ID: 1090266321

View in Genome Browser
Species Human (GRCh38)
Location 11:125355421-125355443
Sequence CAGTTACAGCATGCTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090266321_1090266328 17 Left 1090266321 11:125355421-125355443 CCAATTTCAGCATGCTGTAACTG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1090266328 11:125355461-125355483 CCTCACTTTATGCCCTGAAGAGG 0: 1
1: 0
2: 2
3: 15
4: 124
1090266321_1090266329 21 Left 1090266321 11:125355421-125355443 CCAATTTCAGCATGCTGTAACTG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1090266329 11:125355465-125355487 ACTTTATGCCCTGAAGAGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 100
1090266321_1090266330 22 Left 1090266321 11:125355421-125355443 CCAATTTCAGCATGCTGTAACTG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1090266330 11:125355466-125355488 CTTTATGCCCTGAAGAGGTAGGG 0: 1
1: 0
2: 1
3: 9
4: 111
1090266321_1090266331 23 Left 1090266321 11:125355421-125355443 CCAATTTCAGCATGCTGTAACTG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 1090266331 11:125355467-125355489 TTTATGCCCTGAAGAGGTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090266321 Original CRISPR CAGTTACAGCATGCTGAAAT TGG (reversed) Intronic
907132120 1:52106414-52106436 CAGACACAGCATGATGTAATGGG - Intergenic
909961398 1:81848505-81848527 GAGTAACAGCCTGCTGAGATAGG - Intronic
910592609 1:88943054-88943076 GAGTTACAGAATGCTGAAACGGG + Exonic
915768113 1:158387554-158387576 CAGTTTCAGCTTTCTGAAACTGG - Intergenic
915768114 1:158387555-158387577 CAGTTTCAGAAAGCTGAAACTGG + Intergenic
916049330 1:161024297-161024319 AATTTACAGCATACTAAAATGGG + Intronic
918849130 1:189662006-189662028 CAGCTACAAAATGTTGAAATTGG - Intergenic
919320751 1:196034149-196034171 AAGTCACAGCAGGCAGAAATGGG - Intergenic
920749999 1:208664945-208664967 CAGTTACTGCATGCATAAAATGG + Intergenic
921804158 1:219435322-219435344 AAGTTTCAGCATGCTGAAGATGG - Intergenic
922199805 1:223392550-223392572 CAGTTCCAGCAAGGTGGAATGGG - Intergenic
923436832 1:233975392-233975414 CAGTTATGGCATACTAAAATTGG - Intronic
1065047110 10:21754460-21754482 CACTTACAGCACCCTGAATTGGG - Intergenic
1066215600 10:33283865-33283887 AAGGTGCAGCTTGCTGAAATGGG + Intronic
1067553021 10:47248322-47248344 CAGTGTCAGCCTGCTGAGATGGG - Intergenic
1068156712 10:53208053-53208075 CAGTTACAGCATGCTTCCATGGG - Intergenic
1069359214 10:67622769-67622791 CAGTAAAATCATGCAGAAATTGG + Intronic
1071099848 10:82022745-82022767 CACTTACAGCATGTTGCAAATGG - Intronic
1074068314 10:110039288-110039310 CAGTTCCTGAATGCTTAAATTGG - Intronic
1078130834 11:8612836-8612858 CAGTTAGAGCCTGCTGTAGTTGG - Exonic
1079028765 11:16969581-16969603 CAGTTGCAGCATGACGATATGGG - Intronic
1080260921 11:30349089-30349111 CAGTTACTGCATCCTTAAAATGG + Intergenic
1080781412 11:35433172-35433194 CAGCCACTCCATGCTGAAATGGG + Intronic
1086996994 11:93369250-93369272 AAGTGACAGCATTATGAAATGGG - Intronic
1090266321 11:125355421-125355443 CAGTTACAGCATGCTGAAATTGG - Intronic
1090266322 11:125355422-125355444 CAATTTCAGCATGCTGTAACTGG + Intronic
1090548449 11:127792036-127792058 CCGTTTCAGCGTGCTGCAATAGG - Intergenic
1095254754 12:40021839-40021861 CAGTGTCATTATGCTGAAATTGG + Intronic
1097274632 12:57804196-57804218 CACTTACAGCATTCTGGAAAAGG - Intronic
1098138148 12:67424832-67424854 CACTTCCAGCCTTCTGAAATAGG + Intergenic
1098752306 12:74310139-74310161 CAGTGACAGCAAGATGATATTGG + Intergenic
1099110887 12:78559433-78559455 CTGTTAAAGCAGGCTGAAAATGG + Intergenic
1100558650 12:95723810-95723832 CAAATAAAGAATGCTGAAATAGG - Intronic
1100622896 12:96297366-96297388 CAGTCACAACATTCTGAAAATGG - Intronic
1101956280 12:109215224-109215246 CAGTTAAAGCTTGCTAAAATTGG + Intronic
1104118112 12:125769789-125769811 AAGTAACAGGATGTTGAAATGGG - Intergenic
1105501145 13:20972969-20972991 GAGTTACAACATGCTGAGAGAGG + Intergenic
1106245840 13:27949336-27949358 CAGTGATAGCAGGCTGAAAAAGG - Intergenic
1107091251 13:36482886-36482908 CACTGACAGCATGCTGAATGGGG - Intergenic
1107176315 13:37403623-37403645 CAGATATAGAATGCTGAATTTGG + Intergenic
1110118252 13:71846828-71846850 CAGTAACAGCTAGCAGAAATAGG - Intronic
1110709830 13:78638228-78638250 GAGATACAGCATGGTGAAAAAGG - Intronic
1111436846 13:88222110-88222132 TAGAGACAGCATGATGAAATTGG + Intergenic
1111511386 13:89268307-89268329 CAGGTACACCCTGCTGAAATGGG + Intergenic
1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG + Intergenic
1119648187 14:76363788-76363810 TAGTGACAGCATGCTGCACTGGG + Intronic
1121752832 14:96372444-96372466 CAGATACACAATCCTGAAATAGG + Intronic
1125196404 15:37052297-37052319 GAGATACAGCCTGCTGAAACTGG - Intronic
1125291138 15:38148359-38148381 GAGTTACAGAATGGTGAAAATGG + Intergenic
1125298075 15:38223795-38223817 CAGTGAGAGCCTGCTGAAAGAGG - Intergenic
1131817883 15:96241262-96241284 CAGTTATAGCATGAAGAGATAGG - Intergenic
1133404366 16:5511047-5511069 GAGTCACAGCATGATGCAATTGG + Intergenic
1135201974 16:20445357-20445379 CAGTTTCCACATGCTGAATTGGG + Intergenic
1135217130 16:20582509-20582531 CAGTTTCCACATGCTGAATTGGG - Intergenic
1135690924 16:24537048-24537070 CAGTTCCAGCAAGCGGAATTGGG - Intergenic
1135982779 16:27161321-27161343 CAGTTTCCTCATGTTGAAATAGG - Intergenic
1144754338 17:17670023-17670045 CAGTTACAGAATGCTGAGGACGG - Intergenic
1145838979 17:27977899-27977921 AATTTTCAGCATGCTGAAAATGG - Intergenic
1147457835 17:40549527-40549549 CAGTTCCTGCATGATGCAATAGG - Intergenic
1150150704 17:62807266-62807288 CAGTCACAGTATTCTTAAATTGG - Intronic
1150195545 17:63294360-63294382 CAGCTACAGGAGGCTGAAATGGG + Intronic
1150463708 17:65373751-65373773 CAGTTTAAGCATGCTTAAAGAGG + Intergenic
1151073803 17:71248048-71248070 GAGAGACAGGATGCTGAAATGGG + Intergenic
1151092108 17:71452893-71452915 CAGTTACATCAGGCACAAATGGG - Intergenic
1153270931 18:3320345-3320367 AACTTAAAGGATGCTGAAATTGG - Intergenic
1153436501 18:5073492-5073514 GAGTTACAGCATGGCAAAATCGG - Intergenic
1153696208 18:7645517-7645539 CAGTTGTAGGCTGCTGAAATGGG + Intronic
1154078099 18:11225044-11225066 TAGATTCAGCATGCTGAAACAGG + Intergenic
1156380877 18:36559952-36559974 CAGTTGCAGCAAGCTGAGAGAGG + Intronic
1156809644 18:41231884-41231906 CAATTTCAGCAAACTGAAATAGG - Intergenic
1158190827 18:54826800-54826822 CAGTTACCTCATTCTGAAAATGG + Intronic
1159146585 18:64462315-64462337 ATGTTACATCATGCTGAAGTAGG + Intergenic
1159801948 18:72911410-72911432 CATTTACAGCATGATGAATTTGG + Intergenic
1164391887 19:27830659-27830681 TATTTAGAACATGCTGAAATTGG - Intergenic
1164988494 19:32667107-32667129 CAGTTACTGCAAGCTCACATGGG + Intronic
1168564748 19:57413675-57413697 TGGTTTCAGCATGCTGATATAGG + Intronic
925215134 2:2087852-2087874 CAGTGACAGCTTGCTAACATGGG + Intronic
928077083 2:28274714-28274736 CAGTAACCACTTGCTGAAATGGG + Intronic
928445770 2:31332263-31332285 CTGTCACAGGATGCTAAAATGGG - Intergenic
928506345 2:31957171-31957193 CAGTTACTGCATCCTGAAAAGGG + Intronic
930086694 2:47502863-47502885 CAGTTTCAACATCTTGAAATGGG - Intronic
930910819 2:56627374-56627396 CAATTACAGCTCACTGAAATGGG - Intergenic
932285419 2:70527808-70527830 CAGTTACAGCACTGTGAAGTTGG + Intronic
933569197 2:83989047-83989069 AAGTTACAGCAAGCTGAGATTGG + Intergenic
937888828 2:126919590-126919612 CAGATACATCATGGTGAAAATGG + Intergenic
939189197 2:138896591-138896613 CAGTTACAGAATGTTCAAATTGG + Intergenic
940337797 2:152547007-152547029 CGGTTGCAGCAAGCCGAAATCGG - Intronic
943014585 2:182495472-182495494 GTGTTACAGCATGTTAAAATGGG - Intronic
944285878 2:197949335-197949357 CAGATACAGCATCCTGGACTAGG - Intronic
944757094 2:202774582-202774604 CAGTCACTGCATGCTGAGAGGGG + Exonic
946644920 2:221823150-221823172 CAGACACAGAAGGCTGAAATTGG + Intergenic
949012688 2:241690260-241690282 GAGGTACACCATGCTGGAATAGG - Intergenic
1170538132 20:17362117-17362139 CAGTTAAAGTATTCTGAAATGGG - Intronic
1172553664 20:35821925-35821947 GAATTACCACATGCTGAAATGGG + Intronic
1174998772 20:55602748-55602770 CAGTTACTGCATTCTGGAAAGGG - Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1179356483 21:40665094-40665116 CTTTTACAGCATGCAGAACTGGG + Intronic
1181377027 22:22467297-22467319 CACTTATAGAATGATGAAATCGG + Intergenic
1181403447 22:22665689-22665711 CACTTTCTGCAGGCTGAAATGGG + Intergenic
1181986798 22:26805480-26805502 CAGTTTCCCCATGCAGAAATGGG + Intergenic
949820527 3:8111224-8111246 CAGTTCCAGCATGCTGAACATGG + Intergenic
954480091 3:50791443-50791465 TAGTTTCACCATGTTGAAATGGG + Intronic
955302789 3:57799031-57799053 CAGCTACATCATGCAGAGATGGG - Intronic
956384104 3:68698679-68698701 CATTTGCAGAATGCTGGAATCGG - Intergenic
957456750 3:80460924-80460946 AACTTACAGAATGCTAAAATGGG - Intergenic
957785665 3:84878852-84878874 AAGAGACAGCATGCTGAAGTAGG - Intergenic
958140321 3:89554373-89554395 CAGTTACTGCATTTGGAAATCGG - Intergenic
959241776 3:103806155-103806177 AAGTGACAACATGCTGAATTCGG + Intergenic
962863976 3:139431570-139431592 AAGATACAGAATGCTGAAAGAGG - Intergenic
965667762 3:171113838-171113860 CAGGCAAAGCATGTTGAAATGGG - Intronic
966108791 3:176371179-176371201 CAGTTACATTATTCTGAAAAAGG - Intergenic
970833468 4:20370747-20370769 AAGTTAATGGATGCTGAAATTGG - Intronic
975747080 4:77485344-77485366 AACTGACAGCATGCAGAAATGGG + Intergenic
977892415 4:102327341-102327363 CTTTTACAGCATGCTGAAGGGGG - Intronic
981179892 4:141728862-141728884 CAATTTCAGGATGCTGAATTTGG - Intronic
983527672 4:168776822-168776844 TAATTACATCATGATGAAATGGG - Intronic
986426446 5:7636386-7636408 CAGTCACAGCATGATGCCATAGG - Intronic
988249612 5:28739316-28739338 CAGTTACACAAGTCTGAAATTGG - Intergenic
988706029 5:33726790-33726812 CTGTTACATCAAGCTGAATTTGG - Intronic
990028301 5:51223212-51223234 CAATTACAGCTTGCTTTAATTGG - Intergenic
996581726 5:125038703-125038725 CAGTTACTGCATGCTGAGAGGGG - Intergenic
1001171547 5:169424209-169424231 CAGTTAGAGAATGATGAACTAGG - Intergenic
1001947668 5:175793940-175793962 GAGTTACAGGAGGGTGAAATTGG - Intergenic
1004020372 6:11771083-11771105 CAGTCACAGGATGTGGAAATCGG + Intronic
1014226588 6:118855110-118855132 CAGCTACAGAATGCTGATTTTGG + Intronic
1014882211 6:126737124-126737146 TAGTTTCATCATCCTGAAATTGG - Intergenic
1016106315 6:140167752-140167774 CAGCTACAGCATAGTGAAAAAGG + Intergenic
1018226867 6:161637122-161637144 CCGCTAAATCATGCTGAAATTGG + Intronic
1020748556 7:12110900-12110922 CAGTTTCAGCATGCTGGAGTAGG - Intergenic
1021521323 7:21542321-21542343 CAGTTTCATGATACTGAAATAGG - Intergenic
1024628143 7:51225952-51225974 CAGGGACTGCATGCTGAAAAGGG + Intronic
1027938990 7:84648560-84648582 CTGTTACAGGATGCTGATCTAGG + Intergenic
1028029435 7:85891616-85891638 CAGTTACACATTCCTGAAATTGG - Intergenic
1031138257 7:117910143-117910165 CAGTAACAGCATCTTAAAATAGG - Intergenic
1031664115 7:124463922-124463944 CAGTTTCAGAAAGCTGAAACTGG - Intergenic
1033266896 7:139894602-139894624 GAGTTACAGGATGGTGAATTTGG - Intronic
1034000311 7:147404582-147404604 CAGATTTAGCATGATGAAATGGG - Intronic
1037905731 8:22715133-22715155 CAGTGACTGCATGCTCAGATGGG + Intronic
1038946889 8:32371339-32371361 CAGTCACAGAATGCTGAGCTGGG - Intronic
1042561718 8:70076826-70076848 CCATTACAGGATGCTAAAATTGG - Intergenic
1052393286 9:27906689-27906711 CAGTTACATCATTGTAAAATGGG + Intergenic
1055839606 9:80486709-80486731 CAGTCACAGTGTGGTGAAATGGG - Intergenic
1056318554 9:85415172-85415194 CATTTACAGCATGGTGAGAGGGG + Intergenic
1057234054 9:93345048-93345070 AAGTTACAGCATGCAGTATTTGG + Intronic
1058404387 9:104655298-104655320 CAGTTTCACCATGCTGAGACTGG - Intergenic
1185682268 X:1898432-1898454 CAGTGAGAACATGCTGGAATAGG - Intergenic
1189507753 X:41629348-41629370 CAGCAACATCATTCTGAAATAGG + Intronic
1190741850 X:53293911-53293933 CAGTTTCATCATCTTGAAATTGG - Intronic
1192493512 X:71597345-71597367 AAGTTCCAGCAGGATGAAATTGG - Intronic
1193984681 X:88226206-88226228 CAGTTATATCATGCTGATCTTGG - Intergenic
1194701757 X:97122137-97122159 CACTTACAGTATTCTGAAAATGG + Intronic
1196915551 X:120531380-120531402 CAGTTTCAGGATGCTGCAGTTGG + Intronic
1198086707 X:133289155-133289177 GAGCTTCAACATGCTGAAATTGG + Intergenic
1198686190 X:139230379-139230401 CAGGGAAAGCCTGCTGAAATTGG - Intergenic
1199056535 X:143302659-143302681 CAGTTCCTACATGCTGAATTTGG + Intergenic
1201451382 Y:14119109-14119131 CAGTTACAGTGTGCTAAAAGTGG + Intergenic