ID: 1090283226

View in Genome Browser
Species Human (GRCh38)
Location 11:125476126-125476148
Sequence GTGGTTGCCCAGAGATTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 319}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090283226 Original CRISPR GTGGTTGCCCAGAGATTGGG CGG Intronic
900934640 1:5757379-5757401 GTGGGTGCCCAGAGATGGTGGGG - Intergenic
901386892 1:8916261-8916283 GTGGTTGTCAAGGGATGGGGAGG + Intergenic
901475961 1:9489493-9489515 GTGGTTGCCCAGGGCTGGGGAGG - Intergenic
902972649 1:20065433-20065455 GTGGTTGCCAGGGGTTTGGGAGG - Intronic
903567993 1:24283517-24283539 GTGGTTACCCAGAGACAGGTGGG + Intergenic
904985385 1:34543649-34543671 GTGGTTTCCAGGAGTTTGGGAGG + Intergenic
906911041 1:49951058-49951080 GTGGTTGCCAGGGGATGGGGGGG + Intronic
908507182 1:64816307-64816329 TTGCTTGCCCAGAGATATGGTGG + Intronic
909251614 1:73364145-73364167 GTGGTTGCCCTGAGGATGAGGGG - Intergenic
909775262 1:79477584-79477606 GAGGTAGCTGAGAGATTGGGAGG - Intergenic
910616044 1:89199322-89199344 GTTGTTGCCCAGAGGTGCGGTGG + Intergenic
910716650 1:90238259-90238281 GTGGTTACCAAGAGCCTGGGAGG - Intergenic
913058964 1:115187416-115187438 GTGGTGGCCCAGAGAGGTGGTGG - Intergenic
914940071 1:152014727-152014749 GTGGCAGCCCAGAGGATGGGAGG + Intergenic
915219883 1:154366253-154366275 GTGGTTGCCGAGATCTGGGGCGG - Intergenic
915219971 1:154366911-154366933 GCGGTTGCCCAGATCTGGGGTGG + Intergenic
916212876 1:162372887-162372909 GTCGTTCCCCACAGAGTGGGAGG - Intronic
917931291 1:179824472-179824494 GTGGATGGCCAGAGGCTGGGTGG + Intergenic
918016070 1:180633124-180633146 GTGTTAGCACAGAAATTGGGAGG - Intronic
918667425 1:187168877-187168899 ATGGTTGCCAGGAGATTGGGTGG - Intergenic
919920349 1:202163449-202163471 GTGTGTGGCCAGAGCTTGGGAGG - Intergenic
922157654 1:223052650-223052672 GTGGTGCCCCAGAGAGTGGCCGG - Intergenic
923104210 1:230842108-230842130 GTGGTTGCCAGGAGCTTGCGGGG + Intronic
924006942 1:239622984-239623006 GTGGTTGCCAAAAGCTGGGGAGG - Intronic
1063392040 10:5656189-5656211 GTGGTTGCTCAGTGAGTGAGTGG + Intronic
1064124210 10:12645450-12645472 CTGGTCTCCCAGAGATAGGGTGG + Intronic
1064465674 10:15578188-15578210 GTGGTTGCCAAGAGATATGGAGG - Intronic
1064780844 10:18836390-18836412 GTGCATGCACAGAGACTGGGGGG - Intergenic
1067053034 10:43035971-43035993 GTGGTTGCCTAGGGATGGGGCGG + Intergenic
1067411378 10:46067666-46067688 GTGGTTGCCTAGGGCTGGGGAGG + Intergenic
1067559771 10:47296758-47296780 GTTCTTGTCCAAAGATTGGGAGG - Intergenic
1069549455 10:69352696-69352718 GTGGTTGCTGGGAGATAGGGAGG + Intronic
1071385551 10:85116626-85116648 GTGGTTGCCTGGGGATGGGGAGG - Intergenic
1071826211 10:89328829-89328851 GTGGTTGCCTGGAGATGGTGGGG + Intronic
1071919476 10:90333108-90333130 GTGGTTGCCAGGGGCTTGGGTGG - Intergenic
1072681083 10:97507302-97507324 CTGTTTTCCCAGAGATTTGGAGG - Intronic
1072847023 10:98842867-98842889 GTGGTTGCCAAGGGTTAGGGTGG - Intronic
1073008699 10:100343553-100343575 GTGGTTGCCCAGGGCTTGGAAGG - Intergenic
1073144216 10:101269323-101269345 GTGGTTGCCAGGAGCTGGGGTGG + Intergenic
1073713067 10:106067908-106067930 GTGGCTTACCAGAGACTGGGTGG + Intergenic
1074135957 10:110626564-110626586 GTGTCTACTCAGAGATTGGGTGG - Intergenic
1074273643 10:111980041-111980063 GTGGTTGCCTAGGGGATGGGAGG - Intergenic
1074629585 10:115236913-115236935 GTGGTTGCCAAGAGTTTGGAGGG - Intronic
1074912665 10:117925601-117925623 CTGGTGGCCCAGAGAGTGGGAGG - Intergenic
1075297228 10:121288425-121288447 GTGCTTGCCCAGATATAGTGGGG + Intergenic
1075827465 10:125371284-125371306 GTGGTTGCCTAGGGCTGGGGAGG - Intergenic
1076435218 10:130436262-130436284 GTGGTTGCCAGGAGTTGGGGAGG - Intergenic
1076684237 10:132189897-132189919 GTCGGTGCCCAGAGCTTGGCAGG - Intronic
1077406634 11:2385348-2385370 GTGGTTGCCCTGGGACGGGGAGG - Intronic
1079520646 11:21322381-21322403 GTGTATGCCCTGAGATTGGAGGG + Intronic
1080294655 11:30712973-30712995 ATGGTGGCATAGAGATTGGGAGG + Intergenic
1080700937 11:34643538-34643560 GTTGGTGACCAGAGCTTGGGAGG + Intronic
1081311962 11:41585361-41585383 GTGGTTTCCCAGTGATTGGATGG + Intergenic
1081707800 11:45195388-45195410 GTGGTTGCCTAGGGATGGGTGGG - Intronic
1082749046 11:56998392-56998414 GTGATTGCCCAGAGACAGGCTGG + Intergenic
1083155808 11:60822138-60822160 GTGGTGGCCCAGAGACAGAGAGG + Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1083417161 11:62533279-62533301 GTGATGGCCCAGTGATTTGGGGG + Exonic
1084281601 11:68099147-68099169 GTGGTTGCCAGGAGCTGGGGTGG + Intronic
1084645951 11:70457959-70457981 GTGGTTGCCAGGAGTGTGGGTGG - Intergenic
1086187321 11:84034132-84034154 GTGGTTGCTGAAAGATGGGGTGG - Intronic
1089558478 11:119329999-119330021 GTGGTTGCCAGGAGTCTGGGGGG + Intergenic
1089771055 11:120803297-120803319 GAGGTTACCCAGAGAGTGAGTGG - Intronic
1090283226 11:125476126-125476148 GTGGTTGCCCAGAGATTGGGCGG + Intronic
1090739882 11:129649529-129649551 GTGGTTGCCAAGGGTTAGGGTGG + Intergenic
1090778760 11:129988187-129988209 GTGGTTGCCTAGGGATTAGGAGG + Intronic
1091529386 12:1339775-1339797 GTGGTTGCTCAGGGTTGGGGAGG + Intronic
1092262776 12:6961334-6961356 TTGCTTGCCCAGTGAGTGGGCGG + Intergenic
1092996893 12:13959286-13959308 GTGAACGCCCAGAGACTGGGAGG + Intronic
1094774172 12:33703683-33703705 GTGGTTGCCCAGATATGTGCAGG + Intergenic
1095109676 12:38279263-38279285 GTGGTTGCCCACAGGTTGAAGGG - Intergenic
1095158661 12:38889690-38889712 AAGGTTGGCCAGAGATTGTGAGG + Intronic
1097140987 12:56902464-56902486 ATGGTAGACCAGAGATTGGGTGG + Intergenic
1097829283 12:64206867-64206889 GTGGTTGCCCAGGGCTGGGAGGG + Intronic
1098335453 12:69399952-69399974 GTGGTTGCCAGGAGATGGGTGGG + Intergenic
1098346468 12:69509603-69509625 ATGGTTGCCAAGAGCTAGGGAGG - Intronic
1099189416 12:79547325-79547347 GTTTTGGCCCAGAGATGGGGCGG - Intergenic
1099787524 12:87285204-87285226 GTTTTTGGCCAGATATTGGGGGG + Intergenic
1101072040 12:101086122-101086144 GTGTTCGGCAAGAGATTGGGTGG + Intronic
1102581054 12:113888097-113888119 ATGGTTGGCCAGGGAGTGGGAGG - Intronic
1103137681 12:118521798-118521820 GTGGTTGCTCAGTGACTGGCCGG + Intergenic
1103149222 12:118622588-118622610 GTAGTGGCCCAGAGTGTGGGAGG - Intergenic
1104100853 12:125607770-125607792 GTGGTTGCCTAGAGCTGGGAAGG - Intronic
1105732599 13:23233500-23233522 GTGGTTGCCAGGTGGTTGGGTGG + Intronic
1107753406 13:43593655-43593677 GTGTGTGTACAGAGATTGGGTGG - Intronic
1108295142 13:49009143-49009165 GTGGTTGCCAAGGATTTGGGGGG - Intronic
1109299918 13:60580332-60580354 GTGGTTGTCTAAAGATGGGGAGG + Intergenic
1112681403 13:101769783-101769805 GTGGTTGCCAGGAAATGGGGTGG + Intronic
1112836695 13:103523532-103523554 GTGGTTGCTGAAAGTTTGGGTGG - Intergenic
1114048974 14:18903888-18903910 GTGGTTGCCCAGGGTTGGAGAGG + Intergenic
1114113589 14:19498045-19498067 GTGGTTGCCCAGGGTTGGAGAGG - Intergenic
1114400887 14:22409387-22409409 GTGATGGCCTAGAGATGGGGAGG + Intergenic
1115011215 14:28547402-28547424 ATGGTTGCCAATAGTTTGGGAGG - Intergenic
1115150441 14:30278243-30278265 GTGGTTGCTTAGAGGTCGGGGGG - Intergenic
1115174325 14:30544944-30544966 GTGGTTGCCCGGGGATTGGGTGG - Intergenic
1119188221 14:72660028-72660050 GTGGTTGCCAGGAGCTGGGGAGG + Intronic
1119425356 14:74531508-74531530 GGGGGTGCCCAGAGAGTGAGGGG - Intronic
1119757941 14:77131968-77131990 GTTCTTGAGCAGAGATTGGGAGG - Exonic
1119801595 14:77450138-77450160 GTGGTTACCAAGAGCTGGGGTGG - Intronic
1122002509 14:98671926-98671948 GTGGTTGCCCAGGGGTCGGGAGG - Intergenic
1122159276 14:99771247-99771269 ATGGTTGCCCAGAGACTGAGGGG - Intronic
1122619097 14:103043495-103043517 GTGGTTGCTCAGGGCTGGGGTGG + Intronic
1122739513 14:103863628-103863650 GTGGTTGCCCGAAGTTGGGGAGG - Intergenic
1122834741 14:104425188-104425210 GGGGATGCCCAGGGAGTGGGGGG - Intergenic
1124099179 15:26677555-26677577 CTGGATCCCCAGAAATTGGGTGG - Intronic
1124232754 15:27959718-27959740 GTAGTCGCACAGAGACTGGGAGG - Intronic
1124818103 15:33017151-33017173 GTGGTTGCCAAGGCCTTGGGAGG + Intronic
1126795546 15:52257977-52257999 TTGGTGGCTCAGAGATTCGGAGG + Intronic
1127114362 15:55709835-55709857 GTGGTTGCCTGGCGATGGGGAGG + Intronic
1127992359 15:64129928-64129950 GTGGGTACCCAGACATTGAGTGG + Exonic
1128007194 15:64254207-64254229 GTGGTTGCCAAGGGGTTGGGGGG + Intronic
1128723028 15:69966165-69966187 GTGGTTGCCAGGAGTTGGGGTGG + Intergenic
1130807448 15:87340915-87340937 GTGTTTGCCAAGACATCGGGTGG + Intergenic
1131223353 15:90603734-90603756 GTATTTGCCCAGAGAATGGATGG - Intronic
1132544055 16:524940-524962 GTGGTGGCCCAGAGAAAGGCGGG + Intergenic
1133735754 16:8614359-8614381 GTGGTAGCCAGGAGATGGGGAGG + Intergenic
1134286428 16:12865955-12865977 CTGGTTCCCCTGTGATTGGGTGG - Intergenic
1134676232 16:16092398-16092420 GTGGTTGCCTAGGGCTTCGGAGG - Intronic
1134765678 16:16755667-16755689 GTGGTTGCCTGGAGTTGGGGTGG - Intergenic
1136118757 16:28114660-28114682 GTGGTTGCTCAAAGTTGGGGTGG + Intronic
1136664322 16:31795041-31795063 GTGGTTGCTTAGAGATGGGTTGG - Intergenic
1137688208 16:50401680-50401702 GGGGTGGCCCAGAGACTGGTTGG + Intergenic
1138214971 16:55196296-55196318 GTGGTTGCACAGAGCTTGGAGGG + Intergenic
1141303436 16:82838948-82838970 GTAGCTGCCCAGAGACTGGATGG - Intronic
1141945171 16:87304693-87304715 GTGACTGCCCAGGGAGTGGGAGG + Intronic
1141994820 16:87629666-87629688 TTGGTTGCCCAGGGTTGGGGGGG + Intronic
1143314907 17:6025199-6025221 GCGGTTGCCCAGGGAGTGCGTGG + Intronic
1144068492 17:11645727-11645749 GAGGATGGCCAGAGGTTGGGTGG - Intronic
1144391542 17:14798185-14798207 GTGGATGCATAGATATTGGGTGG + Intergenic
1144611528 17:16722689-16722711 GTGGTTGCCAAGAGTTGGGGAGG - Intronic
1144901212 17:18592661-18592683 GTGGTTGCCAAGAGTTGGGGAGG + Intergenic
1144941415 17:18944462-18944484 GTGGTTGCCAAGGGTTAGGGAGG + Intergenic
1145131294 17:20353436-20353458 GTGGTTGCCAAGAGTTGGGGAGG - Intergenic
1146698803 17:34935225-34935247 GTGGTTACCCAGGGCTGGGGAGG + Intronic
1146808479 17:35884559-35884581 GTGGTGGGACAGAGGTTGGGTGG + Intergenic
1147204855 17:38829708-38829730 GTGGTTGCCTAGAGATGGGTAGG + Intergenic
1147992376 17:44342718-44342740 GTGGTTGCCTAGGGTTAGGGAGG + Intergenic
1148185458 17:45640221-45640243 GTGGTTGCCCAGTGCTGCGGAGG - Intergenic
1148504944 17:48119926-48119948 GTGGTTGCCAGGAGCTGGGGGGG - Intronic
1148618252 17:49015635-49015657 GTGGAAGCACAGAGAATGGGGGG - Intronic
1148993408 17:51685961-51685983 GGGGTGCCCCAGGGATTGGGGGG + Intronic
1149373524 17:56020616-56020638 GTTGTGGGCCAGAGATTGTGGGG - Intergenic
1150035582 17:61792643-61792665 GTGGTTGCCAAGGGTTTGGTGGG + Intronic
1150355502 17:64481134-64481156 GTGGTTGTCCTAAGAGTGGGAGG - Intronic
1150381247 17:64721770-64721792 GTGGTTGCCTAGGGCTGGGGAGG + Intergenic
1150530260 17:65973704-65973726 GTGGTTGCCTGGATATGGGGAGG + Intronic
1151117025 17:71748189-71748211 GTGGTTGCCAGGGGATGGGGAGG - Intergenic
1151250038 17:72827315-72827337 GTGGTTGCCTAGGGTTTGTGGGG + Intronic
1152363635 17:79843499-79843521 GTGGCTGCCCTGACGTTGGGAGG - Intergenic
1152557557 17:81061434-81061456 GTGGTTGCCTGGAGATGGGGAGG - Intronic
1153871159 18:9321641-9321663 GGGGTTGCCCAGGGATGTGGGGG - Intergenic
1154052796 18:10977895-10977917 GTGGTTGCCTAGAGATGGCTGGG + Intronic
1155636671 18:27964189-27964211 GTGGTAGACCAGAGAGAGGGTGG + Intronic
1156629255 18:38947139-38947161 GTGGTTGCCCAAGGTTAGGGTGG - Intergenic
1157769074 18:50328686-50328708 GTGGTTGCCCAGAGCCAAGGAGG - Intergenic
1158027652 18:52920999-52921021 GTGGTTGCCTGGAGTTTGGTAGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1160512707 18:79461397-79461419 GTGGGTCCCCAGGGCTTGGGAGG + Intronic
1161300264 19:3539091-3539113 GTGGTTGCCGAGACACTGGGTGG + Intronic
1161977995 19:7616660-7616682 GTGGCTTCCCAGAGCCTGGGAGG + Intronic
1163009338 19:14415136-14415158 GTGGTTGCCCGGGGCTGGGGTGG - Intronic
1163534770 19:17870884-17870906 GTGATTGCCCAGAAAGTTGGAGG + Intergenic
1167371596 19:49085778-49085800 GTGGGTGCCCAGAGATTTCGGGG - Intronic
1167677673 19:50897576-50897598 GTTGCTGCCCAGAGATTCTGTGG - Intergenic
1168137394 19:54360611-54360633 GTGGGTTCCCAGAGATTAGGGGG - Intronic
1168160683 19:54508471-54508493 GTGGGTTCCCAGAGATTAGGGGG + Intronic
1168392460 19:56021490-56021512 GTGGTTGTCCAGAGTTTTGAGGG - Intronic
1168589746 19:57623089-57623111 GTGGTTGCCTAGGGATTCTGGGG - Exonic
925138148 2:1533873-1533895 GAGGTTGCACACAGAGTGGGGGG - Intronic
926186132 2:10692301-10692323 GTGGTTGTCTAGGGCTTGGGTGG - Intergenic
927820481 2:26259744-26259766 GAGGTTGCCCAGAGGTTTAGAGG + Intronic
929382055 2:41365111-41365133 GTGGTTGCTCAGAGGAGGGGAGG - Intergenic
931503284 2:62895124-62895146 GTGGTTGCCCAGGGGTAGGGAGG + Intronic
931779531 2:65567259-65567281 GTGGTTGCCCAGGAATAGTGAGG + Intergenic
932094324 2:68833847-68833869 GGGGTGGCCCAGAGGTTAGGAGG - Intergenic
934061882 2:88302333-88302355 GTGGTTGCCAAAGGATGGGGTGG - Intergenic
934099730 2:88641328-88641350 GTGGTTGCTCAGGGCTGGGGAGG - Intergenic
934733481 2:96674183-96674205 GTGGTTGCCTAGGGCTGGGGAGG - Intergenic
934761564 2:96859621-96859643 GTGGCTGCCCTGGGATTGTGGGG + Intergenic
934868544 2:97837891-97837913 GTGGTTGCCTAGAAATAGGAAGG - Intronic
934948505 2:98559769-98559791 GTGGTTGACCTGAGGTAGGGAGG + Intronic
934957428 2:98634380-98634402 GTGGCTGCCCGGAGAGTGTGGGG + Intronic
936727599 2:115339788-115339810 TTGGTTGCCAAGGGATTGGGTGG + Intronic
937011258 2:118564902-118564924 ATGGCTGCCCAGGGATGGGGAGG - Intergenic
937954542 2:127414627-127414649 GTGGTTGCCAAGAGTTGGGGTGG + Intergenic
938106303 2:128532938-128532960 GTGGTTGCCTTGGGACTGGGAGG + Intergenic
939587127 2:144019389-144019411 GTGGTTGAGCAGAGAGGGGGAGG + Intronic
939885821 2:147680791-147680813 GAGGTTGTCTAGAGATTGGGCGG + Intergenic
942381317 2:175394244-175394266 GTGGTGGGCCAGAGACTAGGAGG - Intergenic
943202547 2:184847645-184847667 GTTGGTGTCCAGAGATTTGGAGG - Intronic
943637632 2:190323892-190323914 GTGGATCACCTGAGATTGGGAGG - Intronic
944158414 2:196633704-196633726 GTGTGTGCCCTGAGATAGGGTGG + Intergenic
945294641 2:208158632-208158654 GTGGTTGCCTAGCGCTAGGGTGG - Intergenic
945787795 2:214264791-214264813 GTGATTGCCAAGAGTTTAGGAGG - Intronic
946387828 2:219396112-219396134 GTGGTTGCTCAGGGCTAGGGAGG + Intronic
946943879 2:224799177-224799199 GTGGTTGCCTAGGGATGTGGAGG - Intronic
947631931 2:231659399-231659421 GTGGTTGCCAAGAGCTGGGAGGG + Intergenic
947977506 2:234379710-234379732 GTTGTGGCCAAGACATTGGGGGG - Intergenic
1169164512 20:3410475-3410497 GTGGTTGCCTAGGGCTGGGGTGG - Intergenic
1169369958 20:5021054-5021076 GTAGCTGCCCAGAGCCTGGGAGG + Intergenic
1170024319 20:11872586-11872608 GTGGTTGTCAAAAGAATGGGAGG - Intergenic
1170394272 20:15909064-15909086 GGGGTGGCTCAGAAATTGGGAGG + Intronic
1170914704 20:20611328-20611350 TTGTTTGCCCAGAGCTTGGCAGG - Exonic
1171062569 20:21980733-21980755 GTGATTTCTCAGAGATTGAGGGG - Intergenic
1172481349 20:35273718-35273740 GTGGTTGCCCAGGGAGTGATTGG + Intronic
1172606439 20:36217333-36217355 GAGGTGGCCCAGAGAGCGGGTGG + Intronic
1173234378 20:41231033-41231055 GTGGTTGCCAGGAGTTAGGGAGG - Intronic
1174220521 20:48950995-48951017 GTGGTTGTCTAGAGTTAGGGGGG - Intronic
1174333044 20:49836090-49836112 ATGGTTGCCCAGGGACAGGGAGG - Intronic
1174461650 20:50687280-50687302 GTGGATGCAGAGAGATCGGGTGG - Intronic
1175255420 20:57643374-57643396 ATGGTTGCCAGGGGATTGGGGGG + Intergenic
1175965841 20:62659864-62659886 CTGGATGCCCAGAGCTTGGATGG + Intronic
1175992616 20:62796995-62797017 GTGGCTGCGGAGAGATGGGGAGG - Intronic
1176001898 20:62836007-62836029 CTGGTTGCCCAGAGGTGGGCAGG - Intronic
1177826719 21:26092496-26092518 GTGGTTGCCACGGGTTTGGGTGG + Intronic
1178158960 21:29888520-29888542 GTGGTTCCCAACAGTTTGGGAGG - Intronic
1178228237 21:30749981-30750003 GTGGTTGCCAAGGGGTTGGGAGG - Intergenic
1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG + Intronic
1179466124 21:41574605-41574627 GTGGTTGCCAAGAGTTAGTGGGG - Intergenic
1180321142 22:11322514-11322536 GTGGTTTCCCAGAGCCTGTGTGG + Intergenic
1180333901 22:11558231-11558253 GTGGTTTCCCAGAGCCTGTGTGG - Intergenic
1181266292 22:21632861-21632883 CAGGTTGCCCAGGGTTTGGGAGG + Intronic
1181411532 22:22725027-22725049 GGGGTTGCTCAGAGACTGTGAGG + Intergenic
1181666290 22:24400240-24400262 GTGGTTGCCAAGTGCTAGGGAGG - Intronic
1181836868 22:25617603-25617625 GTGGCTGCCCAGGGCTGGGGTGG - Intronic
1183471535 22:38009682-38009704 GTGGTTGCCTAGGGAGAGGGTGG - Intronic
1183497079 22:38152991-38153013 GGTGTTGCCCAGGGATGGGGTGG + Intronic
1183683179 22:39346562-39346584 GTGGTTGCCAGGGGATTGGTGGG - Intergenic
1184606469 22:45577326-45577348 GGGGTCACCCAGAGAGTGGGTGG - Intronic
1185163967 22:49246522-49246544 GTGGCTGCCCAGAAATGGGAAGG - Intergenic
949277587 3:2303380-2303402 GTGGTTGTCCAGAGCTGGGTTGG - Intronic
949447894 3:4154804-4154826 GTGGTTGCCCAGATATTGGCTGG - Intronic
950474869 3:13208870-13208892 GGGGTTGCCCCGGGATGGGGAGG + Intergenic
953367381 3:42357456-42357478 GTGGTTGCCAAAAGTTGGGGTGG - Intergenic
953569425 3:44059277-44059299 GTGAATGCCTAGAGATTTGGTGG + Intergenic
953813769 3:46136139-46136161 GTGATTGCCTAGGGCTTGGGTGG - Intergenic
956007947 3:64800459-64800481 GTGGTTCCCCAGGGGATGGGAGG - Intergenic
957807112 3:85162075-85162097 TTGGTTGCCCAGATATTGATTGG + Intronic
957857886 3:85901809-85901831 GTGGTTGCTTAGAGTTAGGGTGG - Intronic
962032785 3:131619022-131619044 GTTGTTGCCCATAGAGTAGGAGG + Intronic
962111859 3:132459399-132459421 GTGGTTGCCAGGGGCTTGGGAGG + Intronic
962570465 3:136708438-136708460 GTGATTGCCAGGAGACTGGGGGG + Intronic
962768377 3:138589041-138589063 GTGGTTGCTGAGAGAATTGGAGG + Intronic
962878145 3:139551871-139551893 GTGGTTGCCCAGACATCCAGAGG - Intergenic
963599835 3:147369184-147369206 GTGCTGCCCCAGAAATTGGGCGG - Intergenic
963817231 3:149844973-149844995 GTGGTTGCCTAGGGATTGGCAGG - Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
967533872 3:190579745-190579767 CTGGTTGCCTAGGGCTTGGGTGG - Intronic
970716231 4:18928285-18928307 GTGGTTTCCTGGAGATGGGGTGG + Intergenic
970839216 4:20447206-20447228 GTTGTTGCCAAGAGATTTAGGGG - Intronic
970880723 4:20926350-20926372 GTTTTTGCCCAGAGAAGGGGAGG - Intronic
971565259 4:28131091-28131113 GTGGTTGCCTAGGGTTTGCGGGG + Intergenic
972601984 4:40581042-40581064 GTGGGAGCACAGAGGTTGGGAGG + Intronic
973632987 4:52836783-52836805 ATGGTTGTCCAGAGAATTGGTGG + Intergenic
974763984 4:66316339-66316361 TAGGTTGCCCAGAGGTGGGGCGG + Intergenic
976390116 4:84498028-84498050 GTGGGTGCCCAGAGGCGGGGAGG + Exonic
976614826 4:87065805-87065827 GAGGTTGCACAGAGAAAGGGGGG - Intronic
976989370 4:91345851-91345873 GTGGTTGCCAGGAGTTTGTGGGG - Intronic
977619441 4:99119956-99119978 GTGATTGCTCAGAGGGTGGGGGG + Intergenic
977696143 4:99968733-99968755 GTGGTTGAAGAGAGATTTGGAGG - Intergenic
978244469 4:106556404-106556426 GTGCTTGCCCAGAGAGAGTGAGG - Intergenic
978903852 4:113983615-113983637 CTGGATGCCCAGAGGTTGGAGGG + Intergenic
979996903 4:127442183-127442205 GTGGTTGCCAGGGGATTGGTGGG + Intergenic
983603290 4:169554641-169554663 GTGGTTGCCAAGAGTTGGGAGGG + Intronic
984142134 4:176016316-176016338 GTGGTTGCCAAGAGTTAGTGGGG - Intergenic
985554533 5:551222-551244 GTGGCTGCCCGGGGGTTGGGAGG + Intergenic
987085561 5:14464259-14464281 GTGGTTGTCCAAACATTGAGGGG + Intronic
987119997 5:14758250-14758272 GAGGTTGCCCAGAGCTGGGGAGG + Intronic
987825056 5:23020556-23020578 GGGGTGGCTCAGAGATTGGCAGG + Intergenic
991249317 5:64542441-64542463 ATGGCTGGCTAGAGATTGGGAGG - Intronic
991405426 5:66296494-66296516 GTGGTTGCCAGGAGTTGGGGAGG - Intergenic
991907607 5:71527440-71527462 GTGGTTGCCAAAAGGTTAGGGGG - Intronic
991968551 5:72115537-72115559 GTGGATGCCCACAAAATGGGAGG - Intronic
994255462 5:97588804-97588826 GTGGTTACCCAGAGGCTAGGGGG - Intergenic
995637613 5:114212369-114212391 GTGGTTGCCTAGGGGTTGGGTGG + Intergenic
997063730 5:130538447-130538469 GTGGTTACCAGGAGTTTGGGTGG + Intergenic
997117627 5:131142472-131142494 GTGGTTGCCAAGAGTTAGTGGGG + Intergenic
999650954 5:153767003-153767025 GTGGTTGCCTAGAGATTCTGAGG + Intronic
999738266 5:154529291-154529313 GTGGTTGCCTAGGGCTGGGGAGG - Intergenic
1000307925 5:160012916-160012938 GTGGTTAACCAGAGACTGGCAGG - Intronic
1001271792 5:170318153-170318175 GTGGTTGCCAGGAGCTGGGGAGG + Intergenic
1001632925 5:173189932-173189954 GTGATTGCCGAGGGATGGGGTGG - Intergenic
1002444569 5:179281355-179281377 GTGGTTGCCCAGGGCTGGGTTGG - Intronic
1003361348 6:5429054-5429076 GTGGTTGCCTACAGATGTGGGGG + Intronic
1004067457 6:12262645-12262667 GTGGATCACCAGAGATTAGGAGG + Intergenic
1005401937 6:25443773-25443795 GTGGTTGCTAAGAGTTGGGGTGG + Intronic
1005806587 6:29478989-29479011 GTGGTTGCCAAGAGCTGGGAGGG - Intergenic
1007456739 6:41983959-41983981 GTGGTTGCCAGGGGATTGGTGGG - Intronic
1009323563 6:62321414-62321436 CTGGTTGCCTGGGGATTGGGAGG + Intergenic
1010649122 6:78430142-78430164 GTAGTTGCCAAGAGATTAGAGGG - Intergenic
1012122947 6:95389678-95389700 GTGGTTGCCAAGAGTTGGAGGGG - Intergenic
1013523593 6:110954736-110954758 GTGGTTGCCAGGGGCTTGGGAGG - Intergenic
1015455822 6:133424959-133424981 ATGGTTGCCAAGAGATTGGAGGG - Intronic
1015579651 6:134709970-134709992 GTGGTTGCCAAGAGTTGGAGAGG + Intergenic
1015579712 6:134710531-134710553 GTGGTTGCCAAGAGTTGGAGAGG - Intergenic
1016276001 6:142353185-142353207 GTGGGAGCCCATAGCTTGGGTGG - Intronic
1016734783 6:147466103-147466125 GTGGTTGCCAAGAGTTAGTGGGG + Intergenic
1016749608 6:147618410-147618432 GCAGATTCCCAGAGATTGGGAGG + Intronic
1017235358 6:152112618-152112640 GTGGTTTCCCAGAGCTCGGTGGG - Intronic
1017361993 6:153584520-153584542 ATGGTTGCCCAGTGATTTAGAGG - Intergenic
1020029242 7:4921163-4921185 GTGGTGGCCCAGAGAGGGGCTGG - Intronic
1020720802 7:11742671-11742693 GTGATTGCCAAGAGACTGGGAGG + Intronic
1021658016 7:22891022-22891044 GTGGCTGCCCCGAGATGGGGTGG - Intergenic
1021765169 7:23941702-23941724 CTTGTTGCCTAGAGATTAGGAGG + Intergenic
1023263385 7:38380316-38380338 GTGTTTGACCTGAGATCGGGGGG + Intergenic
1023928367 7:44687928-44687950 GTGGTTGCTTAGGGCTTGGGAGG - Intronic
1025960243 7:66214196-66214218 GTGGTTGCCTAGGGATGGAGAGG - Intronic
1026252650 7:68684373-68684395 GTGGCTGCTCAGAGTTGGGGTGG - Intergenic
1026812073 7:73476135-73476157 GTGGTTGCTCAGGGCTGGGGAGG + Intronic
1026887915 7:73965221-73965243 GAGGCTGCCCAGAGATTAGGAGG + Intergenic
1028638913 7:93021647-93021669 GTGCTTACCCTGAGATGGGGTGG + Intergenic
1030707540 7:112709953-112709975 TGAGTTGCCCAGAGATTTGGGGG - Intergenic
1032575929 7:133054691-133054713 GTGGTTGCCTAGGGCTGGGGTGG - Intronic
1032577569 7:133071918-133071940 GTAGTTGCCTAGAGCTGGGGTGG + Intronic
1034146005 7:148872312-148872334 GTGGCTGCCAAGAATTTGGGGGG + Intronic
1035301467 7:157900364-157900386 GTGGTTGCCAAGAGGTTGTCTGG + Intronic
1037725023 8:21476157-21476179 GTGGTTGCTGAGAGTTTGTGGGG + Intergenic
1038033629 8:23666556-23666578 GTGGTTGCCCGCAATTTGGGGGG - Intergenic
1038108055 8:24459543-24459565 GAGGATGCCTAGAGACTGGGAGG - Intronic
1039886474 8:41656821-41656843 GTGGTTCCCCAGGGATGGGAGGG + Intronic
1039983645 8:42429667-42429689 GTGGTTGCTGAGAGCTGGGGTGG + Intronic
1043179593 8:77070375-77070397 GTGGTTTACCAGAGACTGAGAGG - Intergenic
1044682374 8:94794893-94794915 GTGGTTGCCTAGGGCTAGGGAGG - Intergenic
1044917640 8:97132458-97132480 CTGGTTGCCAAAAGAATGGGAGG + Intronic
1046895153 8:119463910-119463932 GTGGTTGCTCAGGGCTGGGGAGG - Intergenic
1048830872 8:138476189-138476211 GTGGTTGCCAAGGGTCTGGGGGG + Intronic
1048968362 8:139630039-139630061 GTGGTTGCCTAGGGGTTGCGGGG + Intronic
1049179247 8:141212664-141212686 GTGGTTGCCAAGAGACTCGGTGG - Intronic
1049314575 8:141956557-141956579 GTGTTTGGCCAGAGCGTGGGAGG - Intergenic
1049389033 8:142358781-142358803 GTGGTCTCCCAGCGATGGGGGGG - Intronic
1049578794 8:143401529-143401551 GAGGCGGCCCAGAGATGGGGAGG + Intergenic
1049703579 8:144026104-144026126 GTGGTTGCTTAGAGCTGGGGAGG - Intronic
1050318017 9:4423116-4423138 GGAGTTGCCCAGAGGTAGGGAGG - Intergenic
1051817819 9:21130492-21130514 GTGGTGGCCTAAAGATGGGGAGG + Intergenic
1053466177 9:38310327-38310349 GTGCTTACCCAGTCATTGGGAGG - Intergenic
1055963811 9:81845652-81845674 GTGGATCACCAGAGATAGGGAGG - Intergenic
1056772469 9:89489511-89489533 GTGGTTGCCAGGAGCTGGGGAGG - Intronic
1058884208 9:109311015-109311037 GTGGTTGCCCGGGGTTTGGGGGG + Intronic
1059804945 9:117788722-117788744 GTGTTTGCCAAGATATTGGAAGG + Intergenic
1060059944 9:120450333-120450355 GTGGTTGCCTAGGGCTGGGGTGG + Intronic
1060472682 9:123961605-123961627 GTGGGTGACCAGGGATTTGGGGG + Intergenic
1060629872 9:125146105-125146127 GTGGGTGCCTAGGGATTGAGTGG + Intergenic
1060975215 9:127761270-127761292 GTAGGTGCACAAAGATTGGGTGG + Intronic
1061741969 9:132713729-132713751 GTGGTTGCCAGGAGACTGGGTGG + Intergenic
1062357268 9:136170819-136170841 GTGGCTGACCAGAGGGTGGGCGG - Intergenic
1062728636 9:138095926-138095948 GTGGTTGCCAGGGGGTTGGGGGG + Intronic
1185472813 X:394865-394887 GTGGTTGCCAGGGGATGGGGAGG - Intergenic
1185541030 X:903066-903088 GTGGATGCCCATAGATAGTGCGG + Intergenic
1186398664 X:9236294-9236316 GTGGTGGCCTAAGGATTGGGTGG - Intergenic
1190422839 X:50302628-50302650 GTGGTTGCCCAAAGCTGGGCAGG - Intronic
1190872594 X:54437063-54437085 ATGGTTGCCCAGGGCTTGGATGG - Intergenic
1192007032 X:67226830-67226852 GTGGTTACCAAGAGCTGGGGTGG + Intergenic
1192373447 X:70534982-70535004 GTGGTTGCCCAGGGCTTAGTGGG - Intronic
1192559597 X:72117603-72117625 GTGGTTGCCTAGGGCTGGGGAGG - Intergenic
1192668542 X:73114247-73114269 GTGGTTGCCTGGTGATGGGGAGG - Intergenic
1193298522 X:79861166-79861188 GTGGTTGCCTAGGGCTGGGGTGG - Intergenic
1193368248 X:80660469-80660491 GTGGTTGCCAAGAGCTGGGGTGG - Intergenic
1193677885 X:84479240-84479262 GTGGTTGCCAGGAGCTGGGGTGG - Intronic
1194325675 X:92513894-92513916 GTGGTTGCTCAGAATTGGGGTGG - Intronic
1195462929 X:105147508-105147530 ATGGTTGCCAGGAGATTGGAGGG - Intronic
1197217267 X:123878402-123878424 GTGGTTGCCTAGGGCTGGGGAGG - Intronic
1197759587 X:130018292-130018314 GTGGTTGCCTAGGGTTGGGGAGG + Intronic
1198410783 X:136365292-136365314 GTGGTTGCCAGGAGCTGGGGTGG - Intronic
1200634404 Y:5633061-5633083 GTGGTTGCTCAGAATTGGGGTGG - Intronic