ID: 1090266907

View in Genome Browser
Species Human (GRCh38)
Location 11:125359071-125359093
Sequence CTGTGGGAGCAAAGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 1, 2: 7, 3: 87, 4: 675}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090266904_1090266907 -10 Left 1090266904 11:125359058-125359080 CCTGCTGAGGCAGCTGTGGGAGC 0: 1
1: 0
2: 9
3: 44
4: 431
Right 1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG 0: 1
1: 1
2: 7
3: 87
4: 675
1090266903_1090266907 -9 Left 1090266903 11:125359057-125359079 CCCTGCTGAGGCAGCTGTGGGAG 0: 1
1: 0
2: 2
3: 32
4: 350
Right 1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG 0: 1
1: 1
2: 7
3: 87
4: 675

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090266907 Original CRISPR CTGTGGGAGCAAAGGCAGGA AGG Intronic
900339071 1:2179248-2179270 CTGTGGGAGCAAAGGCCGTGGGG + Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901328092 1:8381243-8381265 CAGTCGGAGGAAAGGGAGGAGGG - Intronic
901749097 1:11395170-11395192 CTGTGGGAGCTTAGGAAGGGCGG + Intergenic
902099560 1:13974701-13974723 CTGAGGAAGCAAAGGAAGCAAGG + Intergenic
902330312 1:15728056-15728078 CTGTGAGGGCCAAGTCAGGAGGG - Intronic
902382116 1:16057669-16057691 CTGTGTGAGCATTGGCAGTAGGG + Intergenic
902416770 1:16244368-16244390 CTGGGGAAGGAAAGGCAGGTAGG + Intergenic
902751095 1:18511664-18511686 TTGTGGGAGCACAGGAAGCATGG + Intergenic
903174846 1:21574774-21574796 CTTTGTGAGCAAGGCCAGGATGG + Intronic
903354901 1:22740687-22740709 GAGTGGGAGTAAAGGCAGGGAGG - Intronic
903665626 1:25005763-25005785 CTGTAGGAGCAAAGGCTTGGAGG + Intergenic
903724164 1:25428876-25428898 GTGTTGGGGCAGAGGCAGGAAGG + Intronic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
904179459 1:28655680-28655702 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
904197069 1:28793921-28793943 CTGGGTGAGCGAAGGCAGAAAGG + Intergenic
904461318 1:30682037-30682059 CTGTGGCGGCAGAGGCGGGATGG + Intergenic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904681645 1:32233531-32233553 CTTTGGGAGCTGAGGCAGGCAGG - Intergenic
904698710 1:32345632-32345654 CTGCCTGTGCAAAGGCAGGAAGG - Intergenic
904777316 1:32918527-32918549 GAATGGGAGCAAAGGCAGGGAGG - Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905354098 1:37369071-37369093 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
905465257 1:38148390-38148412 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
906050519 1:42867705-42867727 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
906659644 1:47573321-47573343 CTGAGGGAGGGAGGGCAGGAGGG - Intergenic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
906976325 1:50577013-50577035 CAGTGGGGGCCAAGGCATGAAGG - Intronic
907074394 1:51565238-51565260 CTGTTGGAGCCAGGCCAGGAAGG - Intergenic
907110701 1:51923791-51923813 TTGGGGGTGCCAAGGCAGGAAGG + Intronic
907923368 1:58933285-58933307 CTGTGTGAGCCAAGACAGAAAGG - Intergenic
908515147 1:64884640-64884662 CAGTGTGAGTGAAGGCAGGAGGG - Intronic
908737419 1:67291104-67291126 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
909172577 1:72315175-72315197 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
909548915 1:76876892-76876914 CTGAGGGAGAGAAGGCAGGGTGG + Intronic
910630254 1:89346543-89346565 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
910638955 1:89439683-89439705 CTGGGGGAGAGCAGGCAGGATGG + Intergenic
911043158 1:93607830-93607852 TGGTGGGTGCAAAGGCAGGAAGG - Intronic
911175427 1:94812826-94812848 CTGTGGGAGTACAGTCAGGGTGG + Intergenic
911738364 1:101361628-101361650 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
911981869 1:104578973-104578995 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
913090287 1:115472143-115472165 CAATGGGAGCAGAGGCAGGGAGG - Intergenic
913266640 1:117051623-117051645 CTGTGAGAGTGAAAGCAGGAAGG + Intergenic
913813298 1:122927172-122927194 CTTTGGGGCCAAAGGCAGAAAGG + Intergenic
914264100 1:146022802-146022824 CTTTGGGAGCTGAGGCAGGAGGG + Intergenic
914353214 1:146858139-146858161 ATCTGGGGGCAAATGCAGGAAGG - Intergenic
914360109 1:146927702-146927724 CTGTGGGAGGAGAGACAGGCTGG + Intergenic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
914965476 1:152253615-152253637 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
915073827 1:153293223-153293245 CTGTAGGAGGAAAGCCAGGATGG - Intergenic
915528427 1:156489984-156490006 CTCTGGGAGACAGGGCAGGAAGG + Intronic
915658736 1:157383263-157383285 CTATGAGGGTAAAGGCAGGAAGG - Intergenic
915709693 1:157883934-157883956 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
915819988 1:159012771-159012793 CTGGGGCGGCAAAGGAAGGAAGG + Intronic
915907796 1:159891676-159891698 CTGTGGGTGCAAAGTGAGGTAGG - Intronic
915981105 1:160420388-160420410 CTGTGGGGGAGACGGCAGGAGGG - Intronic
916414229 1:164577488-164577510 CTGCTGGAGCCCAGGCAGGAAGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916840205 1:168592642-168592664 ATGTGGGGGTAAAGGGAGGAAGG + Intergenic
916897640 1:169182110-169182132 CTCTGGAAGCTGAGGCAGGAAGG - Intronic
917661636 1:177182154-177182176 GTGAGGGAGCTAAGGGAGGATGG - Intronic
917764558 1:178202300-178202322 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
917779400 1:178376088-178376110 ATGTGGGAGGAAAGCCAGGATGG + Intronic
918109675 1:181444419-181444441 CTATGGGGGGAAAGGGAGGAGGG + Intronic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918259549 1:182783209-182783231 CTGAGGGGGCTGAGGCAGGAGGG - Intergenic
918435999 1:184513617-184513639 CTGTGGGAGCAAATGCATAGAGG - Intronic
918755682 1:188337518-188337540 CTATGGGAGAGAAGGCAGGGTGG + Intergenic
918984658 1:191608579-191608601 CTGTGAGAGCACAGGCATAATGG + Intergenic
919641417 1:200048386-200048408 CTGTAGGAGGCAAGGCAGCATGG - Exonic
920074605 1:203327243-203327265 CTGGGCGTGCAAAGGCAGGCAGG + Intergenic
920247586 1:204600034-204600056 CGGTGGGCGCAGAGGAAGGATGG + Intergenic
920802105 1:209199172-209199194 CTGTGGGGGAGATGGCAGGAAGG - Intergenic
920995909 1:210990955-210990977 CTATGGGAAAACAGGCAGGAAGG + Intronic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
922005942 1:221530848-221530870 TTGTGGAAGCCAAGGGAGGAAGG - Intergenic
922244832 1:223785982-223786004 CAGTGGAAGGAAAGGAAGGAGGG + Intronic
922551369 1:226496988-226497010 CTGTGGGAGCAAAGACAGGGTGG + Intergenic
922656473 1:227388825-227388847 TGGTTGGAGCACAGGCAGGAAGG + Intergenic
922664260 1:227455234-227455256 CTGTGGAAGGAAGGGCAGGGGGG + Intergenic
922885684 1:229018811-229018833 CTGTGGTTGCAAAGGGAGAATGG + Intergenic
923138010 1:231135256-231135278 CTTTGGGAGCCAAGGCAGGAGGG + Intergenic
923697410 1:236267080-236267102 CTGTTGGACCAAAAGAAGGAAGG - Intronic
923806668 1:237265227-237265249 CTGTAGGAGAAAAGGCATGAAGG + Intronic
924223432 1:241901505-241901527 CTCAGGAAGCTAAGGCAGGAGGG - Intergenic
924775729 1:247113452-247113474 CTGTGGGACCCACAGCAGGAGGG + Intergenic
924847102 1:247784846-247784868 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063468263 10:6262772-6262794 CTAGAGGAGCAAAGGCAAGAGGG + Intergenic
1063472605 10:6300251-6300273 CCTTGTGGGCAAAGGCAGGAAGG - Intergenic
1063940057 10:11119153-11119175 CTGTAGTAACGAAGGCAGGAGGG + Intronic
1064354502 10:14604609-14604631 CGGTGGGAGCGAGGGCTGGAGGG + Intronic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066046290 10:31598356-31598378 ATGTGGGAGAGAAGCCAGGATGG + Intergenic
1066228829 10:33411987-33412009 CTGTGAGGGTGAAGGCAGGAAGG + Intergenic
1066236166 10:33486812-33486834 AAGTGGGAGCTAAGACAGGAAGG + Intergenic
1066957652 10:42188344-42188366 CCGTGGGAGAGAAGGCAGGGTGG - Intergenic
1067307380 10:45077053-45077075 TTGGGGGAGCACAGGAAGGAAGG + Intergenic
1067831322 10:49612634-49612656 CACTGGGAGCAATGGAAGGAAGG - Exonic
1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG + Intergenic
1068447237 10:57138885-57138907 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1068542953 10:58315995-58316017 CTGTGGGAACAAAAACAGTAGGG + Intergenic
1069790798 10:71019293-71019315 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1070663925 10:78330132-78330154 CTTTGGGAAAAAAGCCAGGAGGG - Intergenic
1071342882 10:84664730-84664752 CTGTGAGAGCTATTGCAGGAAGG + Intergenic
1071937720 10:90549566-90549588 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1072198773 10:93140203-93140225 CGGGGGGAACAATGGCAGGATGG - Intergenic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072434235 10:95400935-95400957 CTGAGGGAGCAACTTCAGGAGGG + Intronic
1073762786 10:106648798-106648820 ATTTGGGTGCAAAGGCAGGAGGG - Intronic
1074154089 10:110783161-110783183 CTGATGGAGCAAAGGCTGGATGG + Intronic
1074508935 10:114095545-114095567 TTGTGGGCGCACTGGCAGGATGG + Intergenic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1075076406 10:119353620-119353642 CTCTGGCAGCAAAGGCTGGGTGG + Intronic
1075105652 10:119538498-119538520 CTGGGGGAGCAAAGGCACAGAGG + Intronic
1075606818 10:123817689-123817711 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1075815430 10:125261265-125261287 GTGTGTGAACAAAGCCAGGAAGG + Intergenic
1075936695 10:126348494-126348516 ATGTGGGAACAAATGCAAGAGGG + Intronic
1076008131 10:126964444-126964466 CTGTAGGAGCACAGACAGGGAGG + Intronic
1076302703 10:129440147-129440169 CTGGGGGAGAAAAGGCTGGAAGG - Intergenic
1076402549 10:130193520-130193542 CTGTGGGTGAAAGGGCAGGAGGG - Intergenic
1076521674 10:131085120-131085142 CTGTGGGGACACAGCCAGGAGGG + Intergenic
1077121325 11:910310-910332 CAGAGGGAGCAGAGGCAGTAGGG - Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077252575 11:1567125-1567147 CTGTGGGGGCACAGGGAAGATGG - Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077486258 11:2839640-2839662 CTGGGGGAGGGAAGGCAGCAGGG + Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1078444130 11:11391462-11391484 CTATGGGACCAAGGGCAAGAGGG + Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078546652 11:12252089-12252111 TTGTGGGAGGAAAGGCAGGGAGG - Intronic
1079170160 11:18086158-18086180 CTCTGGAAGGCAAGGCAGGAAGG + Intronic
1079320704 11:19449305-19449327 ATGTGGGAGCCAAGCCCGGAAGG + Intronic
1079353787 11:19714026-19714048 GTGTGGGAGAAAGGGCTGGATGG + Intronic
1079638383 11:22773798-22773820 CTGTGGAAGCGAGGTCAGGAAGG - Intronic
1079675131 11:23217366-23217388 CTGTGGCAGCGAGGGAAGGAGGG - Intergenic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1080994683 11:37584213-37584235 CTGTTGGAGCCCAGGCAGGGTGG + Intergenic
1081378319 11:42386208-42386230 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1081742693 11:45451904-45451926 CTGTGTGTGCCAAGGAAGGAGGG - Intergenic
1081957107 11:47103054-47103076 GTGTGGCCCCAAAGGCAGGAAGG + Intronic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1083250660 11:61464466-61464488 CTTTGGGAGCTCAGGGAGGAAGG - Intronic
1083334145 11:61913084-61913106 CTGAGGGGGAATAGGCAGGATGG + Intronic
1083678598 11:64341197-64341219 GTGCGGGGGCAGAGGCAGGAGGG - Intronic
1083702148 11:64486630-64486652 CTCTGGGGGCCAGGGCAGGATGG + Intergenic
1083727727 11:64637142-64637164 CCCTGGGAGGAAGGGCAGGAGGG + Intronic
1083736536 11:64684870-64684892 CTGCAGGAGCCAATGCAGGAAGG + Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1084430414 11:69107740-69107762 CTGTGGCATCCAAGGCAGTATGG - Intergenic
1084453619 11:69254628-69254650 CAGCAGGGGCAAAGGCAGGAGGG + Intergenic
1084558843 11:69891396-69891418 CTGTGGGTGAAAGAGCAGGAGGG + Intergenic
1084659168 11:70537069-70537091 CTGAGGGAGCAAAAGGAGCATGG - Intronic
1084943669 11:72627498-72627520 CAGTGTGAGCAAAGGCAGGGAGG + Intronic
1085012064 11:73148124-73148146 CTGTGGGAAAACAGGCAGGCAGG - Intergenic
1085084303 11:73656487-73656509 CTGAGTGAGCAAAGGAAGGAAGG + Intronic
1085099095 11:73785465-73785487 TTGTAGGAGCAAAGGCAGGGAGG + Intergenic
1085472691 11:76768357-76768379 CCGAGTGTGCAAAGGCAGGAAGG - Intergenic
1085685987 11:78622455-78622477 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1086278638 11:85160717-85160739 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1086538692 11:87881950-87881972 CTGTGGCAGGAAAGGAAGAATGG - Intergenic
1087093642 11:94300015-94300037 CTGAGAGAGGAAAGGCAGGGAGG + Intergenic
1087374049 11:97320816-97320838 CTGGGGGAGAGAAGGCAGGGCGG - Intergenic
1088622241 11:111697746-111697768 CTTTGGGTGCTGAGGCAGGAGGG + Intronic
1088651068 11:111958506-111958528 CAGAGGGAGCTAAGGCAGCAGGG - Intronic
1088893376 11:114060893-114060915 TTGTGGGAGGAAAGGCGAGAAGG - Intronic
1088946429 11:114517860-114517882 CTGTGGGAGCAGAGCCACCAGGG - Intergenic
1089093198 11:115895834-115895856 CTGTGCAAACAAAGGCAGTAAGG - Intergenic
1089180171 11:116578201-116578223 GTGAGGGAGGAAAGGAAGGAGGG - Intergenic
1089398832 11:118152884-118152906 CTGCTGGAGCAACGGCGGGAGGG + Intronic
1089903639 11:122013877-122013899 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1090119168 11:124006108-124006130 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090309359 11:125721155-125721177 CTGTGGGAGCACAGGGAGAGAGG - Intergenic
1090354410 11:126130185-126130207 CTGTGGGGACAAGGGCAGCATGG + Intergenic
1091063581 11:132488013-132488035 CTGTGGCTGCAAAGGTAGGCTGG - Intronic
1091347856 11:134867224-134867246 CTGGGGGGATAAAGGCAGGAGGG + Intergenic
1091350489 11:134890389-134890411 CTGTGGAAGCAATAACAGGAGGG + Intergenic
1091723059 12:2827219-2827241 CTCTTGGTACAAAGGCAGGAAGG + Exonic
1091791337 12:3273849-3273871 GGGAGGGAGCAAGGGCAGGAGGG - Intronic
1093036369 12:14335949-14335971 CTGTGGGAGAGAAGGCAGGGTGG - Intergenic
1095603887 12:44044590-44044612 CTGAGGGAGAGAAGGCAGGGTGG - Intronic
1095856215 12:46863410-46863432 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096180856 12:49549661-49549683 CTGAGGGAGCAAAGGCTAGCAGG - Intronic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096522263 12:52191164-52191186 CTGTGGGACCAGAGGCTTGAGGG + Intronic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096618021 12:52845366-52845388 CTGTCTGAGGAAATGCAGGAAGG - Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096742967 12:53707682-53707704 CTTGGGGGGCCAAGGCAGGAGGG - Intergenic
1096988174 12:55775918-55775940 ATGTGAGAGCAATGGCAGAATGG - Intronic
1097902901 12:64891155-64891177 TTGTGTGAGGAAAGGCAGAATGG + Intergenic
1098749875 12:74279855-74279877 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1098831874 12:75373763-75373785 CTGGGGGAGAGAAGGCAGGATGG + Intronic
1098892798 12:76026948-76026970 CTGTTGGGACAAAGGAAGGAAGG - Exonic
1099365959 12:81765650-81765672 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1099375681 12:81894223-81894245 CCGTGGGAGAGAAGGCAGGGTGG - Intergenic
1099508594 12:83507453-83507475 CTGGGGTAGAAAAGGCAGGGTGG - Intergenic
1100093737 12:91005989-91006011 AGATGGGAGCAGAGGCAGGAAGG - Intergenic
1100241120 12:92711342-92711364 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1100359252 12:93861152-93861174 CTGAGGGAGCAGAGGCTGCAGGG + Intronic
1101480327 12:105090475-105090497 ATGTGGGGGCAAGGGCAAGAGGG - Intergenic
1101543101 12:105682901-105682923 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1101896538 12:108761332-108761354 GTGTGGGACCAAATGCAGGAAGG + Intergenic
1102049721 12:109853986-109854008 CTTTGGGAGGCAAGGCAGGTAGG - Intronic
1102500506 12:113349004-113349026 CAGAGGGAGCAAGGGAAGGAGGG - Intronic
1102957007 12:117065291-117065313 CTGGGGGAGCAGAGGAAGAAGGG + Intronic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1104919860 12:132285149-132285171 CTGAGGGAGGGCAGGCAGGAGGG - Intronic
1104988042 12:132608342-132608364 CAGTGGCAGGAAAGACAGGAGGG - Intronic
1105562078 13:21501777-21501799 CTGTGGCAGGAAAAGAAGGAGGG - Intronic
1105582915 13:21717909-21717931 CTGCCAGAGCAGAGGCAGGAGGG - Intergenic
1106235017 13:27854049-27854071 CTGTGGAAGGAAAGGAGGGAGGG - Intergenic
1106450522 13:29877800-29877822 TTGTGGGAGACAAGGCAGAATGG - Intergenic
1107400380 13:40063539-40063561 CTGTGAGGTCACAGGCAGGAAGG + Intergenic
1107733404 13:43370911-43370933 CGGAGGGAGGAAGGGCAGGAGGG - Intronic
1108302404 13:49091731-49091753 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
1109288063 13:60435478-60435500 AAGTGGGAGCTAAGGCATGAGGG - Intronic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1111198566 13:84905149-84905171 CTGGGGGAGAGAAGGCAGCATGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1113319677 13:109221397-109221419 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1113396168 13:109949798-109949820 CTGGGGGAGAGAAGGCAGGGAGG - Intergenic
1113878444 13:113608886-113608908 CTGGGAGAGAAAGGGCAGGAGGG - Intronic
1113949330 13:114062795-114062817 CTGAGGGAGCAACAGCAGAACGG + Intronic
1114205898 14:20571034-20571056 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114450491 14:22822235-22822257 CTGGGGGCCCAAAGGAAGGAGGG - Intronic
1115023144 14:28707571-28707593 CAGTGGGACCAAAAGCAAGAAGG + Intergenic
1115127226 14:30010512-30010534 CTTGGGGAGCAGGGGCAGGAGGG + Intronic
1115712572 14:36067182-36067204 CTGTGGGGGCAAAAGCAAGTTGG - Intergenic
1115736704 14:36339353-36339375 GTGTGAGAGCAAGAGCAGGAAGG + Intergenic
1115738761 14:36364606-36364628 CTTTGGCAGCCAAAGCAGGAGGG - Intergenic
1116436899 14:44905578-44905600 CTGGGAGAGCATGGGCAGGAGGG - Exonic
1116946572 14:50840835-50840857 CTATGGGAGCACAGAAAGGAGGG + Intergenic
1117212378 14:53513908-53513930 ATGTGTGAACAAAGGCAGTACGG + Intergenic
1118296802 14:64577503-64577525 GTGAGAGAGGAAAGGCAGGAGGG - Intronic
1118880742 14:69823755-69823777 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1119162801 14:72467392-72467414 CTGAGGCAGTAAAAGCAGGAAGG - Intronic
1119391980 14:74296903-74296925 CTCAGGGGGCAGAGGCAGGATGG + Intronic
1119459244 14:74785430-74785452 CTGAGTGAGCAAAAGCAGCAGGG - Intronic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119749711 14:77068467-77068489 CTTCGGGAGCAGTGGCAGGAGGG - Intergenic
1119831870 14:77710395-77710417 CAGTGGGAAATAAGGCAGGAAGG + Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1120973732 14:90231098-90231120 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1121072467 14:91037047-91037069 CTCAGTGACCAAAGGCAGGAGGG - Intronic
1121133699 14:91474372-91474394 ATGTGTATGCAAAGGCAGGATGG + Intronic
1121551584 14:94806866-94806888 CTCCAGGAGCAAAAGCAGGAAGG + Intergenic
1121711987 14:96045358-96045380 CTGTGTGCACAAAGGCAAGAAGG + Intronic
1121846101 14:97173562-97173584 CTGTGGGAGAAAGGCCAGGTTGG - Intergenic
1122047049 14:99031138-99031160 CCGTGGGAGAAAGGGCAGTATGG - Intergenic
1122299584 14:100724258-100724280 CTGTTGGAGGAATGGCTGGAAGG + Intergenic
1122462856 14:101910168-101910190 ATGTGGGCTCAAAGGCACGAGGG - Intronic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1122981375 14:105193737-105193759 CTGTGGGTGCCCAGGCAGCAAGG + Intergenic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1202892713 14_KI270722v1_random:174703-174725 CTCAGGAAGCTAAGGCAGGAGGG + Intergenic
1123992891 15:25696489-25696511 CAGTGGGAGCAACGGGATGAAGG - Intronic
1124442630 15:29698391-29698413 ATGTGGCAGTAAATGCAGGAAGG - Intergenic
1124596892 15:31098750-31098772 CTGGGGGAGCAGACACAGGATGG + Intronic
1125080745 15:35669891-35669913 GTGTGGGTGCGAAGACAGGAAGG - Intergenic
1125099246 15:35891177-35891199 TTCTGTGAGCAAAGGCATGAAGG + Intergenic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126305046 15:47246344-47246366 CAGTGGGAGCTAAAGCATGAGGG + Intronic
1126675518 15:51156751-51156773 CAGTAGGAGCGAGGGCAGGAGGG + Intergenic
1127007013 15:54582011-54582033 TTGTGGGAGAAAGGGGAGGAAGG + Intronic
1127704250 15:61531393-61531415 CAGAGGTAGCAAATGCAGGAAGG - Intergenic
1128263332 15:66248129-66248151 CAGAGGCAGAAAAGGCAGGAGGG - Intronic
1129283638 15:74506105-74506127 CTGCCGGTGCAAAGGCAGGGTGG - Intergenic
1129347270 15:74930615-74930637 CTTTGGGAGCCAAGGGAGGAAGG - Intronic
1129601528 15:77001580-77001602 TGGTGGCAGCAAAGGCAGGATGG - Intronic
1129713873 15:77835941-77835963 CTGTGTGAGCAAAGGCTTGGAGG - Intergenic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130275812 15:82475889-82475911 CCGTGGCAGGAAAGGCAGGTGGG - Intergenic
1130334132 15:82944228-82944250 GTGTGGGAAGAACGGCAGGATGG - Intronic
1130468171 15:84203281-84203303 CCGTGGCAGGAAAGGCAGGTGGG - Intergenic
1130496093 15:84470261-84470283 CCGTGGCAGGAAAGGCAGGTGGG + Intergenic
1130590464 15:85207879-85207901 CCGTGGCAGGAAAGGCAGGTGGG - Intergenic
1130663577 15:85850822-85850844 CTGGGGGAGAAAAGGAAGGGGGG - Intergenic
1130766126 15:86873230-86873252 GTGTGGGAGCAAAGGCATGTTGG + Intronic
1130957685 15:88639055-88639077 CTGAGGGCGCAGAGGCAGGCAGG + Exonic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132390808 15:101436963-101436985 CTGTGGGATCCAGGGCAAGATGG - Intronic
1132726116 16:1339059-1339081 AGGTGGGAGCGAGGGCAGGAGGG - Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1134114640 16:11538915-11538937 CCCTGGAAGCAAGGGCAGGAAGG - Intergenic
1134587127 16:15421314-15421336 CAGTGGAATCAAAGACAGGATGG - Intronic
1135053376 16:19210765-19210787 CGGTGAGAGCAAAGGCATAAGGG + Intronic
1135630568 16:24033019-24033041 ATGTGGTAGGAAAGGCAGGTGGG + Intronic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1136784770 16:32927728-32927750 CGCAGGGAGCAAAGGTAGGAAGG + Intergenic
1136885013 16:33926078-33926100 CGCAGGGAGCAAAGGTAGGAAGG - Intergenic
1137699666 16:50488376-50488398 CTTTGGTGGCTAAGGCAGGAGGG + Intergenic
1138448082 16:57077343-57077365 CTCTGGCAGCCCAGGCAGGATGG - Exonic
1138455441 16:57118047-57118069 ATGTGGGAGCAAAGGCTTGATGG - Intronic
1138868407 16:60851048-60851070 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1138990818 16:62388798-62388820 CTTTGAGAGCCAAGGCAGGAGGG + Intergenic
1139147953 16:64345373-64345395 CTGAGGGAGCCAAGGCAACAGGG - Intergenic
1139435645 16:66935131-66935153 CCGCTTGAGCAAAGGCAGGAAGG - Exonic
1139454219 16:67059378-67059400 CTGTGAGAGAAAAGGCAGAATGG + Intronic
1139500508 16:67360391-67360413 CTGTGGGAGGAAAAACAGGCTGG + Intronic
1139980810 16:70857379-70857401 ATCTGGGGGCAAATGCAGGAAGG + Intronic
1140227982 16:73094008-73094030 CTGGCAGGGCAAAGGCAGGATGG + Intergenic
1140477336 16:75245473-75245495 CTGAGGGAGCACAGGCAGGGAGG + Intronic
1140916444 16:79498043-79498065 ATCTGGGTGCAAGGGCAGGAGGG - Intergenic
1140986619 16:80163956-80163978 GTGTGGGTGCAGATGCAGGAGGG + Intergenic
1141507289 16:84486267-84486289 CGGTGGGGGCAGGGGCAGGAAGG + Intronic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1143346707 17:6254876-6254898 CTGTAGGAGATAAGACAGGAGGG - Intergenic
1143538881 17:7558032-7558054 AGGTGGGAGCAGAGGTAGGAAGG + Intronic
1143860525 17:9887282-9887304 CTTTGGGAGCCAAGGCAGGCGGG + Intronic
1144343056 17:14326393-14326415 CTGTGGAAGCAAGGGATGGAGGG + Intronic
1144402345 17:14918385-14918407 CTGTGGGAGCCGATGCATGATGG + Intergenic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144640399 17:16933587-16933609 ATGTGGGATCTAAGGCAGGGAGG + Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1144825185 17:18101785-18101807 CTGAGGCAGCAAGGGGAGGAAGG + Intronic
1144945445 17:18967334-18967356 CCGTGGAAGGAAGGGCAGGAAGG + Intronic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1146275819 17:31514970-31514992 GTGTGGATGCAAAGGCAGGCGGG + Intronic
1146696395 17:34911800-34911822 CTGTGGCAGGAATGGGAGGAAGG - Intergenic
1147378122 17:40035070-40035092 CTATGGGAGCAGCGGCAGGTGGG + Intronic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1147878923 17:43641685-43641707 GTGTGGGAGCAAAGGCCCTAGGG + Exonic
1148074255 17:44926500-44926522 CTGAGGGAGGAAAGGAGGGAAGG + Intronic
1148227309 17:45907949-45907971 CTGAGGTTGCAGAGGCAGGAAGG - Intronic
1148385462 17:47231289-47231311 CTGTGAGAACAAAGCCAAGAAGG + Intergenic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149655567 17:58308107-58308129 CAGTGGGAGGGAGGGCAGGAGGG + Intronic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151268210 17:72972926-72972948 CTGTGGTAGGTCAGGCAGGAAGG + Intronic
1151827450 17:76531141-76531163 ATCTGGGGGCAAAGGGAGGAAGG + Exonic
1151961385 17:77407761-77407783 CTGTGGGAGGACAGCAAGGAGGG - Intronic
1151967790 17:77440628-77440650 CTGTGGGAGCGTGGGCAGCAGGG - Intronic
1152287723 17:79422355-79422377 CTGTGGCAGCACAGGACGGAGGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1155000992 18:21686764-21686786 GAGTGGGAGAAAGGGCAGGATGG - Intronic
1155208268 18:23579111-23579133 ATGTGGGAGAGAAGGAAGGAAGG - Intronic
1155274660 18:24174878-24174900 CTAGGGAAGCTAAGGCAGGAGGG - Intronic
1156582580 18:38394726-38394748 CTGAGGGAGAAAAGGCAGGGTGG - Intergenic
1157341231 18:46780288-46780310 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1157617680 18:48996896-48996918 AATTGGGAGCAAAGGCAGGGAGG + Intergenic
1158784830 18:60697921-60697943 CTGTGGGAGCAAGGGGATGGAGG + Intergenic
1159025066 18:63176154-63176176 CATGGGGAGCAATGGCAGGATGG + Intronic
1159262084 18:66027108-66027130 CTGTGGATTCAAAGGCATGAGGG + Intergenic
1160042637 18:75359763-75359785 CTGTGGGAGACAAGGTTGGAAGG + Intergenic
1160507046 18:79433005-79433027 CGGTGGGAGCAAACGCAGCAGGG - Intronic
1161000646 19:1909176-1909198 CTGTGGGGGCAGATGCAGGTGGG + Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161314235 19:3610431-3610453 CTGTGGGAGGCAAGGCAGAGGGG + Intergenic
1161651012 19:5484833-5484855 CTGTGTGAGCAAACGCGGGGAGG + Intergenic
1161776227 19:6263700-6263722 CCGTGAGAGTGAAGGCAGGAGGG + Intronic
1162029589 19:7911632-7911654 CTGGGGAGGCAATGGCAGGAGGG + Intronic
1162440350 19:10688527-10688549 CTGGGGGAGAGAAGACAGGATGG - Intronic
1162771352 19:12951218-12951240 ATTTGGGAGGCAAGGCAGGAGGG - Intronic
1162782041 19:13011525-13011547 GGGTGGGAGCAGAGGCAGGGGGG + Intronic
1162899032 19:13783295-13783317 CTGTGGGCACAAAGGCAGGGAGG - Intergenic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1163751483 19:19080810-19080832 CTTGGGAAGCTAAGGCAGGAGGG + Intronic
1164097059 19:22021090-22021112 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
1164117231 19:22234312-22234334 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1164674798 19:30094107-30094129 GGCTGGGAGCCAAGGCAGGAGGG - Intergenic
1164853596 19:31503839-31503861 CAGAGAGAGAAAAGGCAGGAGGG + Intergenic
1165397813 19:35576773-35576795 CTGTGGGGGTAAAGGCAAGCTGG + Intergenic
1165438356 19:35809336-35809358 GTGTGGAGGCTAAGGCAGGAGGG - Intronic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1165950349 19:39470827-39470849 AGGAAGGAGCAAAGGCAGGAGGG - Intronic
1167105879 19:47429712-47429734 CTTTGGGGGCAAAGCCAGGCTGG + Exonic
1167341323 19:48918253-48918275 CTGAGGGAGCCGAGGAAGGAGGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167773828 19:51541901-51541923 GTGTGTGAGCAAAGGCATGAAGG - Intergenic
1167951662 19:53032509-53032531 CTGAGGGAGAGAAGGCAGGATGG - Intergenic
1168258793 19:55181398-55181420 CTTGAGGACCAAAGGCAGGAAGG - Exonic
925639138 2:5970880-5970902 CTGAGGGAGCAAGGGGATGAAGG - Intergenic
926197094 2:10770540-10770562 CTGTGGGCTCTAAGCCAGGACGG - Intronic
926347010 2:11956151-11956173 CTTTGGGACAACAGGCAGGAGGG - Intergenic
926810361 2:16750414-16750436 CTGGGGGAGATAAGGCAGGGTGG + Intergenic
927463836 2:23322396-23322418 GTGTGGGAGCAGTGACAGGATGG - Intergenic
927695086 2:25234421-25234443 CTGGGGGAGAAAAGGCAGAGAGG + Intronic
927695200 2:25235145-25235167 CTCTGGGAGACAAGGCAGCAGGG + Intronic
928167527 2:28981782-28981804 CACTGGGAGCCAAGGAAGGAGGG + Intronic
928298206 2:30103686-30103708 CTGTGGGAGGAAAGGAAGATAGG + Intergenic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
928797059 2:35034886-35034908 CAGAGGGGGCCAAGGCAGGAGGG + Intergenic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930536583 2:52652000-52652022 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
931758631 2:65396543-65396565 TTTTTGGAGCAAAGGCAAGAGGG + Intronic
933256715 2:80089238-80089260 TTGTGGGAGCAAAAGTGGGAAGG + Intronic
934465871 2:94262464-94262486 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
935425075 2:102911063-102911085 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
935564280 2:104589989-104590011 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
936283162 2:111160236-111160258 GTGGGGGAGCCAGGGCAGGAAGG - Intronic
936287118 2:111189400-111189422 CTGTGGGACCCAAGGCAGGAGGG - Intergenic
937015109 2:118597868-118597890 CTATGGGAGCCAACGCTGGATGG + Intergenic
937263177 2:120599275-120599297 ATGTGGGCGTGAAGGCAGGAGGG + Intergenic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937582036 2:123498903-123498925 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
937956895 2:127426711-127426733 CAGTGGGACCACAGCCAGGACGG + Intronic
938159536 2:128973052-128973074 GTGTGGGAGAAAAGGTAGGAAGG - Intergenic
939281498 2:140071494-140071516 CAGTGGGAGGAAAAGCAGCAGGG - Intergenic
939630911 2:144524740-144524762 CAGAGGGAGGAAAAGCAGGAGGG - Intergenic
940445706 2:153773752-153773774 CTGTGGAAGAAAAGGTAGAATGG + Intergenic
940605890 2:155924024-155924046 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
941668050 2:168261392-168261414 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
941770384 2:169338439-169338461 CGGAGGGAGGAAAGGAAGGAAGG + Intronic
941863252 2:170307133-170307155 CTTTGGAGGCTAAGGCAGGAAGG + Intronic
941885282 2:170521565-170521587 AGATGGGAGCAAAGGAAGGAAGG - Intronic
942186486 2:173429251-173429273 ATGTGGGAACGAAGGAAGGAAGG - Intergenic
943662946 2:190578466-190578488 CCCAGGGAGCAAAGGCAGGTGGG + Intergenic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
946152733 2:217787344-217787366 CGGTGGGAGCGCAGGGAGGACGG + Intergenic
946281384 2:218668202-218668224 GTGTGGCAGCAAAGGGAGGAAGG - Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947716142 2:232339760-232339782 TTTTGGGAGCGCAGGCAGGATGG + Intronic
947937838 2:234023196-234023218 CTATGGGAGAAAAGGCAGGAAGG + Intergenic
947988483 2:234468430-234468452 CTGTGGGAGCACAGACATCAGGG - Intergenic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
948860760 2:240751629-240751651 CTGTGGGGGCCATGGCAGGGTGG - Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1171057970 20:21926376-21926398 CTTTGGAGGCCAAGGCAGGAGGG + Intergenic
1171172450 20:23027485-23027507 CTGTGGGAGGAGAGACAGGCAGG - Intergenic
1171238653 20:23547854-23547876 CTGAGGGAGCAAGCACAGGAAGG + Intergenic
1171310347 20:24140300-24140322 CTCAGGGAGCAAAGAAAGGAGGG + Intergenic
1172007107 20:31825051-31825073 CTATGGGAGGAAAGGCTCGAGGG + Intronic
1172576978 20:36017083-36017105 TTGTGGGAGCGAGGGCAGTATGG + Intronic
1172769638 20:37373551-37373573 CTTTGGGGGCCAAGGCAGGAGGG - Intronic
1172795499 20:37534413-37534435 CTGTGGGAGCCCTGGCAGGGAGG + Intergenic
1172820166 20:37725540-37725562 CTTTGGGAGGCAAGGCAGGCAGG - Intronic
1173597045 20:44265257-44265279 CTGTGGGAGCAAAAGCATGGAGG - Intronic
1173653306 20:44681515-44681537 ATGTGTGAACAAATGCAGGATGG + Intergenic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1175296671 20:57913452-57913474 CTGTGGGAGCACAGGTTGTACGG + Intergenic
1175499834 20:59441905-59441927 CTGTGGGTGCAAGTGCAGGGAGG + Intergenic
1175885541 20:62288384-62288406 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885547 20:62288407-62288429 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885565 20:62288475-62288497 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885577 20:62288520-62288542 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1175885589 20:62288565-62288587 CTGTGGGTGCAGAGGCTGGGAGG + Intronic
1176094344 20:63333096-63333118 CTGTGGCCGTAAAGGCAGGAGGG - Intronic
1176596871 21:8705668-8705690 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1177055924 21:16300806-16300828 GTGAGGGACCAAAGGCAGAAAGG - Intergenic
1177913209 21:27056474-27056496 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1178808500 21:35859712-35859734 GGGTAGGAGCAAAGGCTGGATGG - Intronic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179768514 21:43594705-43594727 CGGTGGGAGGAAGGGAAGGAGGG + Intronic
1179779566 21:43690617-43690639 CTGAGGGATCACAGTCAGGAAGG + Intronic
1179953306 21:44723869-44723891 CTGGGGGAGCACGGGCAGGGCGG - Intergenic
1180279791 22:10683110-10683132 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1180587009 22:16901636-16901658 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1180591119 22:16938103-16938125 CTGTGGGAGAGAAGGAAGGGTGG + Intergenic
1180717011 22:17878557-17878579 CTCAGAGAGCAAAGGCAGAAGGG + Intronic
1180832249 22:18912236-18912258 CTGGGGCAGGAAAGGCTGGAGGG - Intronic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1180990650 22:19933752-19933774 CTGTGGGAGGAAGGGCTGGGTGG + Intronic
1181067593 22:20314106-20314128 CTGGGGCAGGAAAGGCTGGAGGG + Intergenic
1181148346 22:20864798-20864820 CTGGGGAAGGAAAGGAAGGAGGG + Intronic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181533533 22:23530440-23530462 GTGGGGGAGCAAAGGGGGGATGG - Intergenic
1181630508 22:24148741-24148763 CTGTTCCAGCAGAGGCAGGAAGG + Intronic
1182052584 22:27324416-27324438 AGGTGGGAGAAAAGGAAGGAGGG + Intergenic
1183541028 22:38429568-38429590 GTGTGGGAAGGAAGGCAGGAGGG - Intronic
1183642698 22:39101728-39101750 CTGTGGGAGGCCAGGAAGGAAGG + Intronic
1184170448 22:42756293-42756315 CTAGGGGAGCTAAGGCGGGAGGG - Intergenic
1184996510 22:48211028-48211050 CTGTGGGAGCAAGAGGAGAAGGG + Intergenic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
1203282334 22_KI270734v1_random:137541-137563 CTGGGGCAGGAAAGGCTGGAGGG - Intergenic
949170010 3:986340-986362 CTGGGGGAGAAAAGCCAGGGTGG + Intergenic
949417559 3:3830623-3830645 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
949891829 3:8738973-8738995 TTGTGGGAGAGAAGGCAGGAAGG + Intronic
949931174 3:9079614-9079636 CTGTAGGACCATAGGCAGGTGGG - Intronic
950104690 3:10380622-10380644 CTGGAGAAGCAATGGCAGGACGG - Intronic
950466387 3:13157640-13157662 CCAGGGGAGCAAAGGAAGGAAGG + Intergenic
950604373 3:14065045-14065067 CTTTGGGTGCAGAGCCAGGAGGG + Exonic
951003644 3:17593115-17593137 CTGAGGGAGAGAAGGCAGGGTGG - Intronic
951580100 3:24153610-24153632 CTGAAGGAGCAAAGACAGGAGGG - Intronic
951970726 3:28441604-28441626 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
952272152 3:31843628-31843650 TTGGGGCAGCAAAGGAAGGAGGG - Intronic
952367772 3:32689991-32690013 CATAGGGAGCAAAGGCAGCATGG + Intronic
952384316 3:32828740-32828762 CTTTGGGAGGACAGGCAGGAGGG - Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953794111 3:45969966-45969988 CAGTGGGAGGAAAGCCATGATGG - Intronic
953904269 3:46860675-46860697 CTGGGGAAGCCAAGACAGGAAGG - Exonic
954627838 3:52032328-52032350 CTGTGGTCGCAAAGGAGGGATGG - Intergenic
954776774 3:53026591-53026613 CTGTGGGGGCACAGGGAGGGAGG - Intronic
955070481 3:55568670-55568692 GGATGGGGGCAAAGGCAGGAAGG - Intronic
955396228 3:58559721-58559743 CTGTGGGGGCACAGGCAGACTGG - Intergenic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
956024992 3:64973868-64973890 CTGTGGAGGCCAAGGCAGGGGGG - Intergenic
956126384 3:66014845-66014867 CAGTGGGAGCAAAGGCCTGGAGG - Intronic
956182980 3:66534611-66534633 TTATGGGAGCAAAGGCAGCTAGG - Intergenic
956360482 3:68441701-68441723 CTGAGGGAGAAAAGGCAGGGTGG - Intronic
956717438 3:72090781-72090803 CAGAGTGAGCAAAGGCAAGAAGG + Intergenic
958487650 3:94732211-94732233 CTGTGGGAGAGAAGGCAGGGTGG + Intergenic
958867155 3:99514763-99514785 CTGCTGGAGCAAAGGTATGAAGG - Intergenic
959997887 3:112698583-112698605 CTGGGGGAGAGAAGGCAGGGGGG - Intergenic
960052278 3:113250385-113250407 CTCTGGGAACAAAGGCAGGTTGG + Intronic
960585448 3:119316943-119316965 CAGGGAGAGCAAAGACAGGAGGG - Intronic
960996494 3:123343772-123343794 GTGGGGGAGGACAGGCAGGAGGG + Intronic
961450004 3:126998409-126998431 CTGTGGGGACACAGGCAGCAGGG - Intronic
961462848 3:127063679-127063701 TTGCGGGGGCCAAGGCAGGAAGG - Intergenic
961553503 3:127682006-127682028 CTGGGGGAGGAAAGGAAGGCTGG + Intergenic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
961809493 3:129513771-129513793 ATGCGGGAGGAAGGGCAGGAGGG + Intronic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
963016235 3:140826762-140826784 CTGTGTAGGCAAAGGCAGGATGG - Intergenic
963108372 3:141665476-141665498 CTGTAGGAAGAAAGGAAGGAAGG + Intergenic
963139461 3:141935603-141935625 CTTGGGAAGCTAAGGCAGGAGGG + Intergenic
963433028 3:145233906-145233928 CTGTGGGAGTTCAGTCAGGATGG + Intergenic
963974076 3:151461044-151461066 CTCTGGGAGGGAAGGAAGGAAGG + Intergenic
964867513 3:161277427-161277449 CTGTGGGAGTTAAGGCAGGCTGG + Intergenic
965226735 3:166000497-166000519 CTGGGGGAGAGAAGGCAGGGAGG + Intergenic
965351321 3:167614994-167615016 CAGAAGGAGGAAAGGCAGGATGG - Intronic
965539814 3:169860703-169860725 GTCTGGGAGAAAAGGCAGCAAGG + Exonic
966014266 3:175121959-175121981 TTGTGGCAGTAAAGACAGGACGG - Intronic
966476524 3:180354609-180354631 CTGTGGGGACAAAGGCAAAATGG - Intergenic
967192446 3:186996614-186996636 CTGAAGTAGCAAAGGCAAGAAGG + Intronic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
969559882 4:7939978-7940000 CTGAGGGAACAAAGGGAGGTTGG + Exonic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972095524 4:35342952-35342974 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972723160 4:41721024-41721046 CAGGGGGAGGGAAGGCAGGAGGG + Intergenic
973711252 4:53632269-53632291 CTGTGAGAGAAAAGGGAGGATGG - Intronic
974095203 4:57356051-57356073 CTGTGGGAGGAAGGAAAGGAGGG - Intergenic
974564819 4:63568572-63568594 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
974727245 4:65812785-65812807 CTTGGGGAGAGAAGGCAGGATGG - Intergenic
975127804 4:70801726-70801748 CTTTGGGAGCAAGGCCAGAAAGG - Intronic
975386688 4:73767246-73767268 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
975942799 4:79668217-79668239 CTGTGGGATGAATGGCAGCAGGG + Intergenic
976233337 4:82868893-82868915 CTTTGGGAGGCAAGGCAGGCTGG - Intronic
976511321 4:85912386-85912408 CTGTGGGAGAAAAAGCACAATGG + Intronic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
979101083 4:116615410-116615432 ATGAGGGAACAAAGGAAGGAAGG + Intergenic
979548980 4:121969143-121969165 CAGTGGAAGAAAAGGAAGGAGGG - Intergenic
980497500 4:133605099-133605121 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
980602230 4:135040283-135040305 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
981233210 4:142383767-142383789 CAGTGGTTGCACAGGCAGGAGGG + Intronic
981921019 4:150084852-150084874 CAGTGGTAGCATGGGCAGGAAGG - Intronic
983559010 4:169082874-169082896 CTTTGGGAGCCAAGGCGGGTGGG - Intergenic
984766583 4:183404748-183404770 CTGCAGGAGCCCAGGCAGGAAGG + Intergenic
984883415 4:184429618-184429640 CTCTGGAAGTAAAGTCAGGAGGG - Intronic
985524479 5:395033-395055 TTGGGAGGGCAAAGGCAGGACGG + Intronic
985616829 5:927553-927575 CTGCGGGGGCAAAGGCCGGAAGG - Intergenic
985877765 5:2613251-2613273 CCCTGGGAGCCGAGGCAGGAGGG - Intergenic
985951576 5:3225511-3225533 CTGTGGGAGGAGAAGCAGGCTGG - Intergenic
986420656 5:7577968-7577990 CTGTTATAGCTAAGGCAGGAGGG + Intronic
986742951 5:10719769-10719791 CTGTGGGAGAGAAGGCAGGGTGG - Intronic
987468158 5:18296725-18296747 CTGAGGGAGAGAAGGTAGGATGG + Intergenic
988160797 5:27516607-27516629 CTGTGGGAGAGAAGGCAGGGTGG + Intergenic
988233262 5:28506826-28506848 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
989404174 5:41042087-41042109 CTGGGGGATCAAAGACAGGTGGG - Exonic
989486353 5:41996095-41996117 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
992438165 5:76774998-76775020 GTATGGGAGCTGAGGCAGGAGGG + Intergenic
993322559 5:86490658-86490680 GTGAGGGAGCAGAGGAAGGATGG - Intergenic
993904925 5:93612146-93612168 CCGTGGGACCAAGGGCCGGACGG + Intergenic
994680576 5:102881841-102881863 CTTTGGGAGAAAAGGTGGGAAGG - Intronic
994947462 5:106414433-106414455 CTTTGGAAGCCAAGGCAGGAGGG + Intergenic
995023477 5:107392769-107392791 CTGTGGGAGCAAGGGCATGCTGG - Intronic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
995617043 5:113976459-113976481 CTGTTAGAGCAGAGCCAGGATGG + Intergenic
995655957 5:114426072-114426094 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
997031187 5:130130739-130130761 CTGAGGGAGTAAAGGCAGTATGG - Intronic
997159043 5:131587899-131587921 CTGAGGGAGCAAACCCAGCAAGG - Intronic
997443384 5:133924656-133924678 AGGTGGGAGGAAAGCCAGGAGGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
998016066 5:138733352-138733374 CTCAGGGAGCAAGGACAGGATGG + Intronic
998221942 5:140289962-140289984 GTCTGGGAGCATAGGCAGGCAGG - Intronic
998757565 5:145397829-145397851 CTATGGGAGCCAAAGCAGCAAGG + Intergenic
999383164 5:151136000-151136022 CTGCAGAAGCAATGGCAGGAAGG + Intronic
999476063 5:151899855-151899877 CTGTGGGAGGTAGGACAGGAAGG - Intronic
1000647147 5:163772637-163772659 CTATGGGAGCAAAGGAGGGGTGG + Intergenic
1001173629 5:169444908-169444930 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1001266263 5:170276605-170276627 CTGGGGGAGCTGGGGCAGGAGGG + Intronic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1001962073 5:175885584-175885606 ATCTGGGAGAACAGGCAGGAGGG - Intergenic
1002050514 5:176568098-176568120 GTGTCGGAGCAGAGGCTGGATGG + Intronic
1002069106 5:176668312-176668334 CTCTGGGACCACAGGCAGGAAGG - Intergenic
1002704101 5:181148739-181148761 CTGTGGGAGCCAAGATGGGAAGG + Intergenic
1002997996 6:2305011-2305033 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1003295048 6:4818906-4818928 CTGTGGTCTTAAAGGCAGGAAGG - Intronic
1003693290 6:8376137-8376159 CTGTGGGAGCATATGTAGGATGG - Intergenic
1003712506 6:8608345-8608367 ATGTGGGAGCTAAGCCATGAGGG - Intergenic
1004449413 6:15730972-15730994 CTGTGTCTGGAAAGGCAGGAGGG - Intergenic
1004540386 6:16544249-16544271 CTGTGGGAACAATGCAAGGAAGG - Intronic
1005236210 6:23764996-23765018 CTGTGGAAGAAAAGGCAAGCTGG - Intergenic
1005394160 6:25364185-25364207 CTCTGGGAGGCCAGGCAGGAGGG - Intronic
1005500272 6:26423141-26423163 CTTTGTGAGCAAAGACAGCAGGG + Intergenic
1005799974 6:29410616-29410638 CTGTGGGACCAAGGGCTGGTTGG + Intronic
1006217709 6:32459635-32459657 CTGTGGGAGGGAACACAGGAGGG - Intergenic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1007165791 6:39828029-39828051 CTGTGGGAGCACAGGTGAGAGGG - Intronic
1007478337 6:42133990-42134012 CTGAGGGAGAAGGGGCAGGAGGG - Intronic
1007664405 6:43505868-43505890 CTGGTGCAGCAATGGCAGGAAGG - Exonic
1007739226 6:44000894-44000916 TTGGGGGAGCATAGGCAGAAGGG - Intronic
1007862676 6:44929799-44929821 ATGTGGGAGCCAAGACAGGGTGG + Intronic
1008040729 6:46795716-46795738 TTTAGGGAGCAAAGGCAGAAAGG - Intronic
1008079348 6:47178307-47178329 CTGAGGGAGGATAGGCAGGGTGG + Intergenic
1008266893 6:49439024-49439046 CTGAGGGAGAGAAGGCAGGGTGG + Intronic
1008507624 6:52246399-52246421 CTGGGGCAGCAGAGCCAGGACGG + Intergenic
1008513425 6:52298084-52298106 CTGTGTGAGCAAAGGCAATTGGG - Intergenic
1009042287 6:58193495-58193517 CTGTTGCAGGAAAAGCAGGAAGG + Intergenic
1009198165 6:60712044-60712066 CTGTGGGAGCACAGACAACATGG - Intergenic
1009218126 6:60947715-60947737 CTGTTGCAGGAAAAGCAGGAGGG + Intergenic
1010107974 6:72190648-72190670 CTGTGGGGGAGAAGGCAGGGTGG + Intronic
1010669591 6:78672040-78672062 CTCTGGAGGCTAAGGCAGGAGGG + Intergenic
1010806778 6:80246493-80246515 TTGTAGTAGCAATGGCAGGAAGG - Intronic
1012920767 6:105219280-105219302 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1013044398 6:106470058-106470080 CTCGGGGACCAAAGGGAGGAGGG - Intergenic
1013123468 6:107160721-107160743 CTGTTTGAGCAAAGGCACAAAGG + Intronic
1013160786 6:107542784-107542806 GTGTGGGAGGAAAGGCACCAGGG + Intronic
1013298346 6:108780343-108780365 ATGTGGGAGACAAAGCAGGAAGG + Intergenic
1013406698 6:109850067-109850089 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
1013677963 6:112488205-112488227 CTGTGATAGGAAAGGGAGGAAGG - Intergenic
1013866396 6:114702280-114702302 GGGAGGGAGGAAAGGCAGGAGGG - Intergenic
1014215386 6:118747956-118747978 CTGTTAGAGCAAAGGAAGGTAGG - Intergenic
1014417015 6:121195650-121195672 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1014631672 6:123797063-123797085 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1015103835 6:129512836-129512858 CAGTGGGAGAAAAGGCAGAGAGG + Intronic
1015513342 6:134060890-134060912 CAGTGGGAGGGAAGGCAGGATGG + Intergenic
1015552416 6:134426017-134426039 ATGTGGGAGCTAAGGTAGGAAGG - Intergenic
1015700732 6:136033499-136033521 CTGTGGGAGCAACAGCAGAAGGG - Intronic
1015998109 6:139015163-139015185 CAATCAGAGCAAAGGCAGGAAGG + Intergenic
1016147299 6:140692451-140692473 CTGTGGGGGAGAAGGCAGGGTGG + Intergenic
1016566665 6:145462835-145462857 CATTTGGAGCAAAAGCAGGAAGG - Intergenic
1017227778 6:152040827-152040849 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
1017388427 6:153911958-153911980 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1017454942 6:154593249-154593271 CTGGGGGAGGGAAGGCAGGCGGG - Intergenic
1017515988 6:155156198-155156220 CAGTGGGAGCAAATGCAGTGTGG + Intronic
1017554982 6:155554088-155554110 CTGTGGGAGCATATTCAGGTTGG + Intergenic
1018122899 6:160654958-160654980 CTGGGGGAGGGAAGGCAGGGTGG + Intronic
1018790245 6:167142980-167143002 CTGGGGGCCCAAAGGCAGCAAGG - Intergenic
1018803760 6:167242728-167242750 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG + Intergenic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1020116364 7:5478550-5478572 AGCTGGGAGCACAGGCAGGAGGG + Intronic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1020603692 7:10308119-10308141 CTGTGTGAGTAAAAGCAGAAAGG - Intergenic
1021121450 7:16800382-16800404 CTGTGGGAGGAACAGCACGAAGG + Intronic
1021349854 7:19578618-19578640 CTTTGGGAGTAATGACAGGAAGG - Intergenic
1021405769 7:20265677-20265699 TTGTGGGAGCGATGGAAGGAAGG + Intergenic
1021988843 7:26123187-26123209 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1022371031 7:29771577-29771599 CTGTGAGTGGAAATGCAGGAAGG + Intergenic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022909327 7:34884878-34884900 CAGTGAGGGCACAGGCAGGAAGG - Intergenic
1024337061 7:48219757-48219779 CTGTGGAGACAAAGTCAGGATGG - Intronic
1024574080 7:50749809-50749831 CTGTGGGCCCAAAGACGGGATGG - Intronic
1024884312 7:54124382-54124404 CTGAGGGAGAGAAGGCAGGGTGG + Intergenic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1025913408 7:65846400-65846422 GTGAGGGAGGAAAGGAAGGAAGG - Intergenic
1026476486 7:70740394-70740416 CTGAAGCAGCAAAGGAAGGAAGG - Intronic
1026514432 7:71056173-71056195 TTGTGGGGGCCAAGGCACGAAGG - Intergenic
1026877528 7:73888061-73888083 CTGGGGGTGCAAATACAGGAGGG - Intergenic
1026993417 7:74600792-74600814 CGGTGTTAGCAAAGGCAGGCAGG + Intronic
1027911757 7:84260669-84260691 CAGAGGGAGCCAAGGCAGCAGGG - Intronic
1029111894 7:98217019-98217041 CTGGGGCAGCAGAGCCAGGATGG - Exonic
1030497327 7:110316003-110316025 CTTTGAGAGCAAGGCCAGGAAGG + Intergenic
1030524309 7:110635199-110635221 CTGTGGGCACATAGGTAGGATGG - Intergenic
1030624372 7:111828229-111828251 ATGTGGGAGCAAAGACCTGAGGG - Intronic
1030979865 7:116173832-116173854 TTCTGGGAGCAAAGGAGGGAGGG - Intergenic
1031236857 7:119188287-119188309 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1032026565 7:128447247-128447269 CTGTGGAAGTAAAGTGAGGATGG - Intergenic
1033247036 7:139726386-139726408 ATGTGAGAGCAAAGGAAAGAGGG + Intronic
1033919197 7:146367687-146367709 CTGTGTTAGCAAAGGCAAAAAGG - Intronic
1034067160 7:148148053-148148075 GTGTGGAAGGAAAGGAAGGAAGG + Intronic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1035045126 7:155960495-155960517 CCGTGGGACCAACGGCAGGTAGG - Intergenic
1035481767 7:159192592-159192614 CTGTGGGAGGGAAGGAAGCAGGG + Intergenic
1036095142 8:5715787-5715809 CTGTGAAAGCAAGGGAAGGAGGG + Intergenic
1036114324 8:5942028-5942050 CTGAGGGAGCTAAGACGGGAGGG + Intergenic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1038660209 8:29490636-29490658 CTGTTGGAGGAAAGGCAGGTGGG + Intergenic
1039600126 8:38829514-38829536 ATGTGGGAGCAAAAGCATGCTGG - Intronic
1040046954 8:42974480-42974502 CTTTGGGAGCCAAGGCGGGTGGG - Intronic
1041311589 8:56523030-56523052 GTGAGGGATCAGAGGCAGGAAGG - Intergenic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1042186433 8:66140799-66140821 AGGTGGGAGCAAAGCCAGAAAGG - Intronic
1042287645 8:67131765-67131787 TTGTCAAAGCAAAGGCAGGAAGG + Intronic
1042567525 8:70127563-70127585 GAGAGGGAGGAAAGGCAGGATGG + Intronic
1042732696 8:71954859-71954881 CTGAGGAAGCTAAAGCAGGAGGG - Intronic
1043342724 8:79260395-79260417 CTGTGGATGCCAAGGCAGGTGGG - Intergenic
1044150827 8:88773336-88773358 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
1044487128 8:92766920-92766942 CTGCGGGAGAGAAGGCAGGGTGG + Intergenic
1045388826 8:101694973-101694995 CTGTGGGAGCAAAGCAAGCTGGG - Intronic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1046090438 8:109497386-109497408 CAGTGGGAACAAAGGCAGGGAGG - Intronic
1046823684 8:118663285-118663307 CTATCGGAACAAAGCCAGGAAGG + Intergenic
1047551239 8:125874591-125874613 CTGTGTGAGCAAAGGCACACAGG - Intergenic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048271896 8:133035998-133036020 CTGAGGGAGCTAGGGAAGGAGGG - Intronic
1048382849 8:133883373-133883395 CTGTGAGAGCAAAGGTTGGCAGG + Intergenic
1048565627 8:135593718-135593740 TTGTGGAAGCCGAGGCAGGAGGG - Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049654016 8:143789848-143789870 CTTCGGGAGCAGACGCAGGAGGG + Intergenic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051356062 9:16240601-16240623 CTGCTGGAGCAAAACCAGGAAGG + Intronic
1052018512 9:23498282-23498304 CTGTGGGCTCCAAGGCATGAGGG + Intergenic
1052442236 9:28512019-28512041 CTGGGGGAGAGAAGGCAGGATGG + Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053866727 9:42446210-42446232 GGGTGGGAGAAAAGGCAGCAGGG + Intergenic
1053942913 9:43270278-43270300 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1054244640 9:62652453-62652475 GGGTGGGAGAAAAGGCAGCAGGG - Intergenic
1054453113 9:65413736-65413758 CTGTGGGAGCAAATGTGGGCGGG - Intergenic
1054558767 9:66686996-66687018 GGGTGGGAGAAAAGGCAGCAGGG - Intergenic
1054733115 9:68721517-68721539 ATATGGTAGCAGAGGCAGGAGGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057567565 9:96178793-96178815 TTCTGGAAGCAAAAGCAGGAAGG + Intergenic
1057794610 9:98146298-98146320 CTCAGGGAACAAAGGCAGCAGGG - Intronic
1058073287 9:100623716-100623738 CTTTGGGAGGCCAGGCAGGAGGG + Intergenic
1058091857 9:100814185-100814207 CAGAGGGAGCCAAGGCAGCAGGG - Intergenic
1058935782 9:109767987-109768009 AGGAGGGAGCAAAGGCAGGTAGG + Intronic
1059336821 9:113574375-113574397 CTGTGGAAGTAGAGGCAGCAGGG - Intronic
1059399829 9:114061955-114061977 CAGTGGGAGCAAAGGCAGGGTGG - Intronic
1060217301 9:121746078-121746100 CTGTGGGGGGAGAGTCAGGAAGG + Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060473231 9:123965902-123965924 CTGTGGGACCAAGGCAAGGAAGG - Intergenic
1060637339 9:125209735-125209757 CTGTGTGTGCAAAGGCATGGAGG - Intronic
1061052461 9:128204462-128204484 TTGTGGGATCAGAGGCGGGAGGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061497837 9:130985822-130985844 CCGTGAAAGCCAAGGCAGGAGGG + Intergenic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062729472 9:138101060-138101082 TTATGGCAACAAAGGCAGGATGG - Intronic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1185834360 X:3331147-3331169 CTTTGGGAGCCCAGGCAGGAGGG - Intronic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186279529 X:7977381-7977403 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1186873852 X:13797982-13798004 GAGTGGGAGCATAGGAAGGATGG + Intronic
1187048072 X:15667824-15667846 CTCTGGGAGCTGAGGCAGGAGGG - Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187604899 X:20872125-20872147 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1187915752 X:24150483-24150505 CTGCGGGAGGCAAGGCAGGAAGG - Intronic
1189181780 X:39011568-39011590 CTGTAAGAGCAAAGGCCTGAAGG + Intergenic
1190076393 X:47320370-47320392 CTATTGGAGCAAAGACAGGAGGG - Intergenic
1191095676 X:56670906-56670928 CTGGGGGAGAGAAGACAGGATGG + Intergenic
1192661536 X:73047500-73047522 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1192673228 X:73168155-73168177 TTGGGGGAGAGAAGGCAGGATGG + Intergenic
1193356283 X:80523384-80523406 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1193399134 X:81021355-81021377 CTCTGGGAGCACAGGCTGAAAGG + Intergenic
1193447181 X:81619030-81619052 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
1193832979 X:86310363-86310385 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1193957319 X:87878478-87878500 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1194833984 X:98659064-98659086 CTGGGGGAGAGAAGGCAGGCTGG - Intergenic
1195342071 X:103916096-103916118 CCTTCGGAGCAAAGGCAGAAAGG + Intergenic
1195365849 X:104124644-104124666 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
1195505019 X:105646892-105646914 CTTTGGGAGCAAAGGCTGGCTGG - Intronic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1197591895 X:128419645-128419667 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1198934072 X:141888140-141888162 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1199318731 X:146412832-146412854 CTGTGGGAGGACAGGCATGCTGG + Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200521299 Y:4212287-4212309 CTGAGGGAGAGAAGGCAGGGCGG - Intergenic
1201193688 Y:11471157-11471179 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1202134520 Y:21647812-21647834 TTGAAGGAGAAAAGGCAGGATGG + Intergenic