ID: 1090265731

View in Genome Browser
Species Human (GRCh38)
Location 11:125351716-125351738
Sequence TACCTGGGTCTCCCCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090265731_1090265733 -9 Left 1090265731 11:125351716-125351738 CCACAGTGGGGGAGACCCAGGTA 0: 1
1: 0
2: 0
3: 14
4: 158
Right 1090265733 11:125351730-125351752 ACCCAGGTACCGGATGTGAGCGG 0: 1
1: 0
2: 0
3: 1
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090265731 Original CRISPR TACCTGGGTCTCCCCCACTG TGG (reversed) Intronic
900554141 1:3271359-3271381 TCCCTGGGTCTCCCACAGTGGGG + Intronic
900950876 1:5857813-5857835 TACCTGGGACTCCCCCGATGAGG - Intergenic
901014293 1:6219104-6219126 TTCCTGGTTCTCACTCACTGAGG + Intronic
903232329 1:21929519-21929541 TACCTTGGTCTCCCAAAGTGTGG + Intronic
903363819 1:22793712-22793734 CACCTGTGTGTCCCGCACTGTGG + Intronic
905019164 1:34796566-34796588 TACCTGGGTCGCCTCCACATAGG - Intronic
910437147 1:87216787-87216809 TTCCTGTGTCTCCCCTACTCAGG - Intergenic
910627012 1:89317441-89317463 TGCCTGGGTATCACCCATTGGGG - Intergenic
915363576 1:155300901-155300923 TCTCTGGGTCTCCCTCTCTGTGG + Intronic
915528838 1:156491848-156491870 GACCTGGGTCACCCCCACCCAGG + Intronic
917079109 1:171237947-171237969 TGACTGGGTTTCCCCCAGTGAGG + Intergenic
920959194 1:210649407-210649429 TACCTTGGTCTGACCCACTCAGG - Intronic
922215350 1:223515810-223515832 TACCTGTGTGTCTCCCTCTGGGG - Intergenic
922801860 1:228368146-228368168 TGCCTGCCCCTCCCCCACTGAGG + Intronic
924772381 1:247088982-247089004 TGCCTCAGTTTCCCCCACTGTGG + Intergenic
1064698252 10:17989491-17989513 AGCCTGAGTCTCCCCCAGTGAGG + Intronic
1072247582 10:93556903-93556925 AACCTGAGTCTGCTCCACTGGGG + Intergenic
1073290664 10:102411777-102411799 TTCCTGGGTCTCACCCATTAAGG + Exonic
1074829032 10:117235798-117235820 AACCTGGGTTTCCCTCACTAGGG - Intergenic
1077727589 11:4690958-4690980 TACATGTGTCTCCCACATTGTGG - Intronic
1078171464 11:8932118-8932140 TACCTGTCTCTGCCCCTCTGGGG - Intronic
1083423702 11:62571563-62571585 TACCTGGGTGTTCCCCACCTTGG - Exonic
1083632428 11:64102638-64102660 TACCTGGTTTTCCCTCCCTGGGG - Intronic
1084867448 11:72070680-72070702 TGCCTGGGTCCCACCCACTTGGG + Intronic
1085739236 11:79064914-79064936 GACATTGGCCTCCCCCACTGCGG - Exonic
1087264131 11:96042457-96042479 TCCCGTGGTCTTCCCCACTGAGG + Intronic
1087528255 11:99346491-99346513 TACCGAGGTCTCCACTACTGTGG + Intronic
1089384804 11:118060536-118060558 TCCCTGGGTTTCCACCACTAAGG - Intergenic
1090055193 11:123417513-123417535 TTGCTTGGTCTCCCCCAGTGTGG - Intergenic
1090265731 11:125351716-125351738 TACCTGGGTCTCCCCCACTGTGG - Intronic
1096156833 12:49345737-49345759 TACCCGGGTCTCCCCGGCGGGGG - Intergenic
1096231228 12:49897930-49897952 CTCCAGGGGCTCCCCCACTGAGG + Intronic
1098377608 12:69834209-69834231 TACCAGGGTATCAACCACTGGGG - Intronic
1098426776 12:70373096-70373118 TGCCTGGGTCTTCTACACTGTGG - Intronic
1099238844 12:80115404-80115426 TGCCTGGGTATCACCCGCTGAGG + Intergenic
1101612560 12:106304212-106304234 TACCTGTGCTTCCCCCTCTGGGG - Intronic
1103086964 12:118068941-118068963 TACCTGGGTCTTCCAAAATGAGG - Intronic
1103597872 12:122035135-122035157 CCTCTGGGTCTCGCCCACTGTGG - Intronic
1103927996 12:124434231-124434253 TGCCTGCCTCACCCCCACTGGGG - Intronic
1104257426 12:127152055-127152077 AACCTGGCTCTCCCACTCTGTGG + Intergenic
1106592042 13:31106119-31106141 TCCCTGTGTCTCCCCTACTGGGG - Intergenic
1107824035 13:44311525-44311547 TACATGCGTCTGCCACACTGTGG - Intergenic
1112416210 13:99205475-99205497 TTCCTGGGTCTCCTCCCCAGAGG + Intronic
1116617140 14:47154331-47154353 TAGCTGCATCTCCCCCACTGCGG - Intronic
1119432797 14:74579260-74579282 TGCCTGGGTCTCCCCGGCAGTGG + Intronic
1119727186 14:76928654-76928676 GACCTGGCTCTCCTCCACTCAGG - Intergenic
1120557921 14:85953409-85953431 TTGCTGAGTCTGCCCCACTGTGG - Intergenic
1121002073 14:90458660-90458682 GACCTGCCTCTGCCCCACTGTGG - Intergenic
1121401536 14:93682171-93682193 TACCTGTTTCTTCCCCACAGGGG - Intronic
1122159040 14:99769450-99769472 AACCTTGGCCTCCCCCACAGTGG + Intronic
1202849681 14_GL000225v1_random:8978-9000 CGCCTGGGGCTCTCCCACTGGGG + Intergenic
1202853641 14_GL000225v1_random:36952-36974 CACCTGGGGCTCTCCCACAGGGG + Intergenic
1202862191 14_GL000225v1_random:89904-89926 TGCCTGGGGCTCTCCCACAGGGG - Intergenic
1202864272 14_GL000225v1_random:104961-104983 CGCCTGGGTCTCTCCCACAGGGG - Intergenic
1202937928 14_KI270725v1_random:109199-109221 TACCTGGGCCAGCCACACTGAGG + Intergenic
1127179513 15:56399816-56399838 TGCCTGGGTATCACCCACGGAGG - Intronic
1128711014 15:69872058-69872080 CACCTGTGGCTCCCCCACTCAGG - Intergenic
1132857622 16:2053939-2053961 CTCCTGGGTTTCCCCCACTCAGG + Intronic
1133597180 16:7304124-7304146 TCCCTGGCTCTCCCCGCCTGGGG - Intronic
1133599803 16:7328127-7328149 CACCTGAGTCTCCGCCACTCTGG - Intronic
1133993388 16:10728147-10728169 CACCTGGGCCTCCCACACTTTGG + Intergenic
1138031462 16:53562642-53562664 TACCTTGGTCTCCCAAAGTGCGG + Intergenic
1144294102 17:13856309-13856331 TGCCTGGGTATCACCCACGGAGG - Intergenic
1144639867 17:16931357-16931379 TGACTGAGTCACCCCCACTGAGG + Intronic
1146313977 17:31792908-31792930 TGCCTGGGTCTCACCCCCAGAGG + Intergenic
1152070844 17:78132898-78132920 TCCCTGGGTCTCCCAGACTCTGG - Intronic
1154039617 18:10841399-10841421 TGCCTTGGCCTCCCCCACTGTGG - Intronic
1162068664 19:8140874-8140896 TTTCTAGGTCTCCACCACTGGGG - Intronic
1162956776 19:14103136-14103158 TACATGGGTTACCCCCACAGAGG + Intronic
1162967868 19:14164499-14164521 GACCTGGGACTGCCCCCCTGAGG - Intronic
1163594278 19:18211756-18211778 AACCTGGGACTTCTCCACTGAGG + Exonic
1164207111 19:23068263-23068285 TGCCTGGGCCTTGCCCACTGGGG - Intergenic
1165308976 19:35019290-35019312 CACCTGTGTCTCCACCACGGAGG - Exonic
1167595611 19:50426393-50426415 TATCTGGGTCAGCCACACTGAGG + Intronic
926158302 2:10470253-10470275 TAGCTGGGGTTACCCCACTGTGG - Intergenic
926625344 2:15085739-15085761 TACCTGGCTTCTCCCCACTGTGG + Intergenic
931179831 2:59888200-59888222 GACCTGGGGCTTCCCCCCTGTGG - Intergenic
932737613 2:74265318-74265340 CACCTGGGTCTCCCCAAAAGAGG + Intronic
936146038 2:109981182-109981204 GACCTGAGGCTCCCACACTGGGG + Intergenic
936198651 2:110390296-110390318 GACCTGAGGCTCCCACACTGGGG - Intergenic
937505246 2:122529323-122529345 TGCCTGGGTGTCCCCTACTGAGG - Intergenic
937880348 2:126859713-126859735 TCCCTTGGTCCCCCCCAGTGTGG - Intergenic
941919703 2:170837753-170837775 TACATGGGTGTCCATCACTGTGG + Intronic
945031803 2:205672063-205672085 TACATGTGTCTGCCCCATTGGGG + Intergenic
946381993 2:219355093-219355115 CACCTGGGTCTGCCCCTCTAAGG + Intergenic
948947268 2:241227118-241227140 CACCTGGGTCTCCCTCAGTGTGG + Intergenic
1170576166 20:17663073-17663095 GGCCTGGGTCACCCTCACTGAGG + Intronic
1171784426 20:29449196-29449218 TGCCTGGGGCTCTCCCACAGGGG - Intergenic
1174520302 20:51124370-51124392 TACCTGGGTCTCACTTTCTGGGG + Intergenic
1174622034 20:51882952-51882974 TGCCTGGGTCTCCCACAGTGAGG - Intergenic
1175803042 20:61812050-61812072 TTCCTGTTTCTCCCCCGCTGCGG + Intronic
1176169058 20:63688979-63689001 GACCTGGGTCTCCCTCATGGGGG + Intronic
1176585395 21:8579940-8579962 TACCTGGGCCAGCCACACTGAGG - Intergenic
1178351767 21:31876703-31876725 TCCCTGGGTCACCCACAGTGGGG - Intronic
1180268203 22:10556839-10556861 TACCTGGGCCAGCCACACTGAGG - Intergenic
1181951506 22:26557174-26557196 TGCCAGGGTCACCCCCACTTTGG - Intronic
1182354022 22:29714075-29714097 TCACAGGGTGTCCCCCACTGTGG + Intergenic
1184963046 22:47945434-47945456 TGCCTGGGTCAGCCCCACTGGGG + Intergenic
1185219549 22:49622593-49622615 TACCGGGGCCTGCCCCACAGAGG + Intronic
951402682 3:22253096-22253118 AATCTTGGTCTCCCACACTGAGG + Intronic
953009733 3:39013526-39013548 TTCCTGGGGCTTCCCCGCTGTGG - Intergenic
953181247 3:40597156-40597178 TACCTGGGTGTTCCTCACCGTGG - Intergenic
954451471 3:50573995-50574017 TCCCTGGGTCTGCCCCACCAGGG + Intronic
963009122 3:140752949-140752971 CACTTGGGTCTCCTCCACTCTGG - Intergenic
963087765 3:141454403-141454425 TGTCTGTGACTCCCCCACTGAGG - Intergenic
964691517 3:159455029-159455051 TACCTGGGTCTCATCTGCTGGGG - Intronic
968660509 4:1796880-1796902 TACCTCAGTTTCCCCCACTGTGG - Intronic
968867378 4:3222092-3222114 TCCCTGTGTCTGCTCCACTGGGG + Intronic
971478103 4:27090902-27090924 TAACGGGGGCTCACCCACTGGGG + Intergenic
974053006 4:56958790-56958812 TACCTGGCTCTGCAGCACTGTGG - Intergenic
976156122 4:82146744-82146766 GACCTGGGTGACCCCCAATGAGG - Intergenic
978349416 4:107805934-107805956 TACTGGGGTCTCCTTCACTGGGG + Intergenic
978610228 4:110529712-110529734 TACCTGGGTCTCTCTGACAGAGG - Intronic
979354839 4:119691142-119691164 CACCTGGTTCTCAGCCACTGTGG + Intergenic
981691676 4:147515598-147515620 TGCCTGAGTCTCCACCACAGGGG - Intronic
985571470 5:647945-647967 TACCTGGGCCTCCTCCCCTCGGG - Intronic
990310511 5:54533557-54533579 AACCTGGGTCTGCCCAACTCAGG - Intronic
990350358 5:54909559-54909581 TACCTCTGTCACCCTCACTGGGG - Intergenic
991568709 5:68032043-68032065 TACCAGGGTATCCCAAACTGAGG - Intergenic
991718316 5:69472660-69472682 CACCTCGGCCTCCCCCAGTGTGG + Intergenic
996056773 5:118990739-118990761 TACCTGGGTCTGCCCCAAGGTGG - Intergenic
996471084 5:123861280-123861302 TACCTAGGTGTCCATCACTGGGG - Intergenic
997624055 5:135319701-135319723 TCCCTGCATCTGCCCCACTGTGG - Intronic
998250975 5:140552144-140552166 CTCCTGGGCCTCCCCCAATGGGG - Exonic
999240263 5:150123353-150123375 TACCTTGCTCTCCACCACAGAGG - Intronic
1000148669 5:158478398-158478420 TGTCTTGGTCTCCCCCACAGTGG - Intergenic
1001284153 5:170410240-170410262 CACCTGGGTCCCCCACACAGGGG + Intronic
1002519882 5:179786499-179786521 TCTCTGGGCCTTCCCCACTGTGG - Intronic
1002719947 5:181252747-181252769 TACCAGGGCCACCTCCACTGTGG + Intergenic
1006297698 6:33177337-33177359 TTCCAGGGTCTCACCCATTGTGG + Intronic
1006317004 6:33297270-33297292 ACCCCAGGTCTCCCCCACTGGGG + Intronic
1007251353 6:40497264-40497286 TCCCTGGTTCTCACCCACTGAGG + Intronic
1007610715 6:43147153-43147175 TGCCTGGGTTTCCCCCTCTGTGG + Intronic
1007688380 6:43681104-43681126 TTCTTGGGTCTCCACCACTACGG + Exonic
1010360482 6:74987347-74987369 TACCAGGGACTTCCCCAGTGGGG - Intergenic
1012204676 6:96445739-96445761 TACCTTGGCCTCCCAAACTGTGG + Intergenic
1013812352 6:114059361-114059383 AATCTGTGTCTCCCCCTCTGTGG + Intronic
1021551621 7:21877132-21877154 TGCCTGGGTGTCCCTCACAGTGG + Intronic
1024219107 7:47273899-47273921 TACCTGGGCCTTACCTACTGGGG - Intergenic
1025722142 7:64026771-64026793 TACCTGGACCTCTCCCACAGGGG - Intergenic
1025782527 7:64614567-64614589 TACCTGAGTGCTCCCCACTGCGG + Intergenic
1029199269 7:98827705-98827727 TTCCTGGATTTCCACCACTGCGG - Intergenic
1032574260 7:133035566-133035588 TACCTGGGTGTTCCCCACCTTGG - Intronic
1033577312 7:142697968-142697990 TACCTGCATCTACCCAACTGAGG - Intergenic
1034260963 7:149755193-149755215 TTCCTGGGTCTCCTCCACTCTGG - Intergenic
1035718205 8:1770149-1770171 TCCATGGGTCTCCCCTACTCTGG + Intronic
1037643600 8:20770802-20770824 TTCTGGGGTCTCCCACACTGGGG + Intergenic
1045217041 8:100158559-100158581 AAGCTGGGTCTCTCCCACCGAGG - Exonic
1049399043 8:142416678-142416700 GAGCAGGGTCTCCCCCAGTGCGG + Intergenic
1051341912 9:16119967-16119989 TTCCTGGGTAACCCCCACTAAGG - Intergenic
1053448028 9:38168128-38168150 TCCCTGGTTCTCACACACTGTGG + Intergenic
1055033048 9:71790001-71790023 TGCCTTGGTCTCCCTAACTGTGG + Intronic
1055448911 9:76412722-76412744 TATCTGGATCAACCCCACTGAGG - Intergenic
1055509128 9:76977624-76977646 CACATGCTTCTCCCCCACTGAGG - Intergenic
1055692321 9:78846061-78846083 TATCTTGGTGTCCACCACTGTGG - Intergenic
1057211481 9:93203168-93203190 TACTTGGGGTTCCCCTACTGGGG - Intronic
1057298868 9:93865133-93865155 GACCTGGGCCTTCCTCACTGAGG + Intergenic
1059241319 9:112808429-112808451 AAACTGGCTCTCCACCACTGGGG - Intronic
1060888039 9:127169310-127169332 GAACTGGGTCTACTCCACTGGGG - Intronic
1062022134 9:134324862-134324884 CACCTGGTCCTCACCCACTGTGG - Intronic
1062160685 9:135077957-135077979 CACCTGGGTGGGCCCCACTGGGG + Intronic
1062637013 9:137496946-137496968 TGCCTGGGAGTCCCCCACAGAGG + Intronic
1203740051 Un_GL000216v2:171055-171077 CGCCTGGGTCTCTCCCACAGGGG + Intergenic
1203615298 Un_KI270749v1:57463-57485 TACCTGGGCCAGCCACACTGAGG - Intergenic
1185741703 X:2538679-2538701 TGCCTCGGTCTCCCAAACTGCGG - Intergenic
1190053745 X:47170338-47170360 TATCTGGTGCTTCCCCACTGTGG + Intronic
1191104573 X:56764489-56764511 AGCCTGGGTTTCCCCCACCGGGG - Intergenic
1191110408 X:56799537-56799559 AGCCAGGGTTTCCCCCACTGGGG - Intergenic
1192762372 X:74106567-74106589 TATCTGGGTCTCCACCACACAGG - Intergenic
1195032977 X:100944609-100944631 TACCTCGGCCTCCCCAAGTGCGG + Intergenic
1195098096 X:101525153-101525175 TGCCTGGGTATCCCCAACAGAGG - Intronic
1196439207 X:115703143-115703165 TACCTGGGTGTTCCCCACCTTGG + Intergenic
1200224519 X:154409754-154409776 TCCCTGGGTCTCCTCCTCTCTGG - Intronic