ID: 1090279115

View in Genome Browser
Species Human (GRCh38)
Location 11:125441115-125441137
Sequence CATGAAGGAGACGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090279107_1090279115 30 Left 1090279107 11:125441062-125441084 CCTCTTCATGCTATTCAAGTAGC No data
Right 1090279115 11:125441115-125441137 CATGAAGGAGACGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090279115 Original CRISPR CATGAAGGAGACGCTGCTGC TGG Intergenic
No off target data available for this crispr