ID: 1090270056

View in Genome Browser
Species Human (GRCh38)
Location 11:125379716-125379738
Sequence AGGTGTGTGCAGCTGTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 562}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090270056_1090270065 14 Left 1090270056 11:125379716-125379738 CCCGGGGACAGCTGCACACACCT 0: 1
1: 0
2: 1
3: 51
4: 562
Right 1090270065 11:125379753-125379775 GCATTCCAGACCAGCAAATTTGG 0: 1
1: 0
2: 0
3: 12
4: 122
1090270056_1090270060 -8 Left 1090270056 11:125379716-125379738 CCCGGGGACAGCTGCACACACCT 0: 1
1: 0
2: 1
3: 51
4: 562
Right 1090270060 11:125379731-125379753 ACACACCTTGGCCCCAAACTGGG 0: 1
1: 0
2: 0
3: 5
4: 133
1090270056_1090270066 15 Left 1090270056 11:125379716-125379738 CCCGGGGACAGCTGCACACACCT 0: 1
1: 0
2: 1
3: 51
4: 562
Right 1090270066 11:125379754-125379776 CATTCCAGACCAGCAAATTTGGG 0: 1
1: 0
2: 1
3: 8
4: 161
1090270056_1090270059 -9 Left 1090270056 11:125379716-125379738 CCCGGGGACAGCTGCACACACCT 0: 1
1: 0
2: 1
3: 51
4: 562
Right 1090270059 11:125379730-125379752 CACACACCTTGGCCCCAAACTGG 0: 1
1: 0
2: 0
3: 14
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090270056 Original CRISPR AGGTGTGTGCAGCTGTCCCC GGG (reversed) Intronic
900057122 1:640495-640517 AGGTGGGTGCTTCAGTCCCCAGG + Intergenic
900523438 1:3117032-3117054 AGGTGGGCACAGCTGCCCCCAGG + Intronic
900610989 1:3544586-3544608 CGGTGTGTGGAGCACTCCCCAGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901092298 1:6650003-6650025 AGGTGTGAGCCACTGTGCCCAGG - Intronic
901549713 1:9986916-9986938 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
901594876 1:10376978-10377000 ATGTCTGTGCTGCTGTCACCAGG + Exonic
901627592 1:10632741-10632763 AGGTCAGGGCAGCTGTCCCCCGG - Intergenic
901871172 1:12140171-12140193 AGGTGTGGGCTGCCCTCCCCTGG + Intronic
902031194 1:13423714-13423736 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
902411399 1:16213570-16213592 AGGTGAGTACAGTTGTCCCTTGG + Intergenic
902413131 1:16223651-16223673 AGGTGTGAGCCACTGTGCCCGGG + Intergenic
902564687 1:17303641-17303663 AGGGCTATGCAGCTGCCCCCAGG - Intergenic
902836478 1:19050349-19050371 AGGTGTGTGCCACTGTGCCCAGG + Intergenic
903065706 1:20698099-20698121 AGGGGTGTGGAGGTGTCTCCAGG - Intronic
903127595 1:21258414-21258436 ATGTGGGTTCAGCTGTGCCCAGG + Intronic
903891783 1:26574609-26574631 AGGTGTGTGCAGATGGCTACAGG - Intronic
903988000 1:27243169-27243191 AGGTGTGAGCCGCTGCTCCCTGG + Intronic
904052898 1:27650872-27650894 AGGAGTGTGAAGGTGTCCCAGGG + Intergenic
904153364 1:28461806-28461828 AGGCGTGAGCTGCTGTGCCCAGG + Intronic
904404094 1:30274917-30274939 AGGTGGCTGCAGCTGCACCCAGG + Intergenic
904976590 1:34461488-34461510 GGGTGTGTTCAGGTATCCCCAGG - Intergenic
906043677 1:42810422-42810444 AGGTGTGAGCCACTGTGCCCGGG + Intronic
907483801 1:54762840-54762862 AGGTGTGAGCCACTGTGCCCAGG + Intronic
909150160 1:71992071-71992093 AGGTGTGAGCCGCTGTGCCCGGG + Intronic
910271696 1:85402277-85402299 AGGTGTGAGCCACTGTGCCCAGG + Intronic
910773741 1:90854304-90854326 AGGTGGATGCAGCAGACCCCAGG + Intergenic
910910722 1:92230913-92230935 CTGTGTGTGCAGATGTCACCTGG + Intronic
912008507 1:104932548-104932570 GGGTGGTTGCAGCTGTGCCCAGG - Intergenic
912168442 1:107068754-107068776 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
914859443 1:151374035-151374057 TTGTGTGTGCAGCTGCCCCACGG + Intergenic
915103280 1:153515850-153515872 AGGGCTGGGCTGCTGTCCCCTGG + Intergenic
915246688 1:154560417-154560439 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
915864406 1:159483485-159483507 AGGTGTGAGCCACTGTGCCCTGG - Intergenic
916731227 1:167568800-167568822 AGGCGTGAGCCACTGTCCCCAGG - Intergenic
916956174 1:169838215-169838237 AGGTGTGAGCCACTGTGCCCAGG + Intronic
917424562 1:174900796-174900818 AGGTGTGAGCCACTGTGCCCAGG + Intronic
917470763 1:175324071-175324093 GAGTCTGTGAAGCTGTCCCCAGG + Intronic
917744878 1:177997284-177997306 AGGGGTGTCCCCCTGTCCCCAGG + Intergenic
917848914 1:179043372-179043394 GGGTGGCTGCAGCTGTACCCAGG + Intronic
917954310 1:180077393-180077415 AGGTGTGAGCCACTGTGCCCAGG - Intronic
918499084 1:185173736-185173758 AGGTGTGAGCCACTGTACCCCGG - Intronic
918515617 1:185359300-185359322 AGGAGTGTTGAGCTGACCCCTGG + Intergenic
919500038 1:198326961-198326983 AGGTGTGAGCCACTGTACCCAGG - Intergenic
919726057 1:200884861-200884883 AGGTGTGAGCCACTGTTCCCGGG + Intergenic
919729856 1:200906683-200906705 AGGTCTGGCCAGCTGGCCCCAGG - Intronic
920246868 1:204594399-204594421 AGGTGTGAGCCGCTGTGCCCAGG + Intergenic
921015499 1:211186622-211186644 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
921715318 1:218411719-218411741 AGGTGTGTGCCACTGTGCCTGGG - Intronic
922303294 1:224322360-224322382 AGGTGTGAGCCACTGTGCCCTGG + Intronic
923044097 1:230342511-230342533 GGGTGTGTGCGGCTGTCACCTGG + Intronic
923127917 1:231048229-231048251 AGGTGTGAGCCACTGTGCCCGGG - Intergenic
923191838 1:231627160-231627182 AGGACTGTGCAGCGATCCCCGGG + Intronic
924756561 1:246946568-246946590 AGGTTTGTGGTGCTGTCACCGGG - Intronic
1063106745 10:2998746-2998768 AGGTGTGAGCCACTGCCCCCTGG - Intergenic
1063262572 10:4406893-4406915 AGGTGTGAGCCACTGTACCCAGG - Intergenic
1063270903 10:4509275-4509297 AGGTTTGTGCAGCTGTGGCCAGG + Intergenic
1063355688 10:5396227-5396249 AGGTGTGAGCCACTGTGCCCTGG - Intronic
1064031902 10:11887846-11887868 AGGTGTGAGCAGCTGCGCCCTGG - Intergenic
1064079656 10:12298275-12298297 AGGTGTGAGCCACTGTGCCCTGG + Intergenic
1065086839 10:22187222-22187244 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1065416658 10:25495568-25495590 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1065773776 10:29101188-29101210 AGGAGGGGGCAGGTGTCCCCTGG + Intergenic
1065797087 10:29317798-29317820 AGGTGTGTGCCACCATCCCCAGG - Intronic
1065839760 10:29692769-29692791 AGGCGTGAGCTGCTGTGCCCAGG + Intronic
1067000379 10:42605952-42605974 AGGTGTGTGCCACTATGCCCGGG - Intronic
1067409010 10:46048457-46048479 AGGTGTGGCCAGCTGCCCACAGG + Intergenic
1067829034 10:49599357-49599379 AGGAGTGTGCTTCTCTCCCCTGG - Intergenic
1070062405 10:72996931-72996953 AGGTGTGAGCCACTGTACCCGGG - Intergenic
1070606284 10:77900656-77900678 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1070769797 10:79075546-79075568 ATGTGTGTGCAGCTGTGTGCAGG - Intronic
1070794953 10:79211032-79211054 AGGTCTCTGCAGCTGTGGCCAGG - Intronic
1070892511 10:79952256-79952278 ATGGGAGTGCAGCTGCCCCCAGG + Intronic
1071157482 10:82707670-82707692 AGGTGTGAGCCACTGTTCCCAGG + Intronic
1071337944 10:84617014-84617036 AGGTGCCTGCAGCTCTCCCAGGG - Intergenic
1071612780 10:87046722-87046744 AGGTGTGAGCCACTGTGCCCTGG - Intergenic
1071903037 10:90141129-90141151 AGCTATGTGCAGCTATGCCCTGG - Intergenic
1072628282 10:97128343-97128365 AGGAGTGTTCATCTGTCTCCTGG + Intronic
1073478483 10:103770477-103770499 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1074352498 10:112751527-112751549 AGATGTGGGCAGCTGTCTCTTGG - Intronic
1075095306 10:119467298-119467320 AGGTCGGTCCAGCTGCCCCCTGG - Intergenic
1075339412 10:121633408-121633430 AGGCTGGTGGAGCTGTCCCCAGG - Intergenic
1076451266 10:130558451-130558473 CGGGGTGTGCAGCTGTGCTCTGG - Intergenic
1076467396 10:130693377-130693399 AGGTGTGAGCCACTGTGCCCGGG + Intergenic
1076695926 10:132247392-132247414 GGGTGTGTGACTCTGTCCCCAGG - Intronic
1076723479 10:132402903-132402925 AGGTGTGGCCCGCTGGCCCCCGG + Intronic
1076781227 10:132725684-132725706 AGGTGTGCACAGCTGTCCACAGG - Intronic
1077015870 11:398912-398934 ACCTGTGTGCAGCTGTGTCCAGG - Intronic
1077314148 11:1909218-1909240 AGGTGTGAGCCGCCGTACCCAGG - Intergenic
1077366176 11:2162244-2162266 AGGTGTGGGAAGCTGTGCACTGG + Intergenic
1077951918 11:6968585-6968607 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1078760989 11:14251706-14251728 ACCTGGGTGCAGCTGTCCTCTGG - Intronic
1079365483 11:19805500-19805522 TGGTATTTGCAGCTGTCCTCTGG + Intronic
1080047172 11:27821293-27821315 AGCTGGCTGCAGCTGCCCCCGGG - Intergenic
1080112677 11:28586306-28586328 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1080259142 11:30326810-30326832 AGGTGTGTGCAGTTTTACTCAGG + Intronic
1080376498 11:31718978-31719000 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1081585435 11:44380726-44380748 AGGTGGGAGCTGCTGGCCCCTGG - Intergenic
1081884694 11:46484921-46484943 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1081996721 11:47370122-47370144 AGGCGTGAGCCACTGTCCCCGGG - Intronic
1082276098 11:50223132-50223154 AAGTGTTTATAGCTGTCCCCAGG - Intergenic
1083919185 11:65772102-65772124 AGGTGTGAGCCACTGTGCCCGGG - Intergenic
1083947599 11:65933058-65933080 AGGTGTGTGCCACTGTGCCCAGG - Intergenic
1085098491 11:73780221-73780243 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1085763423 11:79261578-79261600 AGGTGGGAAGAGCTGTCCCCAGG - Intronic
1087191596 11:95259726-95259748 AAGTGTGTGCATCATTCCCCAGG - Intergenic
1088650999 11:111958196-111958218 GGGTGGCTGCAGCTGTGCCCGGG - Intronic
1088868011 11:113867582-113867604 AGGTGTGTGCCACTGCACCCAGG - Intronic
1089507326 11:118972244-118972266 AGGTGAGACCAGCTGTCCTCCGG - Intronic
1089626847 11:119756333-119756355 AGATGTGTGCAGCCTTGCCCTGG + Intergenic
1089633531 11:119797840-119797862 AGGGGAGTGGAGCTGTCCACCGG - Intergenic
1090057043 11:123432276-123432298 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1090270056 11:125379716-125379738 AGGTGTGTGCAGCTGTCCCCGGG - Intronic
1091088394 11:132745995-132746017 GGGCCTGTCCAGCTGTCCCCAGG - Intronic
1091360786 11:134977319-134977341 AGGTGGGTGCTCCTGACCCCAGG + Intergenic
1091412405 12:252828-252850 AGGTGGGAGCAGCTGACCACGGG - Intronic
1091548518 12:1520156-1520178 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1091758351 12:3070990-3071012 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1092502885 12:9065285-9065307 AGGTGGCTGCAGCTGCACCCTGG - Intergenic
1093014282 12:14140687-14140709 AGGTGTGTGCCACTATGCCCTGG - Intergenic
1094385179 12:29886108-29886130 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1096126741 12:49125074-49125096 AGGCGTGAGCTGCTGTGCCCGGG + Intergenic
1096567933 12:52496693-52496715 GGCTGGGTTCAGCTGTCCCCTGG - Intergenic
1096595578 12:52692946-52692968 AGGTCTGGGCTGCTCTCCCCTGG + Intronic
1097270377 12:57770508-57770530 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1098171478 12:67751378-67751400 ACTTGTGTGCAGCTGCCCCCAGG + Intergenic
1099234754 12:80070608-80070630 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1100403489 12:94252285-94252307 AGGTGTGTGCCACTGTGCCCAGG - Intronic
1100501947 12:95182914-95182936 GGGTGTGTACAGCTGACACCAGG - Intronic
1101382895 12:104229867-104229889 AGGTGTGAGCCACTGTGCCCGGG + Intronic
1102016198 12:109649504-109649526 AGGTGTGAGCCACTGTTCCCGGG - Intergenic
1102053877 12:109881751-109881773 AGGTGTGAGAAGCTGGACCCTGG - Intergenic
1103521838 12:121541252-121541274 AGGTGTATGCCACTATCCCCTGG - Intronic
1103551850 12:121743746-121743768 AGGTAGGTGCAGCTGTAGCCCGG + Exonic
1103632874 12:122276929-122276951 AGGTGTGAGCTGCTGTGCCCGGG + Intronic
1103699900 12:122843665-122843687 AGTTGTGAGCAGGTGGCCCCTGG + Intronic
1103700677 12:122847395-122847417 TGGGGTCTGCAGCTGTCACCCGG - Intronic
1103883766 12:124186080-124186102 TGGGGTGTGCAGGGGTCCCCGGG + Intronic
1104330275 12:127838195-127838217 AGGTGTCTGCAGCTGTCCTAAGG - Intergenic
1104910357 12:132237303-132237325 AGGTGTGAGCAGCTGTGAACTGG - Intronic
1104910380 12:132237484-132237506 AGGTGTGGGCAGCTGTGTGCAGG - Intronic
1104923299 12:132302585-132302607 AGGTGTGTGCTGCGTTCACCAGG - Intronic
1104948924 12:132429932-132429954 AGGTGTCTGCAGGTGTGCTCAGG - Intergenic
1104948928 12:132429952-132429974 AGGTGTGTGCCGATGTGCCTAGG - Intergenic
1104948931 12:132429972-132429994 AGGTGTGTGCAGGTGTGCCCAGG - Intergenic
1104948935 12:132429992-132430014 AGGTGTGCGCAGAGGTTCCCAGG - Intergenic
1104948945 12:132430082-132430104 AGGTGTGTGCAGGTGTGCATAGG - Intergenic
1107446427 13:40473846-40473868 AGGTGTGGGCCACTGTGCCCGGG - Intergenic
1108249493 13:48550761-48550783 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
1108504847 13:51103281-51103303 AAGTGTGGGGAGCTGTCCTCAGG + Intergenic
1109426027 13:62167487-62167509 AGGTGTGCGCCACTGTGCCCCGG + Intergenic
1109780619 13:67106668-67106690 GGGTGGCTGCAGCTGTGCCCAGG - Intronic
1109852626 13:68086987-68087009 AGGTGTGAGCCACTGTTCCCAGG - Intergenic
1111040222 13:82738560-82738582 AGGTGTGAGCCACTGTGCCCGGG + Intergenic
1111091382 13:83452420-83452442 GGGCGGGTGCAGCTGTTCCCAGG - Intergenic
1111139209 13:84092007-84092029 AGGTGTTTGGATCTATCCCCAGG - Intergenic
1111472465 13:88701349-88701371 AGGTGTTTGCAGCTTTCTCAAGG + Intergenic
1112025881 13:95410587-95410609 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1113331654 13:109333320-109333342 GGGTGTGTGCAGGTGTGTCCTGG - Intergenic
1113513819 13:110875406-110875428 TGTTGTGTACAGCTGTCTCCAGG + Intergenic
1113906767 13:113822925-113822947 AGCTGAGTGCAGCTGCCCCTTGG - Intronic
1113940082 13:114014467-114014489 GGGTGTCTGCAGCTGTCCCGAGG + Intronic
1113959602 13:114119407-114119429 AGGCGTGAGCAGTTGTCTCCGGG - Intronic
1113970574 13:114185501-114185523 AGGTGGCTGCAGCTGTACCCAGG - Intergenic
1114280956 14:21192244-21192266 TGGTGGCTGCAGCTGTGCCCTGG - Intergenic
1114477189 14:23004434-23004456 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1114517215 14:23307847-23307869 ATGTCTGTGGAGCTGGCCCCGGG + Exonic
1114871085 14:26659305-26659327 AGGTGTGAGCTACTGTGCCCAGG + Intergenic
1116790086 14:49330379-49330401 GGGTGGCTGCAGCTGCCCCCAGG + Intergenic
1116824576 14:49659865-49659887 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1116898726 14:50341498-50341520 AAGTGTGAGCCGCTGTGCCCAGG - Intronic
1118345994 14:64941344-64941366 AGGTGTGAGCCACTGTACCCTGG + Intronic
1118456287 14:65948044-65948066 AGGTGTGCTGAGCTCTCCCCAGG - Intergenic
1121131645 14:91452789-91452811 AGGTGTGAGCCACTGTGCCCGGG + Intergenic
1121263752 14:92585154-92585176 AGGTGTGTGCCACTGTGCCTGGG + Intronic
1122615837 14:103017177-103017199 AGGTGTGTGCCGCTACACCCTGG - Intronic
1122770721 14:104096481-104096503 AGGTGTGTGCAGTGGGCCCTGGG - Intronic
1123625411 15:22223636-22223658 GTGTGTGTGTAGCTGTCTCCTGG - Intergenic
1123625459 15:22223973-22223995 GTGTGTGTGTAGCTGTCTCCTGG - Intergenic
1123699623 15:22904428-22904450 AGGTGGGAGCAGCTGTGCTCCGG - Intronic
1124133493 15:27011143-27011165 AGGTGTGAGCCACTGTTCCCGGG + Intronic
1124937455 15:34186465-34186487 AGGTGGCTGCAGCTGCACCCTGG - Intronic
1125795613 15:42402159-42402181 AGTTGTGTGCAGCACTACCCAGG + Intronic
1125957799 15:43802593-43802615 AGGTGTGAGCCACTGTGCCCGGG - Intronic
1126051671 15:44691708-44691730 AGGTGTGTGCCACCGTGCCCAGG - Intronic
1126458540 15:48890775-48890797 GCCTGTGTGAAGCTGTCCCCGGG - Exonic
1126859592 15:52871017-52871039 AGGGGTGTGCAGGTGTCCCAGGG + Intergenic
1129904384 15:79175917-79175939 AGGTGTGGTCAAATGTCCCCTGG - Intergenic
1129949191 15:79571220-79571242 AGGTGTGATCACCTGTGCCCAGG - Intergenic
1131025696 15:89139619-89139641 AGGAGTGTGCTGCTGGCACCTGG - Intronic
1132314017 15:100878150-100878172 CAGTGTGTGCAGCAGGCCCCAGG - Intronic
1132455941 16:22991-23013 AGGTGTCCCCAGGTGTCCCCAGG - Intergenic
1132641053 16:978763-978785 GTGTGTGTGCAGCTCCCCCCTGG + Intronic
1132742755 16:1423610-1423632 AGGTGTGAGCCACTGTGCCCCGG + Intergenic
1132744681 16:1431729-1431751 GGGTGGGTGCAGCTCTCCTCTGG - Intergenic
1132792041 16:1696255-1696277 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1132905148 16:2278653-2278675 AGGTGCGTGCACCGGGCCCCTGG - Intronic
1132939451 16:2499650-2499672 AGGTGTGTGCACCCTGCCCCTGG - Intronic
1133101119 16:3480637-3480659 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1133284109 16:4682721-4682743 AGGCGTGTGCAGGGGCCCCCAGG + Intronic
1133537899 16:6719812-6719834 AGGTGTGAGCAGCCATGCCCGGG - Intronic
1134078533 16:11308994-11309016 GGGTGGCTGCAGCTGTACCCAGG + Intronic
1134083144 16:11338319-11338341 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1134165484 16:11926148-11926170 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1134287571 16:12875520-12875542 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1134489824 16:14688299-14688321 AGGTGGGTGAAGCTCTCTCCTGG + Intronic
1134495204 16:14727416-14727438 AGGTGGGTGAAGCTCTCTCCTGG + Intronic
1134500590 16:14766536-14766558 AGGTGGGTGAAGCTCTCTCCTGG + Intronic
1134545273 16:15103199-15103221 AGGTGGGTGAAGCTCTCTCCTGG - Intronic
1134579993 16:15362514-15362536 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1134714715 16:16351682-16351704 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1134722592 16:16395046-16395068 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1134944836 16:18316823-18316845 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1134952100 16:18356976-18356998 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1135057256 16:19241407-19241429 AGGTGGCTGCAGCTGCACCCAGG + Intronic
1135140327 16:19915898-19915920 AGGTGTGAACCGCTGTGCCCCGG + Intergenic
1135310444 16:21401038-21401060 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1135363389 16:21833466-21833488 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1135448403 16:22537612-22537634 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1135621011 16:23955541-23955563 AAGTGTGGGAGGCTGTCCCCTGG + Intronic
1135773527 16:25235832-25235854 AGCTGTGTGCAGCCGTCCTCTGG - Intergenic
1136150024 16:28341387-28341409 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1136166259 16:28455202-28455224 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1136196713 16:28659830-28659852 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1136213053 16:28773955-28773977 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1136257780 16:29053868-29053890 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1136307188 16:29380192-29380214 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1136320713 16:29482435-29482457 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1136344904 16:29668724-29668746 AGGTGTGAGCCACTGTGCCCAGG + Exonic
1136435286 16:30221775-30221797 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1137020552 16:35421712-35421734 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1137421870 16:48341804-48341826 GAGTGGGTGCAGGTGTCCCCAGG + Intronic
1137886665 16:52111687-52111709 AGGTGTGTGCAACCATGCCCAGG - Intergenic
1139280688 16:65767811-65767833 AGGTGTGTGCAACTGTGAGCTGG - Intergenic
1139855316 16:69975188-69975210 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1139885033 16:70202303-70202325 AGGTGGGTGAAGCTCTCTCCTGG - Intergenic
1139899153 16:70313294-70313316 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1140055315 16:71520780-71520802 AGATGTGCACAGCTGTCTCCTGG + Intronic
1140069342 16:71635461-71635483 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1140189902 16:72806592-72806614 AGGTGGGTGCAACCGCCCCCAGG + Intronic
1140367482 16:74393210-74393232 AGGTGGGTGAAGCTCTCTCCTGG + Intergenic
1141186631 16:81792201-81792223 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1141405749 16:83791350-83791372 AGGTGTGTGCCACCGTGCCCAGG - Intronic
1141791577 16:86239701-86239723 CGGTGAGGACAGCTGTCCCCAGG - Intergenic
1141969166 16:87468694-87468716 AGCTGTGGCCAGATGTCCCCTGG - Intronic
1142013245 16:87727905-87727927 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1142145925 16:88492955-88492977 GGGTGTGGGGAGCTGTCCCAGGG + Intronic
1142145937 16:88492995-88493017 GGGTGTGGGGAGCTGTCCCGGGG + Intronic
1142241667 16:88950255-88950277 AGGTCTGTTCACCCGTCCCCTGG + Exonic
1144498222 17:15763932-15763954 AGGTGTGAGCCACTGTACCCAGG + Intergenic
1144604887 17:16656460-16656482 AGGTGTGAGCCACTGTACCCAGG - Intergenic
1144889250 17:18484593-18484615 AGAGGTGTGCAGCTCTCTCCTGG + Intronic
1145142958 17:20459703-20459725 AGAGGTGTGCAGCTCTCTCCTGG - Intronic
1145161602 17:20578974-20578996 AGGTGTGAGCCACTGTACCCAGG + Intergenic
1145395350 17:22489929-22489951 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1145792913 17:27638982-27639004 AGAGGTGTGCAGCTCTCTCCTGG + Intronic
1145807774 17:27746851-27746873 AGAGGTGTGCAGCTCTCTCCTGG + Intergenic
1145960583 17:28884487-28884509 GGGTGGGTGCAGGTGGCCCCAGG + Intronic
1146245798 17:31281775-31281797 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1146410462 17:32579209-32579231 AGGTGTGTGCCACTATACCCAGG + Intronic
1146646429 17:34580014-34580036 AGGTTTGTGCAGGTTCCCCCAGG + Intergenic
1147673463 17:42189975-42189997 AGGCGTGTGTGGCTGTGCCCAGG + Intronic
1148432821 17:47656288-47656310 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1149983250 17:61328486-61328508 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1149991912 17:61388129-61388151 AGGTCTGAGCAGCTGTCCTGCGG - Intronic
1150239355 17:63619689-63619711 AGGTGTGAGCCACTGTGCCCCGG + Intergenic
1150640451 17:66946204-66946226 AGGCATGTGCAGCTGCCCGCTGG - Intergenic
1150836159 17:68565844-68565866 AAGTGCTTGCAGCTGTGCCCTGG - Intronic
1151212316 17:72553851-72553873 ATGTGTGTGCATGTGTGCCCAGG - Intergenic
1151442875 17:74144702-74144724 AGGTGTGAGCCACTGTGCCCCGG + Intergenic
1151489402 17:74423784-74423806 AGGTGTGAGCCACTGTGCCCGGG - Intergenic
1151763859 17:76122180-76122202 AGGCGAGTGGCGCTGTCCCCAGG + Intergenic
1151799334 17:76368485-76368507 AGGCCTGAGCAGCTGTCCCTTGG + Intronic
1152371829 17:79893042-79893064 AAGTGTCTACAGCTGTCGCCTGG + Intergenic
1152800984 17:82330551-82330573 AGGTGCGTGCAGCTGGCCCTTGG - Intronic
1152862782 17:82705493-82705515 AGGTGGGTGCGGCTGTCCCTCGG + Intergenic
1153482186 18:5557661-5557683 AGGTGTGAGCTACTGTGCCCAGG + Intronic
1154014496 18:10604401-10604423 CCGTGGGTGCAGCTCTCCCCAGG - Intergenic
1155169975 18:23260068-23260090 AGGTTGCTGCAGCTGCCCCCAGG + Exonic
1155993762 18:32307799-32307821 AGGTGTGAGCCACTGTGCCCTGG + Intronic
1157253410 18:46116281-46116303 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1159551629 18:69901600-69901622 AGGTGTGAGCCACTGTGCCCGGG - Intronic
1159956244 18:74520208-74520230 AAGTGTATCCAGCTGTCCACGGG + Exonic
1160351829 18:78189210-78189232 AGGTGTGTGCAGGTATCACCTGG + Intergenic
1160827426 19:1087132-1087154 AGGTGTGAGCCACTGTGCCCAGG + Exonic
1160847264 19:1172096-1172118 AGGTGTGGGCAGATGTCTGCCGG + Intronic
1161281041 19:3445904-3445926 AGATGTGACCTGCTGTCCCCGGG - Intronic
1162391936 19:10395207-10395229 AGGTGAGTGGAGCTTTCCCCGGG - Exonic
1162410829 19:10503970-10503992 AGGTGTGAGGCGCTGTGCCCAGG + Intergenic
1162485148 19:10955651-10955673 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1164126434 19:22322540-22322562 AGGTGTGAGCCACTGTTCCCAGG + Intergenic
1164673155 19:30084590-30084612 GGGTGTGTGCAGTTTTCTCCTGG - Intergenic
1165159342 19:33806698-33806720 AGGTGTGTGCAGATGTTGTCAGG + Intronic
1165906028 19:39195480-39195502 ATGTGTGTGCAGCTGTGTGCTGG - Intergenic
1166380492 19:42352949-42352971 TGGTGTGTGCAGTGGCCCCCCGG + Exonic
1166381161 19:42356088-42356110 GGGTGTGTGCATCTGTGCCGAGG + Exonic
1167925131 19:52815235-52815257 AGGTGTGAGCCACTGTGCCCGGG - Intronic
1168113240 19:54206781-54206803 TGGTGGGTTCAGCTGTCTCCTGG + Intronic
1168472794 19:56652889-56652911 AGGCTGGTGCAGCTCTCCCCTGG - Intronic
925236613 2:2284449-2284471 AGGTGTGTGCGGCTGTTGCCTGG - Exonic
926046771 2:9715801-9715823 ATGTGTGTGCAGGTGTCCATAGG + Intergenic
926547118 2:14255561-14255583 GGGTGAGTGCAGCTGTGCCCAGG + Intergenic
926699887 2:15796602-15796624 AGCTGTGTAAATCTGTCCCCGGG - Intergenic
927651141 2:24914392-24914414 AGGTGTGAGCCGCTGTCCAGAGG - Intronic
928590453 2:32809404-32809426 AGATGTGGGCAGCTGTCTCTTGG + Intronic
929475136 2:42238915-42238937 AGGTGTGTGCTGCCACCCCCTGG + Intronic
930225172 2:48784925-48784947 AGGTGTGTAAAGCTGTGCCTTGG + Intergenic
931256348 2:60577177-60577199 AGGTGTGTGCCACCGTACCCAGG - Intergenic
931306176 2:61031009-61031031 AGGTGTGAGCCACTGTGCCCAGG - Intronic
931620884 2:64208193-64208215 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
933449371 2:82427449-82427471 AGGTGTGAGCCGCTGTGCCCGGG - Intergenic
933606626 2:84390244-84390266 GGGTGGCTGCAGCTGTGCCCAGG + Intergenic
934044599 2:88162264-88162286 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
935191427 2:100781745-100781767 AGGTGAGGGCAGCTGACCCTGGG - Intergenic
935518858 2:104078777-104078799 CGGTGGCTGCAGCTGTGCCCAGG + Intergenic
935650601 2:105378633-105378655 AGCTGAGTGCAGATGGCCCCAGG - Intronic
936022039 2:109002262-109002284 AGGGGTGGACAGCTGGCCCCAGG - Intergenic
936290210 2:111217178-111217200 AGGTGGCTGCAGCTGCACCCAGG + Intergenic
938118518 2:128618212-128618234 AGGTGTGTGCAGTTATCACATGG - Intergenic
938541400 2:132286674-132286696 GGGTGTGGGAAGCTGACCCCAGG + Intergenic
939244400 2:139604642-139604664 AGGTGTGTGGAGTTGTTCCTAGG + Intergenic
939999477 2:148952385-148952407 AGGTATTTGCAGCTGTCTACAGG + Intronic
941404707 2:165074403-165074425 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
941902688 2:170693355-170693377 AGTTGTGTGCATCTGTCCTTTGG - Intergenic
942060283 2:172223098-172223120 AGGTGTGAGCCACTGTGCCCTGG - Intergenic
943247321 2:185472928-185472950 AAGTGTGTGCTCCTGTTCCCTGG + Intergenic
943297419 2:186155913-186155935 AGGTGTGAGCATCTATACCCAGG - Intergenic
943840493 2:192574271-192574293 AGGTGTGAGCCACTGTCCCCAGG - Intergenic
943858308 2:192827962-192827984 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
944083346 2:195815018-195815040 AGGTGTGAGCCACTGTGCCCAGG + Intronic
944498006 2:200328183-200328205 AAGTGTGTACAGTTGTCCTCAGG + Intronic
944749014 2:202689160-202689182 AGGTGTGGGCCACTGTGCCCAGG - Intronic
944780460 2:203012357-203012379 AGGTGTGAGCCACTGTGCCCGGG - Intronic
944981498 2:205125941-205125963 AGGTGTTTGAATCTGTGCCCCGG - Intronic
945132458 2:206588069-206588091 ACATGTGTGCTCCTGTCCCCAGG + Exonic
946329269 2:219000571-219000593 GGGTGTGTGCAGCCCTCTCCTGG - Intergenic
947442577 2:230136179-230136201 AGGTGTGAGCCACTGTGCCCGGG + Intergenic
948036500 2:234862475-234862497 AGGTGTGAGCCACTGTGCCCTGG - Intergenic
948139222 2:235660524-235660546 AGGTGTGCACAGGTGTGCCCAGG + Intronic
948587026 2:239026065-239026087 GGGTGGCTGCAGCTGTGCCCCGG + Intergenic
948994778 2:241572781-241572803 AGGTGAGAGCAGGTGTTCCCGGG - Exonic
948994791 2:241572822-241572844 AGGTGAGAGCAGGTGTTCCCGGG - Exonic
948994828 2:241572943-241572965 AGGTGAGAGCAGGTGTTCCCGGG - Exonic
948994841 2:241572984-241573006 AGGTGAGAGCAGGTGTTCCCGGG - Exonic
948994877 2:241573105-241573127 AGGTGAGAGCAGGTGTTCCCGGG - Exonic
1170048322 20:12111637-12111659 AGGTTTGTGCAACTGACCTCTGG - Intergenic
1170781640 20:19430847-19430869 ATGTGTGTGCATGTGTCCCTAGG - Intronic
1170949852 20:20926635-20926657 AGCTGTGTTCAGCTGGCCGCAGG - Intergenic
1171482549 20:25465033-25465055 AGATGTCAGCAGCTGTCTCCTGG + Intronic
1171756940 20:29119294-29119316 AGGTCTCTGCAGCTGTGCCAAGG - Intergenic
1171862994 20:30418559-30418581 AGGTCTCTGCAGCTGTGCCAAGG - Intergenic
1171999374 20:31760636-31760658 AGGTGTGAGCTACTGTTCCCGGG + Intronic
1172088896 20:32412835-32412857 AGGCGTGAGCCACTGTCCCCAGG + Intronic
1172426776 20:34860881-34860903 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1173615683 20:44401490-44401512 AGGTGGGGGCAGATGTGCCCAGG + Intronic
1175102154 20:56586980-56587002 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1175709134 20:61205307-61205329 AGGTGTGTCCTGCCCTCCCCTGG + Intergenic
1175736067 20:61388205-61388227 AGGGCTGTGCAGCTGTCGGCCGG + Intronic
1175838936 20:62014526-62014548 AGGTGAGTGCACGTGTGCCCTGG - Exonic
1175916094 20:62426730-62426752 ATGCGTGTGCAGCTGTCCCGGGG - Intronic
1176117286 20:63438604-63438626 AGGTGAGTCCAGGTGTCCCCCGG - Exonic
1176152365 20:63598557-63598579 AGGTCTCTGCAGCTGGACCCAGG + Intronic
1176206788 20:63893260-63893282 AGGTGTGAGCCACTGTGCCCGGG + Intergenic
1176233793 20:64044978-64045000 AGGGGTGTGCAGCTGGTGCCAGG + Intronic
1176998695 21:15585461-15585483 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1178537936 21:33425598-33425620 ACGTGTGTGCTGGTGTCCCTGGG + Intronic
1179639774 21:42739432-42739454 ATGTGTGTGCCTGTGTCCCCGGG - Intronic
1179815638 21:43904459-43904481 GGGATTGTGCAGCTGTCCCCGGG - Intronic
1180146058 21:45919687-45919709 TGGTGTCTACAGCTGACCCCAGG - Intronic
1180172820 21:46068782-46068804 AGGTGTGTGCATGTGTGCCTGGG + Intergenic
1180959830 22:19757495-19757517 AGGTGTGTGCAGATGTACACAGG + Intronic
1181718776 22:24757331-24757353 AGGTGTGAGCCACTGTGCCCTGG - Intronic
1182352122 22:29704975-29704997 TGGTGGTTGCAGATGTCCCCAGG + Intergenic
1182472659 22:30558120-30558142 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1182620184 22:31614578-31614600 ATGTGGGTGAAGCAGTCCCCTGG + Intronic
1183104261 22:35605044-35605066 AGGTGGGTGCAGCAGTCCTGAGG + Intergenic
1183146350 22:35995989-35996011 AGCTGTTTCCAGCTGTCCTCTGG - Intronic
1183690663 22:39386400-39386422 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1183887791 22:40899541-40899563 AGGTGTGAGCCACTGTGCCCGGG - Intronic
1183975436 22:41509171-41509193 TGTTGTGGGCAGCTGTCCCCAGG - Intronic
1184053269 22:42025069-42025091 AGGTGTGAACAACTGTGCCCAGG + Intronic
1184555459 22:45230292-45230314 AGGTGGGAGCAGATGTCCCAGGG + Intronic
1185236593 22:49717061-49717083 AGTTGTGTGCATGTGTGCCCTGG - Intergenic
1185299653 22:50072724-50072746 AGGTGTGTACAACTGACCCTGGG - Intronic
1185343402 22:50301270-50301292 AGGGGGCTGCAGCTGTGCCCAGG - Intronic
950207532 3:11092241-11092263 GGGAGTGTGCAGCTGCGCCCAGG - Intergenic
950541166 3:13614163-13614185 AGGTGAGTGCTGCTCTTCCCTGG + Exonic
950635616 3:14312302-14312324 CTGTGTGTGCAGCTGCCTCCTGG - Intergenic
951999661 3:28771417-28771439 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
952657384 3:35802129-35802151 GGGTGGCTGCAGCTGTGCCCAGG + Intergenic
952771894 3:37009194-37009216 AAGTGTGTGCAGCTGCCCCTTGG + Intronic
954362941 3:50131973-50131995 AGGTGTGTGTAGCTGCCTTCAGG + Intergenic
955525673 3:59817378-59817400 GGGTGTGTGGAACTGTCCCTTGG + Intronic
956570527 3:70689435-70689457 AGGTGTGAGCCCCTGCCCCCAGG + Intergenic
957625781 3:82650648-82650670 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
957638375 3:82815860-82815882 AGGTGACTGCAGCTGTTCCTGGG + Intergenic
958562140 3:95760055-95760077 AGGTGGCTTCAGCTGTGCCCAGG + Intergenic
959077156 3:101761143-101761165 AGGTGTGAGCCACTGTGCCCAGG + Intronic
961311278 3:126003714-126003736 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
961515104 3:127427413-127427435 AGGTGAGTGCAGAGGCCCCCAGG - Intergenic
963767976 3:149357554-149357576 AAGTGGTTGCTGCTGTCCCCTGG - Intergenic
964524173 3:157599538-157599560 AGGTGTGTGCTTGTGTCCCCTGG - Intronic
964927940 3:161979439-161979461 AGGTGGTTGCAGCTGTGTCCAGG + Intergenic
965700465 3:171455517-171455539 AGGTGTGAGCCACTGTGCCCAGG + Intronic
965774099 3:172210099-172210121 GGGTGGCTGCAGCTGTGCCCAGG + Intronic
965924400 3:173959108-173959130 GGGTGGCTGCAGCTGTGCCCAGG + Intronic
966196248 3:177316863-177316885 AGGTGTGAGCCACTGTACCCGGG - Intergenic
966423518 3:179757177-179757199 GTGTGTGTGCAGCTTTTCCCAGG + Intronic
966721932 3:183072144-183072166 AGGTGTGAGCCACTGTGCCCAGG + Intronic
966789347 3:183651674-183651696 AGGTGTGAGCCCCTGTGCCCAGG - Intronic
966836475 3:184053187-184053209 AGGTGAGTCCAGGTGTCCCTCGG - Intronic
967987338 3:195105380-195105402 TGGAGAGTACAGCTGTCCCCAGG + Intronic
968022629 3:195407426-195407448 AGGTGTGAGCCACTGTGCCCAGG - Intronic
968427776 4:534768-534790 AGCTTTGTGCAGATGTCCCCGGG + Intronic
968741460 4:2333551-2333573 TGGAGTGTGCAGGTGACCCCAGG - Intronic
969348145 4:6581946-6581968 GGGTGTGGGCAGCGGCCCCCGGG + Intronic
970326149 4:14927193-14927215 ATGTGTGTGCAGTTGTTACCTGG + Intergenic
970459892 4:16263038-16263060 AGGTGTGAGCTGCTGCGCCCAGG + Intergenic
971248697 4:24953284-24953306 AGCTGTGTGCAGCTTCCTCCAGG + Intronic
971273516 4:25173445-25173467 CAGTTTGTGCAGCTGTCACCAGG - Intronic
971906876 4:32737334-32737356 AGGTGTGTGCCACTATGCCCAGG + Intergenic
973708355 4:53601691-53601713 TGGTGTGTGCAGCTGCCTCTAGG - Intronic
974528667 4:63079278-63079300 AGCTGTGTGCAGATGTCTCTGGG - Intergenic
974718470 4:65703136-65703158 GTGTGTGTGCAGTTGTCCCATGG - Intergenic
975195294 4:71517876-71517898 AGGTGAGTGCACCTGGCACCTGG + Intronic
975254440 4:72216671-72216693 GGGTGGCTGCAGCTGTGCCCAGG + Intergenic
975379192 4:73678927-73678949 AGGTGTGAGCCACTGCCCCCGGG - Intergenic
975719026 4:77232533-77232555 ATGTGTCTGCAGCTGACCGCTGG + Intronic
976097915 4:81528517-81528539 GGGTGGCTGCAGCTGTACCCAGG + Intronic
976288534 4:83393578-83393600 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
978347749 4:107789037-107789059 AGGTGGCTGCAGCTGTGCCCAGG + Intergenic
978489591 4:109298428-109298450 AGGGGTGGGCATCTGTCCACAGG + Intronic
979286980 4:118937309-118937331 AGGTATGTGCAGAGGTCCCAAGG - Intronic
981112718 4:140954356-140954378 AGGTGTGTGCCACTGCACCCAGG + Intronic
981659143 4:147145881-147145903 TGGTGGGTTCAGCTGTCCTCAGG + Intergenic
982233749 4:153232946-153232968 AGCCGGGTGGAGCTGTCCCCTGG + Intronic
982332652 4:154198628-154198650 AGGTGTGAGCCACTGCCCCCAGG + Intergenic
982610943 4:157574389-157574411 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
982722032 4:158869202-158869224 AGGTGTGTCCAGCGGGGCCCTGG + Exonic
983088059 4:163471989-163472011 CTGTTTGTGCAGCTGTCTCCAGG - Exonic
983994831 4:174169198-174169220 AGGTGTGAGCTACTGTGCCCCGG + Intergenic
984375234 4:178921831-178921853 AGGGGGCTGCAGCTGTACCCAGG - Intergenic
984695138 4:182771390-182771412 ACTTTTGTGCAGCTGACCCCAGG - Intronic
984809504 4:183782363-183782385 AGGTGTGAGCCACTGTGCCCGGG - Intergenic
984968546 4:185165167-185165189 AGGTGTGAGCCACTGTGCCCAGG - Intronic
985623183 5:966788-966810 AGGTGTGTGCCACTGCGCCCAGG + Intergenic
985763718 5:1765414-1765436 AGGGGTGTGCAGCTCCCACCTGG - Intergenic
985764150 5:1768093-1768115 AGCTGTGGGCAGCTGCACCCGGG - Intergenic
985916045 5:2919879-2919901 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
986311963 5:6557546-6557568 GTGTGAGTGCATCTGTCCCCGGG - Intergenic
986355713 5:6923741-6923763 AGCTGTGTGCATCAGTCCCCAGG - Intergenic
986827186 5:11534335-11534357 AGGTGTGAGCCACTGTCACCTGG - Intronic
987057697 5:14210353-14210375 AGGGGTGTCCAGCTTTCCCCAGG + Intronic
987401142 5:17478224-17478246 TGGTGGCTGCAGCTGTCCCTTGG + Intergenic
987505764 5:18769407-18769429 AGGTGTGTGCAGCGATCACATGG + Intergenic
988189903 5:27916787-27916809 AGTTGTGTGCAGGTTTCTCCAGG - Intergenic
988949856 5:36245295-36245317 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
989040144 5:37219095-37219117 AGGTGTGAGCCACTGTACCCAGG - Intronic
989821580 5:45800104-45800126 GGGTGGCTGCAGCTGTACCCAGG - Intergenic
990355052 5:54958822-54958844 AGGTGTGTGCAGGTCTACCAGGG - Intergenic
990878655 5:60516944-60516966 GGGTGGCTGCAGCTGTGCCCAGG - Intronic
991364539 5:65854536-65854558 AGATGTGAGCTGCTGTACCCAGG - Intronic
992450844 5:76874471-76874493 AGGTGTGAGCTGCTGCCCCAAGG - Intronic
992544034 5:77793385-77793407 AGGTGTGAGCCACTGTACCCAGG + Intronic
992730616 5:79664192-79664214 ATGTGTGTACAGTTGTCCCTTGG - Intronic
992990039 5:82274584-82274606 CGGGGTGGGCAGCTCTCCCCGGG - Exonic
993227207 5:85182450-85182472 AGGGCTGTACAGCTGTCTCCTGG - Intergenic
995849854 5:116533782-116533804 AGGTGAGGGCTGCTGGCCCCAGG - Intronic
997600808 5:135137190-135137212 AGGTGGGTGCAGGTATCACCTGG + Intronic
997865182 5:137455748-137455770 AGGTGTGAGCCACTGTGCCCAGG - Intronic
998560032 5:143162853-143162875 AGGTGTGGGCCACTGTACCCTGG - Intronic
999160254 5:149489806-149489828 AGATGTGTGCCGCTGTCCATTGG + Intergenic
999170797 5:149593046-149593068 AGGTGTAAGCCGCTGTACCCAGG + Intronic
999445316 5:151634080-151634102 GGGTGTTTCCAGCTGTCACCAGG + Intergenic
1000180230 5:158802103-158802125 TGGTGTGTGCAGCTATCAGCAGG + Intronic
1001252301 5:170155871-170155893 AGGTGTGAGCCGCTGCACCCGGG + Intergenic
1001656426 5:173354356-173354378 AGGTGTGAGCTGCCGTGCCCAGG + Intergenic
1002102141 5:176862907-176862929 AGGAGCCTGCAGCTGCCCCCAGG + Intronic
1002162394 5:177322705-177322727 AGGTGTGAGCAACTGGCGCCTGG + Intergenic
1002333180 5:178459481-178459503 AGGTGTGAGCCACTGCCCCCGGG - Intronic
1002897582 6:1388636-1388658 AGGGGTGTGCAGCTGTCACTAGG - Intergenic
1002940476 6:1711210-1711232 AAGTGGGGGCAGCTGTGCCCTGG - Intronic
1003151091 6:3549512-3549534 AGGAGTGTGCAGCAGTACCCAGG - Intergenic
1003172002 6:3727260-3727282 AGGGGTGTGATGCTGTCTCCAGG - Intronic
1003202053 6:3970299-3970321 AGGTGTGAGAAGCGGTCCCAGGG - Intergenic
1003444334 6:6171000-6171022 AGGTTTGGTCAGCTGTCCCTAGG + Intronic
1005955278 6:30659361-30659383 AGCTGTGTGCAGCAGTGCGCAGG + Intronic
1006171610 6:32096448-32096470 CGGTGTGCGCAGCTGTCCTGGGG - Intronic
1006388295 6:33744568-33744590 ACGTGTGTGCTGCTGCCCTCTGG - Intronic
1006467229 6:34202968-34202990 AGGTGGTTGCAGCTGCACCCAGG + Intergenic
1006657596 6:35609063-35609085 AGGTGTGGGCCACTGTGCCCAGG + Intronic
1006972232 6:38058206-38058228 CTGTGTGTGCATCTGTCTCCAGG + Intronic
1007173399 6:39879921-39879943 CAGTGTGTGCAGCTTCCCCCAGG - Intronic
1007985227 6:46200894-46200916 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1008682309 6:53885780-53885802 AGATGTGTCCAGGTGCCCCCAGG - Intronic
1010289988 6:74124429-74124451 AGGTGAGTCAAGCTCTCCCCAGG + Intergenic
1012966542 6:105680629-105680651 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1014391568 6:120871969-120871991 GGGTGGCTGCAGCTGTGCCCGGG - Intergenic
1015126252 6:129757888-129757910 AGGTGTGAGCAACTATGCCCAGG + Intergenic
1015411946 6:132903726-132903748 AGGTGTGTGCCACTGTGCCTGGG + Intergenic
1015455772 6:133424720-133424742 AGGTGGCTGCAGCTGCACCCAGG + Intronic
1015559602 6:134500607-134500629 AGGTGTGAGCCACTGCCCCCCGG - Intergenic
1015939806 6:138436991-138437013 AGGTGTGAGCCACTGCCCCCTGG - Intronic
1016076865 6:139805601-139805623 GGGTGACTGCAGCTGTGCCCAGG + Intergenic
1016861765 6:148727528-148727550 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1017480405 6:154848232-154848254 AGGCGTGAGCCGCTGTGCCCAGG - Intronic
1019412490 7:912348-912370 CGGTGGGAGCAGCTGTCACCAGG + Intronic
1019436377 7:1024358-1024380 TGGTGTGTGCAGCTGAACTCAGG - Intronic
1019870889 7:3759869-3759891 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1020102063 7:5399432-5399454 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1021488965 7:21197679-21197701 AGGTGGATGCTGCTGTCCACAGG + Intergenic
1021579110 7:22133477-22133499 GGGTGTGTTCAGGTGTCTCCAGG - Intronic
1022249935 7:28597384-28597406 AGTTGTTTTCAGCTGTCCACTGG + Intronic
1022251643 7:28614235-28614257 AGGTGTGAGCCACTGTACCCAGG + Intronic
1022588608 7:31639812-31639834 AGGTGTGAGCCACTGTACCCAGG + Intronic
1023271470 7:38467839-38467861 AGATGTTTGCAGCTGTCACAGGG - Intronic
1023839260 7:44086885-44086907 CAGTGTGTGAAGCTGTTCCCTGG - Intergenic
1026737566 7:72958835-72958857 AGGTGTAAGCTGCTGTGCCCAGG + Intergenic
1026805598 7:73427839-73427861 CTGTGTGTGCACCTGTGCCCAGG - Intergenic
1027106167 7:75406233-75406255 AGGTGTAAGCTGCTGTGCCCAGG - Intronic
1027160381 7:75798097-75798119 AGGTTTGAGCTGCTGTGCCCAGG + Intergenic
1028584549 7:92439990-92440012 AGGTGTGAGCCACTGTCCCCAGG - Intergenic
1029186242 7:98740934-98740956 AGATGTATGCATCTCTCCCCAGG - Intergenic
1029202147 7:98846328-98846350 AGGTGGGGAGAGCTGTCCCCAGG - Intergenic
1029294276 7:99527046-99527068 AGGTGTGAGCCACTGTACCCAGG - Intronic
1029348359 7:99995015-99995037 AGGTGTGAGCCGCTGTGCCCAGG - Intergenic
1029981462 7:104883581-104883603 AGGTGTGTGCAGCTGTGATCAGG + Intronic
1030285989 7:107827354-107827376 AGGTGTCTGAACCAGTCCCCAGG + Intergenic
1030818658 7:114069626-114069648 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1031079308 7:117242718-117242740 ATGTGCCTGCAGCTGTCACCAGG + Intergenic
1031927395 7:127651768-127651790 AGGTGGGCGCCGCTGTACCCGGG - Intergenic
1031941774 7:127797169-127797191 AGGTGTGAGCCGCTGTGCCCGGG + Intronic
1032677014 7:134140246-134140268 AGGTGTGAGCCACTGTGCCCGGG + Intronic
1033232121 7:139607958-139607980 AGGTGTGAGCCACTGTGCCCTGG - Intronic
1034481089 7:151320897-151320919 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
1034859549 7:154583782-154583804 ACCTGTGTGCTGCTGTCTCCGGG + Intronic
1034966302 7:155393301-155393323 GGGTGGCAGCAGCTGTCCCCAGG - Intronic
1035044473 7:155954672-155954694 AGGACTGTGAAGCTGTCCCACGG + Intergenic
1035306788 7:157938309-157938331 AGGCATGTGCAGCTGTCCCATGG - Intronic
1035589485 8:802091-802113 AGGTGTGTGGACCATTCCCCAGG - Intergenic
1036417575 8:8564776-8564798 AGCTGAGTGCACCTGTCTCCAGG + Intergenic
1037596648 8:20359906-20359928 AGGTGAGTGCACCAGTCCCCTGG + Intergenic
1037785100 8:21898075-21898097 AGGTATTTGTGGCTGTCCCCAGG + Intergenic
1037976846 8:23219941-23219963 ACGTGTGTGCACCTGGCCACAGG - Intronic
1038943011 8:32326284-32326306 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1039229576 8:35428462-35428484 AGGTGTGAGCCACTGCCCCCCGG + Intronic
1039369737 8:36972648-36972670 ATGTGTGTGCAGCTGCACCACGG + Intergenic
1039743966 8:40407063-40407085 AGCTGTGTGCAGATGACTCCGGG + Intergenic
1040620080 8:49082174-49082196 AGATGTGTGCTGATGTCCCAGGG + Intergenic
1041511851 8:58661449-58661471 AGGTGTGTGCCACTGTACCCAGG - Intergenic
1041511871 8:58661589-58661611 AGGTGTGTGCCACTGCACCCAGG - Intergenic
1041911895 8:63097716-63097738 AGGTGTGAGCCACTGTCCCCAGG - Intergenic
1042292807 8:67187415-67187437 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1042856512 8:73273229-73273251 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
1043195423 8:77287024-77287046 GGGTGGCTGCAGCTGTGCCCAGG - Intergenic
1043214415 8:77568020-77568042 AGGTGTGGGCTACTGTGCCCAGG + Intergenic
1043517602 8:81009891-81009913 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1044563998 8:93643477-93643499 AGGTGTGAGCCACTGTGCCCGGG + Intergenic
1045238467 8:100377032-100377054 GGGTGTCTGTAGCTCTCCCCTGG - Intronic
1045302188 8:100921305-100921327 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1045599156 8:103693720-103693742 AGGTGTGTGTCCCTGGCCCCTGG + Intronic
1045851958 8:106711761-106711783 AGGTATGTGCAGCTGTCACTTGG - Intronic
1046263651 8:111803321-111803343 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1047740752 8:127804447-127804469 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1048503299 8:134997975-134997997 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1050036850 9:1445292-1445314 AGGTGTGTGTAACTGAGCCCAGG + Intergenic
1050511733 9:6403161-6403183 AGGTGTGTGCCACTGCTCCCTGG - Intergenic
1050594555 9:7193040-7193062 AGGTGTGAGCCACTGTGCCCAGG + Intergenic
1051151332 9:14082406-14082428 AGGTGGGGGCAGCTCTTCCCAGG + Intronic
1052583684 9:30395487-30395509 AGGTGTGTGCCACTGCCACCTGG + Intergenic
1053403684 9:37851514-37851536 AGGTGTGAGCCACTGTGCCCAGG - Intronic
1053433826 9:38061884-38061906 CGTTTTGTGCAGCTGTCCCTTGG + Intronic
1053617278 9:39781393-39781415 GGGTGGCTGCAGCTGTACCCAGG - Intergenic
1053897184 9:42753877-42753899 GGGTGGCTGCAGCTGTACCCAGG + Intergenic
1054158347 9:61656547-61656569 ATGTGTGTTCAGGGGTCCCCAGG + Intergenic
1054266888 9:62926044-62926066 GGGTGGCTGCAGCTGTACCCAGG + Intergenic
1054478120 9:65587552-65587574 ATGTGTGTTCAGGGGTCCCCAGG + Intergenic
1054550381 9:66595498-66595520 GGGTGGCTGCAGCTGTACCCAGG + Intergenic
1054906794 9:70419755-70419777 AGGCGGGTGCTGCTGTCCCCGGG + Intergenic
1057267504 9:93629038-93629060 AGGTGTGTGCCACTGTGCTCCGG + Intronic
1057468419 9:95337195-95337217 GGGTGGCTGCAGCTGTGCCCTGG - Intergenic
1059065075 9:111075214-111075236 AGGTGTGTGCAACCATGCCCAGG - Intergenic
1059188544 9:112300816-112300838 AGGTGTGAGCCACTGTGCCCGGG - Intronic
1059310031 9:113381907-113381929 AGGTGTGCGCCACTGTGCCCGGG + Intergenic
1059678896 9:116567264-116567286 ATATGTGTGCAGTTGTCCTCAGG + Intronic
1060343668 9:122798626-122798648 AGATGTGTCCATCTGTCCACAGG + Intronic
1060734804 9:126060076-126060098 AGGTGCCTACTGCTGTCCCCAGG + Intergenic
1060922336 9:127430092-127430114 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1061133027 9:128718761-128718783 CAGTGTGCCCAGCTGTCCCCTGG - Intronic
1061615715 9:131777480-131777502 AGGTGTGAGCCACTGTGCCCTGG - Intergenic
1061720418 9:132547684-132547706 AGGTGTCCTCAGGTGTCCCCAGG + Intronic
1061941702 9:133887389-133887411 AGGTGTGGACATCTGGCCCCAGG + Intronic
1062166144 9:135108353-135108375 AGGTGTGAGCCACTGTGCCCGGG - Intronic
1062229023 9:135470889-135470911 AGCTGTGTGCAGCCGTGTCCAGG - Intergenic
1062694166 9:137864475-137864497 AGGTGTGAGCCACTGTGCCCAGG + Intronic
1062710422 9:137972334-137972356 GGGTGAGTGCAGCTGACCCCTGG - Intronic
1202801554 9_KI270720v1_random:4049-4071 AGGTCTCTGCAGCTGTGCCAAGG + Intergenic
1186033227 X:5392326-5392348 AGAGGAGTCCAGCTGTCCCCAGG - Intergenic
1186179702 X:6960869-6960891 AGGTATGAGCAGCTGTTCCATGG - Intergenic
1186600211 X:11028608-11028630 AGGTGTGGGCCACTGTGCCCAGG + Intergenic
1189317114 X:40064120-40064142 AGGTGTGGGCGGCTCCCCCCGGG + Intronic
1189436688 X:40999264-40999286 AGGTGTGAGCCACTGTGCCCGGG - Intergenic
1189494267 X:41494946-41494968 AGGTGTGAGCCACTGTGCCCGGG + Intergenic
1190016103 X:46828703-46828725 AGGTGTGAGCCACTGTGCCCAGG - Intergenic
1190904093 X:54709079-54709101 AGGTGTGAGCCACTGTGCCCGGG - Intergenic
1192326519 X:70136983-70137005 AGGTGTGAGCCGCTGTGCCCTGG + Intronic
1194195210 X:90883623-90883645 AGCAATGTGCAGCTGTCCCATGG - Intergenic
1194379254 X:93174690-93174712 AGGTGGTTGCAGCTGCACCCAGG - Intergenic
1194380181 X:93181405-93181427 AGGTGGGTGCAGCTTCACCCAGG - Intergenic
1196210842 X:112994191-112994213 AGGTGTGAGCCACTGTGCCCTGG + Intergenic
1196427895 X:115590539-115590561 AGGTGTGAGCAACTGTGCCCGGG - Intronic
1199188114 X:144939963-144939985 GGGTGCCTGCAGCTGTGCCCAGG + Intergenic
1199599068 X:149530438-149530460 AGGTGTGAGCCGCTGCACCCAGG - Intronic
1200400429 X:156016734-156016756 AGGTGTCCCCAGGTGTCCCCAGG + Intergenic
1201708843 Y:16967145-16967167 AGGTGTGTGCCACTGTGGCCTGG - Intergenic