ID: 1090277854

View in Genome Browser
Species Human (GRCh38)
Location 11:125432228-125432250
Sequence CTCCTTTAACAACAGGACAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090277851_1090277854 0 Left 1090277851 11:125432205-125432227 CCCTAGGTGATCACAGAACTTAG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1090277854 11:125432228-125432250 CTCCTTTAACAACAGGACAATGG 0: 1
1: 0
2: 1
3: 14
4: 234
1090277850_1090277854 10 Left 1090277850 11:125432195-125432217 CCACAGCTGTCCCTAGGTGATCA 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1090277854 11:125432228-125432250 CTCCTTTAACAACAGGACAATGG 0: 1
1: 0
2: 1
3: 14
4: 234
1090277852_1090277854 -1 Left 1090277852 11:125432206-125432228 CCTAGGTGATCACAGAACTTAGC 0: 1
1: 0
2: 0
3: 15
4: 132
Right 1090277854 11:125432228-125432250 CTCCTTTAACAACAGGACAATGG 0: 1
1: 0
2: 1
3: 14
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090277854 Original CRISPR CTCCTTTAACAACAGGACAA TGG Exonic
900865917 1:5268546-5268568 TTGCTTTAAAAACAGGACCATGG + Intergenic
905051351 1:35053694-35053716 CTACTGTAACATCAGGACAGAGG - Intergenic
907177902 1:52542701-52542723 TTCCTCTAACATCAAGACAAGGG + Intronic
907701593 1:56793446-56793468 CTCCATTAAAAAATGGACAAAGG + Intronic
907758363 1:57333225-57333247 CTCCTCTAACTTTAGGACAATGG - Intronic
908731126 1:67227313-67227335 TTCCTTTAATAACAGGTTAAAGG + Intronic
908757611 1:67483300-67483322 TTGCTTTGCCAACAGGACAAGGG - Intergenic
909533892 1:76711979-76712001 CTCCTTTACTTACAAGACAATGG + Intergenic
909661460 1:78087921-78087943 CTCCATTAAAAAGTGGACAAAGG + Intronic
909803230 1:79841162-79841184 CTCCTTCAAGAAAAGCACAAAGG - Intergenic
910889605 1:92003508-92003530 CTCCTTTAGCTACATGTCAAGGG - Intronic
915624875 1:157108221-157108243 CTTCTTTAACGCCAGGAAAAGGG + Intergenic
916840048 1:168590872-168590894 CTTCTTCAACAAGAGGATAAGGG - Intergenic
917652206 1:177089032-177089054 CCCCTTTATGAGCAGGACAATGG + Intronic
917863038 1:179166422-179166444 CTCATTTAACAAGTGGAAAAAGG + Intronic
918569645 1:185974375-185974397 CTCTTTTAACAACATGAGATAGG + Intronic
918805829 1:189042630-189042652 CTCCATTAACAAGTAGACAAAGG - Intergenic
920358047 1:205390477-205390499 TTCCTTTAAAATCAGGACCAAGG + Intronic
921675050 1:217967702-217967724 CTCCATTAAAAAGTGGACAAAGG - Intergenic
923150298 1:231227194-231227216 CTCCTTTGACCACATGACAGTGG - Intronic
923258269 1:232241239-232241261 CTCCTTTAACCACAGCAGGAAGG - Intergenic
923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG + Intronic
1063088191 10:2838346-2838368 CTTCTTTAACGAAAGGACAAGGG - Intergenic
1063776281 10:9268610-9268632 CCCCATTAAAAAGAGGACAAAGG - Intergenic
1064845659 10:19649555-19649577 CTCCATTAAAAAGTGGACAAAGG - Intronic
1064912114 10:20414213-20414235 CCCCTTTAAAAAGTGGACAAAGG + Intergenic
1066143993 10:32537323-32537345 CTCCATTAAAAAGGGGACAAAGG - Intronic
1066202351 10:33154021-33154043 CTCCTTTGACAAGAATACAAAGG + Intergenic
1070400625 10:76050515-76050537 CTCCTATAATAACAGGGCCATGG - Intronic
1072743058 10:97921931-97921953 CGCATTTAACCACAGGACAAAGG - Intronic
1074210318 10:111326674-111326696 CTCCATTAAAAACTGGACAAAGG - Intergenic
1074210353 10:111327230-111327252 CTCCATTAAAAACTGGGCAAAGG + Intergenic
1074745743 10:116530276-116530298 CTCATTTAATAAGAAGACAAAGG + Intergenic
1075437551 10:122456699-122456721 CTCCTTCCAAAATAGGACAAAGG - Intronic
1076285700 10:129294320-129294342 TTCCTTTAATAACAAGACAAGGG + Intergenic
1077553412 11:3214301-3214323 CTCCTCTAACATTAGGACCACGG + Intergenic
1077757567 11:5050048-5050070 ATAATTTAATAACAGGACAAAGG + Intergenic
1078223663 11:9372814-9372836 CTCCTTTTACTAAAGGAAAATGG + Intergenic
1079133329 11:17762112-17762134 CCCCTTTTACTGCAGGACAAGGG + Intronic
1080503517 11:32892257-32892279 CTCCCCTAACAGCAGGAAAAGGG + Intergenic
1080997426 11:37620519-37620541 CTCCCTTCACAATAGGACCAGGG + Intergenic
1082741075 11:56911832-56911854 CTTCTTAAACAACAGAAAAAAGG + Intergenic
1082760676 11:57124131-57124153 CCCCTCTATCAACAGGACATGGG + Intergenic
1084424838 11:69079007-69079029 CTACTTTACCAGCAGGACAACGG - Exonic
1085777551 11:79380127-79380149 CTCCTTTTATAAAAGGACATTGG - Intronic
1090277854 11:125432228-125432250 CTCCTTTAACAACAGGACAATGG + Exonic
1091140940 11:133234070-133234092 TTCCCTTATCAACAAGACAATGG + Intronic
1091144515 11:133265973-133265995 CTCCGTTTACAAAAGGAGAAGGG + Intronic
1092509365 12:9138087-9138109 TTCCTTTAAGAACAGGAGCAAGG - Intergenic
1093211463 12:16314045-16314067 CTCCTCTAACAAAGGGAGAAGGG - Intergenic
1093833046 12:23789463-23789485 CTCCTTTAAGAATAGGCCAGAGG - Intronic
1094460340 12:30691012-30691034 CTCCATTTACAAAAGGATAAAGG - Intronic
1096554928 12:52397735-52397757 CTGTTTTAAGAAGAGGACAATGG - Intronic
1097370352 12:58771238-58771260 CTCCATTAAAAAGTGGACAAAGG + Intronic
1097797365 12:63878030-63878052 CTCCTTTAAAAAGCTGACAAAGG + Intronic
1097903236 12:64893781-64893803 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1102917392 12:116764580-116764602 CTGTTTTAACAACAGCAGAAAGG - Intronic
1107025833 13:35800510-35800532 CTCTTTCAACAACAGAGCAAAGG + Intronic
1107961461 13:45563147-45563169 CTCCTTTACCAAGAGACCAAAGG - Intronic
1108710753 13:53029864-53029886 CTCCTTTAAAGAAAGGAGAATGG + Intronic
1111314279 13:86532301-86532323 CTCCTTTACCATCAGGACCACGG - Intergenic
1113397165 13:109958811-109958833 CTCCATTAAAAACTGGGCAAAGG - Intergenic
1113543324 13:111125719-111125741 CTACTTTAAGGACAGGACATTGG - Intronic
1113906983 13:113823876-113823898 CTCCTGAAACAAGAGGACATCGG - Intronic
1114851759 14:26390673-26390695 CTCCTTTAAAAACAGGAGAGTGG + Intergenic
1114942948 14:27638781-27638803 TTCTTTTAAAAACAGGAAAATGG - Intergenic
1115094390 14:29617354-29617376 TTCATTTAAAAACAGAACAATGG - Intronic
1116359846 14:43979956-43979978 CCCCATTAAAAACTGGACAAAGG - Intergenic
1117253753 14:53957749-53957771 TTCCTTTAAAAACAGACCAAGGG - Intronic
1117294535 14:54366862-54366884 CTCTTTCAACCACAGGAGAAAGG + Intergenic
1120291389 14:82576347-82576369 CTCCTTTAAAAAGTGGGCAATGG + Intergenic
1120500535 14:85291719-85291741 CTCCCATAACAAAATGACAATGG - Intergenic
1120836716 14:89045199-89045221 TACCTTTACCAACATGACAAAGG + Intergenic
1122050361 14:99055288-99055310 GTCCTTTAACAACTGGGAAATGG - Intergenic
1123455704 15:20422408-20422430 CTCCATTAAAAAATGGACAAAGG - Intergenic
1123950618 15:25269628-25269650 CTCCCTGAACAACAGGGTAAAGG - Intergenic
1128012392 15:64310335-64310357 CACCTTTTCCAACAGGAAAAGGG + Intronic
1128201731 15:65814659-65814681 CTCCTTTAATCACAGTACTATGG - Intronic
1129863683 15:78885027-78885049 CTCCTTCAGGAACAGGAAAAAGG - Exonic
1130614177 15:85388427-85388449 CCCCTCTAACATCAGGAAAAAGG - Intronic
1130892327 15:88143553-88143575 CTCTTTTAACACCAGCAAAATGG + Intronic
1139638807 16:68275926-68275948 TTCCTTTAGCAACAGAATAAAGG - Intronic
1141089492 16:81120587-81120609 CTCTTTCAACAACAGGAGAAAGG - Intergenic
1143074440 17:4328780-4328802 CTGCACTAACAACATGACAATGG + Intronic
1143428236 17:6857668-6857690 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1144136439 17:12299780-12299802 CTACTTTAACTACTGTACAATGG - Intergenic
1144249850 17:13404911-13404933 CTCTCTTGACAACAGGAAAAAGG - Intergenic
1146622512 17:34410224-34410246 CCCCTTTAAGAAGTGGACAAAGG + Intergenic
1149202258 17:54200723-54200745 CCCCTGTACCAACAGGAAAAAGG - Intergenic
1151423557 17:74014848-74014870 CTCCTTGGACATCAGGACATTGG + Intergenic
1152717984 17:81909033-81909055 CTCCTCTAGGAAAAGGACAACGG + Exonic
1152789152 17:82269252-82269274 CGCCTTGAGCAGCAGGACAAAGG + Intronic
1153192276 18:2554944-2554966 CTTTTTGAAAAACAGGACAAGGG - Exonic
1153785831 18:8534401-8534423 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1155351272 18:24909654-24909676 CTCTATTCACAACTGGACAATGG + Intergenic
1155382732 18:25242142-25242164 CTCCTTGAATAATAGGAAAAAGG - Intronic
1156102333 18:33611850-33611872 TTCCTTTACCAAGAGGACTATGG + Intronic
1156311376 18:35925487-35925509 CTACTTGAAGAACAGGACACTGG - Intergenic
1157277244 18:46320001-46320023 CTCCTTTAACCACAGTATATGGG - Intergenic
1158115790 18:53993716-53993738 TTCCATTAAAAACAGGAAAAAGG - Intergenic
1159573112 18:70143181-70143203 CTCCATTAAAAAGTGGACAAAGG - Intronic
1160571730 18:79822113-79822135 CTGCTTAAACCCCAGGACAATGG - Intergenic
1161174998 19:2836542-2836564 ATCCATTCACAAAAGGACAAAGG + Intergenic
1161535013 19:4813643-4813665 CTCCTTACACGCCAGGACAACGG + Intergenic
1167188526 19:47965896-47965918 TTCTTTGAGCAACAGGACAAAGG - Intergenic
925581065 2:5411344-5411366 TTCCTTTAGCTACAGGACACAGG + Intergenic
925788845 2:7461674-7461696 CTCCATTAAAAAGTGGACAAAGG + Intergenic
927329663 2:21847409-21847431 CTCCATTAAAAACTGGACAGAGG + Intergenic
927672814 2:25083011-25083033 CTCCTTTAAAACCATGAGAATGG - Intronic
928580132 2:32699057-32699079 CTTCTTTTACAAAGGGACAAGGG - Intronic
931798461 2:65734927-65734949 CCCCTTTAAAAAGTGGACAAAGG - Intergenic
933404200 2:81837409-81837431 CCCCATTAAAAAGAGGACAAAGG - Intergenic
933610639 2:84430886-84430908 CTCCTTTCACCACAGGAACAGGG + Intronic
935157770 2:100498418-100498440 CTTCTTCAAATACAGGACAAAGG + Intergenic
937121052 2:119440167-119440189 CTCCTTCAGCAACAGCACCAAGG - Exonic
937194379 2:120138269-120138291 CTCCTTTAAGATCTGGAAAAAGG + Intronic
937297786 2:120820199-120820221 CTCCCTTAAAATCAGGACAGTGG + Intronic
937301289 2:120844037-120844059 CACCTTTTACATCAGGGCAAGGG + Intronic
939747831 2:145999495-145999517 CTCCATTAAAAAGTGGACAAAGG + Intergenic
941178742 2:162233541-162233563 CTCCATTAAAAAATGGACAAAGG - Intronic
941238841 2:163011934-163011956 CTCCGTTAAAAAGTGGACAAAGG - Intergenic
941743171 2:169058121-169058143 CTCCATTAAAAAGTGGACAAAGG + Intergenic
942499336 2:176572298-176572320 CTCCTTGGACAAAAGGAGAATGG - Intergenic
942824836 2:180163088-180163110 CTCCCTTAACATCAGGAAGAAGG + Intergenic
943366721 2:186973574-186973596 CTCCTTTAACAGTAGAAGAATGG - Intergenic
943700441 2:190983541-190983563 CTCCCTTAACAACTGGCCATTGG + Intronic
944705476 2:202284368-202284390 GTTCATTAACAACAGGACTATGG - Exonic
944730730 2:202514868-202514890 CTCCTATAAGAACAGGAAACAGG - Exonic
945264729 2:207879732-207879754 CTCTCTAAACAAGAGGACAACGG + Intronic
945981207 2:216312711-216312733 CTCCATTAAAAACTGGGCAAAGG - Intronic
948934222 2:241151745-241151767 CTCCTTGACTAACAGGACATGGG - Intronic
1168883199 20:1225397-1225419 CACCTTTCACAACAGGACTATGG + Intergenic
1169302007 20:4451139-4451161 CTGCTTTAACAATAAGAAAATGG + Intergenic
1171384467 20:24760553-24760575 TTCCTCTAACATCAGGAAAAAGG + Intergenic
1179961424 21:44769008-44769030 CTCCTCTGACAATACGACAAAGG + Exonic
1181329946 22:22082499-22082521 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1184142716 22:42587617-42587639 CTCCTCACACAAGAGGACAAGGG + Intronic
1184668689 22:46001738-46001760 AGCGTTTAAAAACAGGACAAAGG - Intergenic
950538557 3:13595786-13595808 CTCCTTTGATCATAGGACAATGG - Intronic
951456252 3:22895577-22895599 CTAATGTAACAACAGGGCAAGGG + Intergenic
951649938 3:24940434-24940456 CTCTTTTTACAACAAGAGAAGGG + Intergenic
953728676 3:45425979-45426001 CTACTGTAACAACATGACAGTGG - Intronic
953831816 3:46304492-46304514 CTCCTATAACAAAAGCACATAGG - Intergenic
954236031 3:49257928-49257950 GTGCTTGAAAAACAGGACAAGGG - Exonic
958013610 3:87913254-87913276 CCCCATTAAAAAGAGGACAAAGG + Intergenic
959124454 3:102273228-102273250 CTCCATTAAAAACTGGGCAAAGG - Intronic
959287232 3:104430561-104430583 CTTCTTTTTCAACAGGACATTGG - Intergenic
959646772 3:108712363-108712385 CACTTTGAACAACAGCACAAAGG - Intergenic
963089408 3:141468473-141468495 CTCCATTAAAAACTGGGCAAAGG - Intergenic
963197943 3:142554486-142554508 CTCCTTTAACACCAGCACTTCGG - Intronic
963643166 3:147882448-147882470 CTCCTCAAACAAAAGGAGAAAGG + Intergenic
963769317 3:149373480-149373502 TTCCTTCCACAACAGAACAAAGG + Intronic
967090908 3:186134015-186134037 CTCCTTCAACACCAGGAAATTGG + Intronic
967229753 3:187326245-187326267 CTGCTTTAAATATAGGACAAAGG - Intergenic
970472078 4:16388937-16388959 CTCCTTCAACAAGAGGATATGGG + Intergenic
970562423 4:17295770-17295792 CTTCATTAGCAACATGACAATGG - Intergenic
971387842 4:26157722-26157744 CACTTTTACCAATAGGACAATGG + Intergenic
972030711 4:34454171-34454193 CTCCATTAAAAAGTGGACAAAGG + Intergenic
975478398 4:74849458-74849480 CTCCATTAAAAAGTGGACAAAGG - Intergenic
978539160 4:109797732-109797754 CTACTTTAAAAAGTGGACAAAGG + Intronic
978952468 4:114577412-114577434 CCCCATTAACCACTGGACAAAGG - Intergenic
982042680 4:151410529-151410551 CTCATTAATCAACAGGATAAAGG - Intronic
982433673 4:155355158-155355180 CTCCTATAAGAACAAGAAAAAGG + Exonic
984658832 4:182350981-182351003 CTCTTTTAACAACACGTCAGTGG - Intronic
986412336 5:7493372-7493394 CTCCTCTAAGAAGAGGACAGGGG + Intronic
988123607 5:26999591-26999613 CTCATTTGACAAAGGGACAAAGG + Intronic
988267971 5:28976168-28976190 ATCCTTAAACAAGAGAACAAGGG - Intergenic
990066693 5:51724881-51724903 TTACTTTAACAACAATACAATGG - Intergenic
990433980 5:55768943-55768965 CTCCGTTAAAAAGTGGACAATGG - Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991972970 5:72158488-72158510 TTCCTTTAAACACAGCACAAGGG + Intronic
993032592 5:82722430-82722452 CTCCTATAAGAAAAGGAAAATGG - Intergenic
993978675 5:94514874-94514896 TTCCTTAAACAAAAGAACAAGGG + Intronic
994332983 5:98529354-98529376 CTCATTTAAGAACAAGAGAATGG + Intergenic
994446231 5:99878777-99878799 CTCCTTCAACCACAGGTAAATGG + Intergenic
995810325 5:116099771-116099793 CCCATTTAAAAACTGGACAAAGG - Intronic
995908422 5:117155321-117155343 GTCTTTTATCAACAGGTCAAAGG + Intergenic
996027348 5:118661724-118661746 CTTCTTTGACAACAGAACAAAGG - Intergenic
997017738 5:129956378-129956400 CTCCATTAAAAAGTGGACAAAGG - Intronic
997393062 5:133532732-133532754 CTCCTTTAACAACATCAGTAGGG + Intronic
999072082 5:148754342-148754364 CTCATTTAAAAATTGGACAAAGG - Intergenic
999085857 5:148888899-148888921 CTCCTTGAACTCCAGGAGAAGGG - Intergenic
999655530 5:153806983-153807005 CTCCTTCAACCACATGGCAACGG + Intronic
999761519 5:154704809-154704831 CTCCATTAAAAAATGGACAAAGG + Intergenic
1000236691 5:159368073-159368095 CTCCCTTCAGGACAGGACAATGG + Intergenic
1004491139 6:16117444-16117466 TTCCTTTAACTACAGGACCAAGG + Intergenic
1007746963 6:44049015-44049037 CCCCTTTGCCTACAGGACAAAGG + Intergenic
1008334863 6:50290521-50290543 CTTCTTGGAAAACAGGACAATGG - Intergenic
1009812635 6:68688814-68688836 CACCTTTAACAACAGACCACAGG + Intronic
1009842690 6:69096530-69096552 CACTTTTAAAAATAGGACAATGG - Intronic
1013921290 6:115407585-115407607 CTCCTTTAAGAAGTGGGCAAAGG - Intergenic
1015641649 6:135340063-135340085 CTCCTTTAAAAAAAGAAAAAAGG + Intronic
1016608455 6:145961759-145961781 CTCAGTTAAGAACTGGACAAAGG - Intronic
1017000235 6:149991429-149991451 CTCCTATAACAGCAGGAGGATGG + Intergenic
1018049162 6:159993076-159993098 CCCCTTTAAAAAGAGGGCAAAGG - Intronic
1019717707 7:2547709-2547731 CACCTTTCACAACAGGTGAATGG + Intronic
1019859708 7:3646211-3646233 CTGCTTTCACCACATGACAAAGG - Intronic
1021595287 7:22309305-22309327 ATTCTTTCACAACAGGACCAGGG + Intronic
1021782947 7:24123777-24123799 CTCCTTTTATGACAGGAAAATGG - Intergenic
1021835287 7:24666430-24666452 CTCTTTTAACATCTTGACAAAGG - Intronic
1022875812 7:34528306-34528328 CCCCATTAAAAACTGGACAAAGG - Intergenic
1023170924 7:37389721-37389743 CTCCTTTAACCATAGGAAATAGG + Intronic
1024493554 7:50015718-50015740 CCCCATTAACAAAAGGGCAAAGG + Intronic
1025270240 7:57505097-57505119 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1026285982 7:68963173-68963195 ATCCTACAACAAGAGGACAAGGG - Intergenic
1026639019 7:72108222-72108244 GTCCTTTAAGAGCAGGACAGAGG - Intronic
1027672905 7:81124246-81124268 CCCCATTAAAAACTGGACAAAGG - Intergenic
1029648168 7:101871410-101871432 CTCTTCTACCAACAGGACACAGG - Intronic
1030978423 7:116156079-116156101 CTCCTTCAGCATCAGGACCAGGG - Intronic
1031319446 7:120304778-120304800 CTAATTTAACAACAGTGCAATGG - Intronic
1032820005 7:135515595-135515617 CTCCTTTAGTAAAAGGAGAATGG + Intergenic
1033153321 7:138935533-138935555 GTCCTGTAACAACAGGGAAAAGG + Intronic
1035453488 7:158994387-158994409 CTCCATTAAAAAGAGGGCAAAGG + Intergenic
1039725116 8:40207020-40207042 TTCCTTTAAGAACAGAAAAAGGG + Intergenic
1039977870 8:42382617-42382639 CTCCTTTAGCCACAGAACAAAGG + Intergenic
1041146500 8:54881523-54881545 GTCCTTAAACAACAGGGTAATGG + Intergenic
1043754984 8:83992145-83992167 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1044543030 8:93429127-93429149 CAACTTTCACAACAGAACAAGGG + Intergenic
1044616526 8:94148237-94148259 CACCTTTAACAAAACCACAAAGG + Intronic
1045033575 8:98160519-98160541 CTCCCTCAACAAGAGGACAAGGG - Intergenic
1046432271 8:114143526-114143548 CTCCTTTAAAAAGCGGGCAAAGG - Intergenic
1046684744 8:117212628-117212650 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1047075976 8:121403495-121403517 CTGTTTGACCAACAGGACAATGG + Intergenic
1047354918 8:124111406-124111428 TTCCTATAACAAGAGGACAAGGG - Intronic
1048830263 8:138469551-138469573 CACCTATTACAACTGGACAATGG + Intronic
1050678216 9:8080284-8080306 CTCCATCAAAAACTGGACAAAGG - Intergenic
1052338202 9:27340443-27340465 CTCATTTAACCACAGGAGATGGG + Intronic
1052466077 9:28831032-28831054 CTCCCTTAAGAAAAGGAAAATGG + Intergenic
1052583544 9:30393569-30393591 CTCCATTAAAAACTGGGCAAAGG + Intergenic
1055782807 9:79837875-79837897 CTCCTTTAAAAAATGGGCAAAGG - Intergenic
1059881284 9:118692417-118692439 CGCTTTTAACAACAGGGAAAAGG + Intergenic
1060318827 9:122536301-122536323 CACCTTTAAAAACAGTTCAATGG + Intergenic
1060419158 9:123455167-123455189 CTCCTTTAAGAACAGGACATGGG - Intronic
1061201901 9:129142854-129142876 CTCCTTTATCAAGTGGCCAAAGG + Intronic
1189553968 X:42123008-42123030 CCCAGTTAACAATAGGACAATGG + Intergenic
1190238670 X:48639271-48639293 CTCCTTTAAGATCAGGAACAAGG + Intergenic
1190616190 X:52235312-52235334 CTCCATTAAAAAGTGGACAAAGG - Intergenic
1190975366 X:55394890-55394912 TTCCTTTCACAATAGGAAAATGG + Intergenic
1193017629 X:76753708-76753730 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1193576479 X:83204066-83204088 CTACTTAAACAACAGAAGAAAGG - Intergenic
1193609308 X:83609791-83609813 CTCCATTAAAAACTGGCCAAAGG - Intergenic
1193611255 X:83633945-83633967 CCCCATTAAAAAGAGGACAAAGG - Intergenic
1194238384 X:91413129-91413151 CTCCATTAAAAAGTGGACAAAGG + Intergenic
1194314729 X:92362450-92362472 CTCCTTTAAAAAATGGGCAAAGG - Intronic
1195354221 X:104023102-104023124 CTCCATCAATAAGAGGACAAAGG - Intergenic
1195518958 X:105809615-105809637 CTCCATCAACAAGTGGACAAAGG - Intergenic
1199857123 X:151768535-151768557 CTCTATTCACAAGAGGACAATGG - Intergenic
1200622785 Y:5473967-5473989 CTCCTTTAAAAAATGGGCAAAGG - Intronic
1200903705 Y:8459816-8459838 CTTCTTTGGCAATAGGACAAAGG + Intergenic
1201685209 Y:16693738-16693760 CTCCTCTAACCAGAGGTCAAAGG - Intergenic