ID: 1090279387

View in Genome Browser
Species Human (GRCh38)
Location 11:125443029-125443051
Sequence GAAAACTCCACCACAGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090279387_1090279391 1 Left 1090279387 11:125443029-125443051 CCCGGCCCTGTGGTGGAGTTTTC No data
Right 1090279391 11:125443053-125443075 TACCAGAACTTGACCAGACTAGG No data
1090279387_1090279395 26 Left 1090279387 11:125443029-125443051 CCCGGCCCTGTGGTGGAGTTTTC No data
Right 1090279395 11:125443078-125443100 TAGCAAAATCCTTTAATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090279387 Original CRISPR GAAAACTCCACCACAGGGCC GGG (reversed) Intergenic
No off target data available for this crispr