ID: 1090276315

View in Genome Browser
Species Human (GRCh38)
Location 11:125422278-125422300
Sequence GCCTGAAGGCCTTTAGTGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090276311_1090276315 21 Left 1090276311 11:125422234-125422256 CCAGCCACGACTGTCTTCATTCT 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG 0: 1
1: 0
2: 1
3: 2
4: 87
1090276310_1090276315 22 Left 1090276310 11:125422233-125422255 CCCAGCCACGACTGTCTTCATTC 0: 1
1: 0
2: 1
3: 7
4: 157
Right 1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG 0: 1
1: 0
2: 1
3: 2
4: 87
1090276308_1090276315 28 Left 1090276308 11:125422227-125422249 CCTTACCCCAGCCACGACTGTCT 0: 1
1: 0
2: 1
3: 9
4: 176
Right 1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG 0: 1
1: 0
2: 1
3: 2
4: 87
1090276307_1090276315 29 Left 1090276307 11:125422226-125422248 CCCTTACCCCAGCCACGACTGTC 0: 1
1: 0
2: 0
3: 21
4: 165
Right 1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG 0: 1
1: 0
2: 1
3: 2
4: 87
1090276309_1090276315 23 Left 1090276309 11:125422232-125422254 CCCCAGCCACGACTGTCTTCATT 0: 1
1: 0
2: 2
3: 23
4: 193
Right 1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG 0: 1
1: 0
2: 1
3: 2
4: 87
1090276306_1090276315 30 Left 1090276306 11:125422225-125422247 CCCCTTACCCCAGCCACGACTGT 0: 1
1: 0
2: 6
3: 180
4: 401
Right 1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG 0: 1
1: 0
2: 1
3: 2
4: 87
1090276312_1090276315 17 Left 1090276312 11:125422238-125422260 CCACGACTGTCTTCATTCTAGAC 0: 1
1: 0
2: 1
3: 3
4: 80
Right 1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG 0: 1
1: 0
2: 1
3: 2
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090276315 Original CRISPR GCCTGAAGGCCTTTAGTGTA CGG Intronic
903706404 1:25288966-25288988 GCCTCAAGGACTTTAGGGGAAGG - Intronic
903720833 1:25404400-25404422 GCCTCAAGGACTTTAGGGGAAGG + Intronic
904277901 1:29396168-29396190 GCCTGAATGCTCTTAGTGAAGGG - Intergenic
910262274 1:85304149-85304171 GTCTGAAGGCCAATAATGTAAGG - Intergenic
916671193 1:167022252-167022274 GCCTGCAGGTCTCCAGTGTAAGG - Intergenic
916993328 1:170268239-170268261 ACCTGAAGGAATTTAGTGTCAGG - Intergenic
919713982 1:200755961-200755983 GGCAGAAGGCCTCTAGTGCATGG + Intronic
921542380 1:216431832-216431854 GCCTGAAGCCCATGAGTGTGTGG + Intergenic
923500671 1:234561112-234561134 ACCTGAAGGCCATGTGTGTATGG + Intergenic
1067549759 10:47226089-47226111 GCCTGTAGCCCCTTGGTGTATGG - Intergenic
1073275822 10:102310488-102310510 GCGTGCAGGCCTCTAGTCTAGGG - Intronic
1074650635 10:115520580-115520602 GCCTGAATGCCTTTAATGACAGG + Intronic
1080123189 11:28700984-28701006 GCTTGAAGGGCTTTATTTTATGG + Intergenic
1090276315 11:125422278-125422300 GCCTGAAGGCCTTTAGTGTACGG + Intronic
1090558300 11:127900111-127900133 GTCTGAAGTCCTTAAATGTAAGG + Intergenic
1101481529 12:105102812-105102834 TCTGGAAGGCCATTAGTGTAGGG - Intergenic
1101647858 12:106647770-106647792 GCCTGAGGCCCTTTATTGTGGGG - Intronic
1103911968 12:124356853-124356875 GCAGGAAGGCCATTTGTGTAGGG - Intronic
1106257176 13:28032283-28032305 GCATGAGGGCCCTTGGTGTATGG + Intronic
1110368125 13:74710430-74710452 CTCTGAAGGCCTTGAGTGTAAGG - Intergenic
1111126949 13:83922578-83922600 GCCTGAAGGACTTTTCTTTAAGG - Intergenic
1116611379 14:47077198-47077220 GCCTGTAGCCATTTAGTGAAAGG - Intronic
1118344253 14:64924545-64924567 TCCTGAAGTCATTTAGTATAGGG - Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1126378814 15:48024785-48024807 ACTTGAAGGCCTGTAGTATAAGG + Intergenic
1127502651 15:59569279-59569301 CCCTGAAGGCCCTTTGGGTAGGG + Intergenic
1128991542 15:72264883-72264905 GCAAGAAGGCCTTTAGGGAATGG + Intronic
1134266512 16:12697429-12697451 TCCTGAAGGTCTTCAGTGGAGGG - Intronic
1143893051 17:10116999-10117021 GTTTGAAGCCCGTTAGTGTATGG - Intronic
1150693791 17:67386754-67386776 GCCTGGAGGTCTGTAGTGTTAGG + Intronic
1156487008 18:37472752-37472774 GCCTGAAGGTCTTCAGAGAAGGG + Intronic
1165610947 19:37151961-37151983 GCGGGAAGGCCTTTAGTGGCAGG - Exonic
1167238092 19:48326978-48327000 GCCAGAATGCCTTTAGAGGAGGG - Intronic
929862115 2:45687931-45687953 GGCTGGTGGCCTTTATTGTATGG + Intronic
935130962 2:100260725-100260747 GCGGGAAGGCGCTTAGTGTAAGG - Intergenic
937883089 2:126882941-126882963 GCCTGAAAGCCTTCAGAGGAAGG + Intergenic
939674127 2:145050663-145050685 GCCTGAAGACCTTTAGTGTCTGG + Intergenic
942903651 2:181154793-181154815 TTCTGAAGTCCTTTAGCGTATGG + Intergenic
944155093 2:196599261-196599283 GCCTGAGGCCATTTAGTCTAAGG - Intergenic
1170177692 20:13490712-13490734 ACCTTAAGGCCTATAGGGTAAGG + Intronic
1172291196 20:33778270-33778292 GCCTGGAGGCATTTAGTATGTGG + Intronic
1174403613 20:50289834-50289856 GCCTGAAGGCCGTGAGTTTGAGG + Intergenic
1179626444 21:42652280-42652302 GCCTGGAGGCCTTTGGGGTGGGG - Intergenic
1181571254 22:23768654-23768676 GCGTAAAGGCCGTTAGTGTCGGG - Intronic
1182871003 22:33647568-33647590 GTCTGGAGGCCATCAGTGTAGGG - Intronic
1183742198 22:39675012-39675034 CCCTGAAGGGGTTTAGTGTTAGG - Intronic
954910595 3:54104145-54104167 GCCTGGAGTCCTTTAAAGTAGGG + Intergenic
956780851 3:72601933-72601955 GCCTGAAGGGCTTTGGTAAAAGG - Intergenic
959241883 3:103807748-103807770 GCCTGAACGTTTTTGGTGTATGG + Intergenic
960429244 3:117548499-117548521 GCCTTAAGACCTTTAGGGAAAGG - Intergenic
961727860 3:128944682-128944704 CCCTGAAGGCCTTCAGGGAAGGG + Intronic
966939650 3:184737566-184737588 GCCTGAAGACCTTTCCTGCAAGG + Intergenic
969174993 4:5391683-5391705 GCCTGAAGGCCTTTGGAATCTGG + Intronic
973747030 4:53973829-53973851 GACAGAAGGACTTTAGTGAAGGG - Intronic
979222837 4:118248648-118248670 GCCTGAAGGCCTTGAAAGGAGGG + Intronic
982215004 4:153074905-153074927 TCCTGAAGGGCTCTATTGTATGG - Intergenic
983210295 4:164951747-164951769 GTCTGTAGGCCTTTCGTGGAGGG - Intergenic
983777916 4:171631395-171631417 TCCTGAAGGTTTTTAGTGAAAGG - Intergenic
984751434 4:183279950-183279972 CTCTCAATGCCTTTAGTGTATGG + Intronic
985592193 5:771319-771341 CCCTTAAGGTCTTCAGTGTAGGG - Intergenic
988072807 5:26315993-26316015 AACTGAAGGCCTTTATTCTAAGG - Intergenic
988478355 5:31608182-31608204 GCCTGAAGCCCTTAACTTTAGGG - Intergenic
989486319 5:41995924-41995946 GCCTGAAGGACAGTAGTGAAGGG - Intergenic
990303898 5:54476318-54476340 GACTGAGGGGTTTTAGTGTAGGG - Intergenic
993965752 5:94358426-94358448 CCCTGAAGGCCTTTATACTATGG + Intronic
1001579035 5:172785944-172785966 GCCAGAAGGCCTTTTGGGTCAGG - Intergenic
1004758198 6:18636529-18636551 GTTAGAAGGCCTTAAGTGTAGGG + Intergenic
1008427315 6:51374388-51374410 GGCTGAAAGTCTTTAGTGTTGGG + Intergenic
1009337957 6:62517059-62517081 GCTTGAAGAATTTTAGTGTAGGG - Intergenic
1028134464 7:87211063-87211085 GCCTCAGGGCCTGTAGTGTGGGG + Intronic
1031987507 7:128172598-128172620 GCCTGAAGCACTTTATTATAAGG - Intergenic
1033362347 7:140646707-140646729 GCCTGCAGGGCTTTGGTCTATGG - Intronic
1036527292 8:9547093-9547115 CCCTGAAGGCCATTAGTGAAGGG - Intergenic
1038216223 8:25564020-25564042 GCCTTAAGGCCTTGAGACTAAGG - Intergenic
1038627130 8:29205017-29205039 GCCTGTAGACCTTGAGTGTGTGG - Intronic
1038951999 8:32425240-32425262 GCCTGAAGGCATTTGTTCTATGG - Intronic
1042413426 8:68491501-68491523 GCCTGTATTCCTTTAGTGCATGG + Intronic
1043783007 8:84360757-84360779 GCCTGCAGGCATTGAGTGTGGGG + Intronic
1047920384 8:129628981-129629003 GCCTGAAAGCATTTTGTGGATGG - Intergenic
1050084687 9:1952135-1952157 GGCTGAAATCCTGTAGTGTAAGG + Intergenic
1050341661 9:4646030-4646052 GCCTGTAGGCCATTGTTGTATGG - Intronic
1050759462 9:9049194-9049216 GCCTTAAGGCATTCAGTGGAAGG + Intronic
1051400043 9:16671187-16671209 GCATGAAGGCATTTTGTTTAGGG - Intronic
1052564499 9:30130651-30130673 GCCTGAACACCTTTACTGAAAGG - Intergenic
1057459482 9:95246758-95246780 GCCTGAAGGCACTTTGTGTCAGG - Intronic
1057634824 9:96754889-96754911 GCTTGAAGGCCCTTAGTGGGTGG + Intergenic
1057956429 9:99411875-99411897 GCCAGACGGCCTTCAGTGTCAGG - Intergenic
1062541628 9:137044171-137044193 GCCTGAGGGCCCTGAGTGTCAGG - Intronic
1197094339 X:122575070-122575092 GCCTCTAGGCCTTTAATGGAAGG + Intergenic
1197693903 X:129530453-129530475 GCCTGAAGCCCATTTTTGTATGG - Intergenic
1197764294 X:130049931-130049953 GCCTGAAGGCATTTAGGTTTGGG - Intronic