ID: 1090269259

View in Genome Browser
Species Human (GRCh38)
Location 11:125374444-125374466
Sequence AGTCAGGGGGGTGATCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090269253_1090269259 6 Left 1090269253 11:125374415-125374437 CCTGAGGTAACATCTCAGCTGCT 0: 1
1: 0
2: 3
3: 15
4: 217
Right 1090269259 11:125374444-125374466 AGTCAGGGGGGTGATCCTGCTGG 0: 1
1: 0
2: 2
3: 13
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090269259 Original CRISPR AGTCAGGGGGGTGATCCTGC TGG Intronic
900793857 1:4695898-4695920 AGACAGGAGCGTGATCCTGTGGG + Intronic
901065946 1:6494723-6494745 AGTCAGGGAGGGCATCCTGGAGG - Intronic
901834061 1:11912315-11912337 AGTCAGGGAGGTCTTCCTGGAGG - Intergenic
902700374 1:18168086-18168108 AGGCAGCAGGGTGGTCCTGCTGG - Intronic
904539147 1:31221060-31221082 AGTCAGTGTGGTGAGCATGCGGG + Intronic
906704129 1:47882333-47882355 ACTCAGGGGGCAGATCCTGGGGG - Intronic
914455887 1:147835950-147835972 AGTCTGGGGGGTAATGGTGCAGG - Intergenic
915064018 1:153210032-153210054 AGTCAGGGGCTTGATTCTGAAGG - Intergenic
916543349 1:165778603-165778625 AGTCAGTGTGGTGATTCTTCAGG - Intronic
916773086 1:167932942-167932964 AGTCAGGTGGGGGATAATGCGGG + Intronic
919749135 1:201025697-201025719 AGTCAGAGGGGACCTCCTGCAGG - Intergenic
920048908 1:203151540-203151562 AATCAGGGGTGTGCTCCTGGTGG + Intronic
921356167 1:214286395-214286417 AGTCAGGAGGTTGATGCTGCAGG + Intronic
923339615 1:232996252-232996274 AGTCAGGGGGGTGTGGCTGCGGG - Intronic
1066594117 10:37030184-37030206 AGTCAGTGTGGTGATTCTTCAGG + Intergenic
1067080821 10:43211355-43211377 GGTCAGGGGTGTGACCCTGGAGG - Intronic
1068404735 10:56574373-56574395 AGTGATGGGGGTGCTGCTGCAGG + Intergenic
1070439188 10:76426162-76426184 AGTCAGTGTGGTGATTCTGCAGG - Intronic
1070624547 10:78041357-78041379 AGTCATGGGGCTGGGCCTGCTGG + Intronic
1071243344 10:83735481-83735503 CGTCAGGGGGGTGATCCTGGTGG - Intergenic
1071386981 10:85131303-85131325 AGTCAGTGTGGTGATCCCTCAGG + Intergenic
1071863419 10:89699800-89699822 AGTCAGGGGAGTGAATCTGTAGG - Intergenic
1073059079 10:100722761-100722783 AGTCCTGGGGGTGACCCTGCTGG - Intergenic
1074285630 10:112095247-112095269 AGTCAGGGGGGTCCTTCTGAAGG - Intergenic
1075221434 10:120588342-120588364 AGGCAGGGGGGTGCATCTGCAGG - Intronic
1075778993 10:125004990-125005012 AGCCACGGGGGGGCTCCTGCTGG + Intronic
1076156112 10:128206982-128207004 AGTGAGGTGGGTGAGGCTGCTGG + Intergenic
1076574813 10:131457532-131457554 AGACAGAGGGGGGATCCTGGAGG + Intergenic
1077009393 11:373429-373451 AGTCTGGGGGGTGATAGAGCAGG - Exonic
1078876157 11:15399866-15399888 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
1080416409 11:32073400-32073422 AGGAAGGGGGGTGCTCCTGGAGG - Intronic
1081233461 11:40616341-40616363 AGTCAGTGTGGTGATCCCTCAGG + Intronic
1082152743 11:48762529-48762551 AGTCAAGGTGGCGATTCTGCAGG - Intergenic
1082560707 11:54617614-54617636 AGTCAGTGTGGTGATTCTTCAGG + Intergenic
1083924025 11:65795230-65795252 TGTCAGGGTGGTGCTCCTTCAGG - Exonic
1084351530 11:68603495-68603517 AACCAGGGGTGAGATCCTGCTGG + Intronic
1084497438 11:69513250-69513272 ACTCAGGAAGGTCATCCTGCAGG - Intergenic
1085315861 11:75544569-75544591 AGTCAGGGAGGTTGTCCTGGAGG + Intergenic
1087309367 11:96521933-96521955 AGTCAAGGGGTTCCTCCTGCTGG + Intergenic
1090269259 11:125374444-125374466 AGTCAGGGGGGTGATCCTGCTGG + Intronic
1094190105 12:27689458-27689480 AGTACAGGGGCTGATCCTGCAGG + Intronic
1095066140 12:37777801-37777823 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
1096787764 12:54027380-54027402 AGGCAGGGGCTTGAGCCTGCAGG + Intronic
1106549917 13:30762197-30762219 AGTGTGGGGGCTGATGCTGCTGG + Intronic
1107113312 13:36721039-36721061 AGTCAGGGGAGTGATACTCCTGG - Intergenic
1107320108 13:39177488-39177510 AGGAAGTGGGGTGATCCTGAGGG + Intergenic
1108595334 13:51944216-51944238 GGTCATGCGGGTGCTCCTGCTGG - Exonic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113941101 13:114019013-114019035 GGTCAGGAGGGTGATCCTGTAGG + Intronic
1115233791 14:31188897-31188919 AGTGAGGTGGGTGACCCTGTGGG - Intronic
1118285342 14:64465622-64465644 AGGCAGGGCGGGGAGCCTGCGGG + Intronic
1118452229 14:65913394-65913416 AGACAGGGAGGTGAGCCTGTGGG - Intergenic
1119896627 14:78225159-78225181 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
1120750363 14:88191805-88191827 AGTCAGGAAGCTGAACCTGCAGG + Intronic
1120829333 14:88984212-88984234 AGTCAAGGGGGTTTTCCTTCAGG - Intergenic
1122257406 14:100489001-100489023 GGGCAGGTGGGTGCTCCTGCAGG - Intronic
1122503270 14:102215904-102215926 AGGCAGGGGGGTAGGCCTGCGGG - Intronic
1123990429 15:25679560-25679582 AGACAGGGGGGTCACCCTGCCGG + Exonic
1124102807 15:26711752-26711774 AGACAGGTGGTTGATGCTGCTGG - Intronic
1124131060 15:26986025-26986047 AGTCAGAGGGGTGGTCCGGCAGG - Intronic
1127674761 15:61228784-61228806 AGCCAGGGGGGTGAGCCCGCCGG + Intronic
1129161695 15:73751476-73751498 AGGCAGGGGGATGACTCTGCAGG + Exonic
1129479393 15:75811021-75811043 AGGCAGGGGCCAGATCCTGCAGG - Intergenic
1130862145 15:87900659-87900681 AGTCAGGCTGCTGATGCTGCAGG - Intronic
1131074029 15:89483757-89483779 AGACAGGGGGGCCTTCCTGCAGG + Intronic
1131367525 15:91853320-91853342 AGTAAGGGGGGTGCCCCTGAGGG - Intergenic
1131928563 15:97413876-97413898 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
1132239670 15:100248159-100248181 AGGGAGAGGGGTGATCCTACAGG - Intronic
1136235213 16:28909603-28909625 ACTCAGGAGGGTGAGGCTGCAGG + Intronic
1138750017 16:59408411-59408433 AGTCAGTGTGGTGATCCCTCAGG - Intergenic
1138799021 16:60003101-60003123 AGTGATGGGGTTGATTCTGCAGG - Intergenic
1138810131 16:60139739-60139761 AGCAAGGGGGGTGGTCCTGAGGG + Intergenic
1142864935 17:2785039-2785061 AGGCAGGGGGATGATGCCGCAGG - Intronic
1144890913 17:18493913-18493935 AGTTAGGAGGCTGATGCTGCAGG + Intronic
1144944658 17:18963758-18963780 GGTCAGGGTGGTGATTCTCCAGG - Intronic
1145141311 17:20450405-20450427 AGTTAGGAGGCTGATGCTGCAGG - Intronic
1145240404 17:21237683-21237705 AGTCAGGTGGGAGATCTGGCTGG - Intergenic
1148759633 17:49992989-49993011 TGTAAGGAGTGTGATCCTGCCGG - Intronic
1148983277 17:51598043-51598065 AATCATGGGGGTGATCCTCATGG + Intergenic
1152275487 17:79354203-79354225 TGTCAGTGTGGTGATCCTGTGGG + Intronic
1153698613 18:7669207-7669229 ATTCAGCAGGGGGATCCTGCTGG + Intronic
1158793980 18:60818822-60818844 AGTCAGTGTGGTGATCCCTCAGG - Intergenic
1160335545 18:78035552-78035574 AATCAGGAAGGTGCTCCTGCAGG + Intergenic
1166891775 19:45998479-45998501 AGTCAGGGAGGGCTTCCTGCAGG + Intronic
1167007045 19:46782808-46782830 AGTCAGGGGGGACTTCCTGGAGG + Intronic
1167088104 19:47324292-47324314 AGTCAGGGAGGTATTCCTGGAGG - Intergenic
1167713909 19:51128557-51128579 AGTCCTGGGGGTCATCCTGTGGG - Intronic
927342890 2:22002578-22002600 TGTCCTGGTGGTGATCCTGCTGG + Intergenic
928769597 2:34690939-34690961 GGTAAGGGGGTTGAGCCTGCTGG + Intergenic
933648367 2:84830265-84830287 AGGCAGGGGCGGGATCCTCCCGG + Intronic
937204752 2:120228320-120228342 AGTCAAGGAGGTGACCCTGAAGG - Intergenic
938535411 2:132236706-132236728 AGTCAGTGTGGTGATCCCTCAGG + Intronic
939617392 2:144376784-144376806 AGTCATGAGAGTCATCCTGCTGG - Intergenic
940199956 2:151139883-151139905 AGTGAGGGCCGTGAGCCTGCGGG - Intergenic
946331677 2:219013117-219013139 AGTCTGGGGGTTCAACCTGCTGG + Intronic
947696182 2:232191395-232191417 AATCAGGTGGGTGATCAAGCTGG + Intronic
949031441 2:241799226-241799248 AGTGGGGGGCGTGATCATGCTGG - Intronic
1169428674 20:5516349-5516371 AGTCAGTGTGGTGATTCTTCAGG + Intergenic
1170866445 20:20162034-20162056 AGACAGGGGCGTGTTCCTTCTGG + Intronic
1171722007 20:28572382-28572404 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
1171772619 20:29336036-29336058 AGTCAGTGTGGTGATCCCTCAGG + Intergenic
1171903157 20:30875654-30875676 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
1171903875 20:30883433-30883455 AGTCAGTGTGGTGATCCCTCAGG - Intergenic
1174174677 20:48637294-48637316 AGCCAAGGGGGTGCTACTGCAGG - Intronic
1175302899 20:57955553-57955575 AGTCATTGGGGTGAGGCTGCAGG + Intergenic
1179389334 21:40973259-40973281 AGTCAGTGTGGTGATCCCTCAGG + Intergenic
1180222692 21:46369428-46369450 AGACAGGGGTCTGATGCTGCTGG + Intronic
1180337300 22:11589576-11589598 AGTCAGTGTGGTGATCCCTCAGG - Intergenic
1181640260 22:24192696-24192718 AGTCAGGGGGGGCTTCCTGGAGG - Intergenic
1182880129 22:33725941-33725963 AATCAGGGGAGAGATGCTGCTGG + Intronic
1183228592 22:36566676-36566698 AGGCAGTGGGGAGCTCCTGCAGG - Intronic
1184042304 22:41951410-41951432 AGGCAGAGAGGTGATGCTGCTGG - Intergenic
949818781 3:8092450-8092472 AGGCAGGGGTCTGCTCCTGCTGG + Intergenic
952188466 3:30996681-30996703 AGTCAGGGGGAGCATCCTGAAGG - Intergenic
952379589 3:32794472-32794494 AGTCTGGGGAGGGAACCTGCCGG + Intergenic
953288987 3:41642749-41642771 AGTCAGTGTGGTGATTCTTCAGG - Intronic
954257295 3:49415705-49415727 AGGCAGGGTGGTGTACCTGCTGG + Exonic
956579242 3:70791948-70791970 AGTCAGGGTGGTGATTCCTCAGG - Intergenic
957454210 3:80419951-80419973 AGTCAGTGTGGTGATCCCTCAGG + Intergenic
958697181 3:97542654-97542676 AGTCAGTGTGGTGATTCTTCAGG - Intronic
962103979 3:132371792-132371814 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
964646733 3:158966657-158966679 AGTCTGGGTGCTGCTCCTGCTGG + Intronic
965410630 3:168326308-168326330 CATCAGGAGGGAGATCCTGCTGG + Intergenic
966106017 3:176334867-176334889 AGTCAGGGTGGTGATTCCTCAGG - Intergenic
967999600 3:195195769-195195791 GGCCAGAGGGGTGAGCCTGCTGG - Intronic
972056939 4:34815216-34815238 TGGCAGGGAGGTGGTCCTGCAGG - Intergenic
975803566 4:78088860-78088882 AGTCAGTGTGGTGATTCTTCAGG + Intronic
976535235 4:86206605-86206627 AGTCAGTGTGGTGATTCTTCAGG - Intronic
981344495 4:143659641-143659663 AGTCAGTGGGGTGATTCCTCAGG - Intronic
984682671 4:182628008-182628030 AATCAGGAGTGTGAACCTGCTGG - Intronic
986905266 5:12488118-12488140 AGTCAGGGGAGTCATCTTACAGG + Intergenic
987710225 5:21495173-21495195 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
988749388 5:34179000-34179022 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
988953128 5:36285486-36285508 ATTCAGGAGGCTGATCCTGTGGG - Intronic
989835347 5:45981804-45981826 AGTCAGTGTGGTGATTCTTCGGG + Intergenic
990350256 5:54908908-54908930 AGCCAGGAGGCTGATGCTGCTGG - Intergenic
991737643 5:69642192-69642214 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991760551 5:69914233-69914255 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
991786781 5:70203868-70203890 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991789219 5:70221918-70221940 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991817101 5:70518308-70518330 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991839782 5:70789283-70789305 AGACAAGGGGGTGAGCCTGGGGG + Intergenic
991879227 5:71204253-71204275 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
991881667 5:71222282-71222304 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
993922689 5:93827155-93827177 AGTCAGTGTGGTGATCCCTCAGG - Intronic
994460193 5:100062262-100062284 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
994484341 5:100375687-100375709 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
995152550 5:108866017-108866039 AGTCAGTGTGGTGATTCTTCAGG + Intronic
995232784 5:109788621-109788643 AGTTATTGGGGTGATCCTACTGG + Intronic
995740168 5:115347734-115347756 AGTCAGGGGGCTGGAACTGCCGG + Intergenic
996340701 5:122435739-122435761 GGTGAGGGGGGTGTTCCCGCAGG + Intronic
1001539305 5:172526255-172526277 AATCAGGGGTGTGTTCCCGCTGG + Intergenic
1004147309 6:13079792-13079814 AGCCAGAGTGGTGATCTTGCTGG - Intronic
1005416501 6:25605610-25605632 AGTGAGGAGGGTGATGCTGACGG - Intronic
1005547462 6:26885346-26885368 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
1006996789 6:38268496-38268518 AGTCAGGAGGATGTTCCAGCAGG + Intronic
1008918187 6:56812815-56812837 AGTCAGTGTGGTGATTCCGCAGG + Intronic
1009018224 6:57926413-57926435 AGACAAGGGGGTGAGCCTGGGGG - Intergenic
1009314480 6:62200666-62200688 AGTCAGTGTGGTGATTCTTCAGG + Intronic
1011573902 6:88772901-88772923 AGTCAGTGTGGTGATTCTTCAGG + Intronic
1014571484 6:123014221-123014243 AGTCAGTGTGGTGATCCCTCAGG - Intronic
1015401929 6:132797106-132797128 ATTCAAGGTGATGATCCTGCAGG - Exonic
1015792958 6:136982380-136982402 AGTCAGGGTGGTCTTCCTGCAGG - Intergenic
1016106048 6:140163712-140163734 AGTCAGTGTGGTGATTCTTCAGG + Intergenic
1018705384 6:166460412-166460434 CCTCAGGCGGGTGATGCTGCAGG + Intronic
1018807908 6:167275505-167275527 AGTCAGCGGGGGGATCTTCCAGG + Intronic
1018847462 6:167565567-167565589 GGGCAGGCGGGTGGTCCTGCTGG - Intergenic
1018948655 6:168364502-168364524 ATTCTGGGGGGTGATTCTGAGGG + Intergenic
1020535590 7:9392038-9392060 AGTCTGGGGGGTGAGGCTGAAGG + Intergenic
1021827372 7:24568786-24568808 ATTCACGGGGTTGCTCCTGCTGG - Intergenic
1022072929 7:26935690-26935712 AGTCAGTGTGGTGATTCTTCAGG + Intronic
1023350024 7:39310992-39311014 AGTTAGGAGGGTGATCCTCCAGG + Intronic
1023671423 7:42581125-42581147 AGTCAGTGTGGTGATCCCTCAGG - Intergenic
1023890563 7:44389089-44389111 ATTCAGTGGGGTCATCCTGTTGG - Intronic
1024043186 7:45570641-45570663 ATTCAGGGGGGTGCACGTGCAGG - Intergenic
1025572556 7:62594524-62594546 AGTCAGTGTGGTGATTCTTCTGG - Intergenic
1025927301 7:65970269-65970291 AGACAAGGGGGTGAGCCTGGGGG - Exonic
1025998760 7:66545056-66545078 ACTTGGGGAGGTGATCCTGCAGG + Intergenic
1030739076 7:113086629-113086651 AGTCAGGTAGGGGTTCCTGCTGG - Intronic
1034362162 7:150509515-150509537 GGTCATGGGGGTGGTCCTTCAGG + Intergenic
1034866911 7:154649718-154649740 AGTCAGGCTGCTGCTCCTGCAGG - Intronic
1037527563 8:19741598-19741620 AGTCGGGGAGCTGATCCTGCTGG + Intronic
1037605112 8:20431715-20431737 AGTCAGGGGCCTGATCCTGCAGG - Intergenic
1039774539 8:40722717-40722739 AGTCAGGAGGAGGAACCTGCGGG + Intronic
1045987122 8:108261660-108261682 AGCCAGGGTGGCGCTCCTGCTGG - Intronic
1046269415 8:111874224-111874246 AGTCAGTGTGGTGATTCTTCAGG + Intergenic
1048740865 8:137559141-137559163 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
1049594762 8:143478202-143478224 AGTCAGGGGGACACTCCTGCAGG - Intronic
1051223100 9:14871214-14871236 AGTCAGTGTGGTGATTCTTCAGG - Intronic
1053105507 9:35404764-35404786 AGGCAGGGGAGTGATGCTTCAGG + Exonic
1055804368 9:80076390-80076412 AGTGATGGGGGTGATCCTCGGGG - Intergenic
1057870111 9:98710374-98710396 AGTCAGGGCAGTGCTCCTCCTGG - Intergenic
1059849006 9:118315706-118315728 AGGCAGGGGGGAAATGCTGCTGG + Intergenic
1060724627 9:125998899-125998921 AGTCTGCTGGGTGGTCCTGCTGG + Intergenic
1061587945 9:131580375-131580397 TCCCAGGGGGCTGATCCTGCAGG - Exonic
1061679529 9:132236124-132236146 AGTCAGAGGGGGCTTCCTGCAGG + Intronic
1062264541 9:135680994-135681016 AGTCAGAAGGGCCATCCTGCAGG - Intergenic
1185735096 X:2490161-2490183 CGTCCGGGAGGTGATCCTGAAGG - Exonic
1189147045 X:38666120-38666142 GATCACTGGGGTGATCCTGCTGG + Exonic
1192006763 X:67222642-67222664 AGTCAGTGTGGTGATTCTGCAGG + Intergenic
1192696539 X:73422136-73422158 AGTTTGGGGTGTGATCCAGCAGG + Intergenic
1193410120 X:81152576-81152598 AGTCAGTGTGGTGATCCCTCAGG + Intronic
1193953473 X:87828530-87828552 AGTCAGTGTGGTGATTCTTCAGG - Intergenic
1194356349 X:92889038-92889060 GGTCTGGGGGGTAATGCTGCAGG + Intergenic
1198200281 X:134409675-134409697 ATTCAGGGGGGTGCACGTGCAGG + Intronic
1199469038 X:148173141-148173163 AGTCAGTGTGGTGATTCTTCAGG + Intergenic
1199682543 X:150236948-150236970 AGTCAGCCTGGTGATGCTGCAGG - Intergenic
1201546160 Y:15164439-15164461 AGTCAGTGTGGTGATTCTTCAGG + Intergenic
1201865381 Y:18647603-18647625 AGTCAGTGTGGTGATTCTTCGGG + Intergenic