTTCTGTGGGGAGGTGG + Intergenic
1190595469 X:52049153-52049175 CTGTTGTGGGTAGGGGGAGGGGG + Intergenic
1190613355 X:52204920-52204942 CTGTTGTGGGTAGGGGGAGGGGG - Intergenic
1191879003 X:65825641-65825663 CTGTTGTGGGTGGGGGGAGGGGG + Intergenic
1193454511 X:81713695-81713717 CTGTTGTGGGTGGGAGGAGGGGG + Intergenic
1193579536 X:83247178-83247200 CTGTCGTGAGTGGGGGGAGGGGG + Intergenic
1194995569 X:100588235-100588257 CTGAGGTATGTGAGGGGAGGAGG - Intronic
1195646660 X:107238382-107238404 ATGTTGTCCTTTTGGGGAGGTGG + Intronic
1196541625 X:116917287-116917309 CTGTTGTGGGTGGGGGGAGCGGG - Intergenic
1197905187 X:131417237-131417259 ATGTTGTATGTGTGGGTAAGGGG - Intergenic
1198845405 X:140905260-140905282 CTGTTGAAAGTGTGTGGATGAGG + Intergenic
1201651297 Y:16290575-16290597 CTGTTGTGGGTTGGGGGAGGGGG - Intergenic
1202058372 Y:20859729-20859751 CTGTTATAAGTGTGGAAAGGAGG + Intergenic