ID: 1090284058

View in Genome Browser
Species Human (GRCh38)
Location 11:125483739-125483761
Sequence CAGCAAAGCCCAAAATAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090284052_1090284058 21 Left 1090284052 11:125483695-125483717 CCTTCAGATTTGTCCCTGCAGGA 0: 1
1: 0
2: 0
3: 8
4: 175
Right 1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 191
1090284053_1090284058 8 Left 1090284053 11:125483708-125483730 CCCTGCAGGAAGTGCCCACAGAA 0: 1
1: 0
2: 1
3: 36
4: 274
Right 1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 191
1090284056_1090284058 -7 Left 1090284056 11:125483723-125483745 CCACAGAAATGAAATTCAGCAAA 0: 1
1: 0
2: 3
3: 55
4: 452
Right 1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 191
1090284055_1090284058 -6 Left 1090284055 11:125483722-125483744 CCCACAGAAATGAAATTCAGCAA 0: 1
1: 1
2: 1
3: 36
4: 446
Right 1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 191
1090284054_1090284058 7 Left 1090284054 11:125483709-125483731 CCTGCAGGAAGTGCCCACAGAAA 0: 1
1: 0
2: 0
3: 35
4: 228
Right 1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090284058 Original CRISPR CAGCAAAGCCCAAAATAGGC AGG Intronic
900939833 1:5791558-5791580 CAGCAAACCTCAAAAGAGGGGGG + Intergenic
902386925 1:16081361-16081383 CCTCAAAGCTGAAAATAGGCTGG + Intergenic
904626232 1:31805427-31805449 ACGCAAAGCACAAAACAGGCCGG + Intronic
905535436 1:38717956-38717978 CAACACAGCCCAAACTAGCCTGG + Intergenic
907170369 1:52457528-52457550 AAGAAAATCACAAAATAGGCTGG - Intronic
907728299 1:57041102-57041124 CAGCAAAGGAAAAAATAGCCAGG + Intronic
908674559 1:66589318-66589340 AAACAAAGTCTAAAATAGGCAGG - Intronic
909588391 1:77317511-77317533 CAGCAAAGTGAAAAATGGGCAGG - Intronic
911123843 1:94322189-94322211 CAACAAAGCCCAAAATAACTAGG - Intergenic
911462172 1:98204661-98204683 GAGCAAAACCAAAAATAGGAAGG + Intergenic
911745644 1:101439068-101439090 AAGCAAACCCCCAAATAGCCAGG - Intergenic
913647519 1:120873068-120873090 CAGTAAATCCCAGAATAGGGTGG + Intergenic
914174024 1:145258339-145258361 CAGTAAATCCCAGAATAGGGTGG - Intergenic
914298929 1:146360972-146360994 CAGTAAATCCCAGAATAGGGTGG - Intergenic
914431150 1:147620876-147620898 CAGCAGACCCCAAAACAGGGGGG - Exonic
914528685 1:148499524-148499546 CAGTAAATCCCAGAATAGGGTGG - Intergenic
914637708 1:149567584-149567606 CAGTAAATCCCAGAATAGGGTGG + Intergenic
914875363 1:151509643-151509665 CAAAAAAACCCAAAACAGGCTGG + Intergenic
916161072 1:161915406-161915428 CAGCTAACCCCAAAATAGTCAGG - Intronic
917756908 1:178110842-178110864 CAGCAAATCCCAAATTTGGGAGG - Intronic
919792002 1:201297819-201297841 CAGCCTAGCTCAAAAGAGGCAGG + Intronic
919947233 1:202328519-202328541 CAGCAAAGCCCAGGAGAGGTTGG - Intergenic
921717273 1:218430524-218430546 CAGCAAAGGCTAAAATAGAATGG + Intronic
1063798369 10:9539874-9539896 CAGCAAAGCCAAACCAAGGCAGG + Intergenic
1064184388 10:13148255-13148277 TAGCAAAGAACAAAATAAGCAGG + Intergenic
1064685373 10:17855870-17855892 CATCAAAGTCCAAAATTGGCCGG + Intronic
1066626834 10:37415686-37415708 CATCATAGCCCAAAATTGGGGGG + Intergenic
1067258267 10:44664140-44664162 CTGAAAAGGCCAAAATAGGAAGG + Intergenic
1067915049 10:50388335-50388357 CTTAAAAGCCCAAAAGAGGCTGG + Intronic
1068026231 10:51648905-51648927 CAAGAATGCCCAAAGTAGGCCGG + Intronic
1069863074 10:71483284-71483306 CACCCAAGCCCACAAGAGGCTGG + Intronic
1070480546 10:76878369-76878391 AAGCAAAGCCAAGAAAAGGCTGG - Intronic
1072996343 10:100248180-100248202 CAAAAAAGCTGAAAATAGGCTGG + Intronic
1073233600 10:101994096-101994118 CAGGAAAGCCCGGAATAGACAGG - Intronic
1074211239 10:111337129-111337151 CAACAAAAACCAAAAAAGGCTGG - Intergenic
1074444797 10:113512752-113512774 AAGCAAAACCCAAAATAGCCAGG + Intergenic
1075041209 10:119108186-119108208 AAAAAAACCCCAAAATAGGCTGG + Intronic
1075204337 10:120434027-120434049 CAGTAAAGACCACAAAAGGCTGG + Intergenic
1077274119 11:1695454-1695476 CAGCAAAGCCCAAAGGTGGGGGG + Intergenic
1077385070 11:2265454-2265476 CAGCAGAGCCCAGGACAGGCTGG + Intergenic
1078865606 11:15294564-15294586 CAGCAAAGCCCAATAAAGCCTGG - Intergenic
1081088778 11:38835436-38835458 CAACAAAGCCCAAGATAGTTTGG + Intergenic
1081865612 11:46358120-46358142 CAGCACAGCAAAAAAAAGGCAGG - Intronic
1083489821 11:63008076-63008098 CAGCATAGCCCAGCATAGGCTGG + Intronic
1084280234 11:68085073-68085095 AAACTAAGCCCAAAATAGGAAGG - Intronic
1086186863 11:84028661-84028683 AAGCAAAGACCTTAATAGGCAGG - Intronic
1089458180 11:118637644-118637666 AAGAAAAGACCAAAGTAGGCTGG - Intronic
1090284058 11:125483739-125483761 CAGCAAAGCCCAAAATAGGCAGG + Intronic
1090337622 11:125983637-125983659 CACCAAAGCCAAAACTAAGCAGG - Intronic
1091487749 12:906326-906348 CAGCAGAGCCGAAATCAGGCAGG + Intronic
1093086783 12:14874344-14874366 CAGCAAAGGCCAAAAGGGCCAGG - Intronic
1094522782 12:31210437-31210459 CAGCATATGCCAAAATAAGCTGG - Intergenic
1095121787 12:38427582-38427604 CAGCAGAACTCAAAACAGGCAGG - Intergenic
1095886955 12:47198667-47198689 CAGAAAATCCCAAAGAAGGCAGG + Intronic
1098406053 12:70127150-70127172 CATCAAAACCTAAAATAGGCTGG + Intergenic
1098417298 12:70249301-70249323 TAGCAAAGCCAAAAGTAGTCAGG - Intronic
1101266546 12:103094198-103094220 CAGCAAAGGGCAAAATAGGTGGG - Intergenic
1101506804 12:105354656-105354678 CAGCAAGGCCCTCAATATGCTGG - Intronic
1101827472 12:108231747-108231769 CAGCAAAACACAATATGGGCAGG + Intronic
1101843582 12:108344463-108344485 GAGCAGAGGGCAAAATAGGCTGG + Intergenic
1108992438 13:56677556-56677578 CACCAAAGCAAAAATTAGGCTGG - Intergenic
1110122616 13:71902387-71902409 TAGAAATGTCCAAAATAGGCAGG - Intergenic
1112534031 13:100232164-100232186 CAGCAAAGCACAAGATAAGGAGG - Intronic
1114595809 14:23910755-23910777 CAGCAAAGGCCCAGATAGGGTGG - Intergenic
1117982397 14:61354736-61354758 CAGAAAAGCCTAAAATACTCTGG - Intronic
1119167287 14:72505070-72505092 CAGCAAAAGCCTAAATTGGCTGG - Intronic
1121317316 14:92970014-92970036 CAGCAGAGCCAGAAAAAGGCTGG + Intronic
1122033674 14:98932182-98932204 CAGCAAAGCCACAAGTTGGCGGG + Intergenic
1123026343 14:105426016-105426038 CAGCAAAGCCCACGCCAGGCCGG - Intronic
1130221761 15:82025386-82025408 CACCGAAGGGCAAAATAGGCAGG + Intergenic
1131699221 15:94915888-94915910 CAGCAAAGCAGAAAAGAGTCAGG - Intergenic
1135638236 16:24097330-24097352 AAGAAAAGCCTAAGATAGGCTGG - Intronic
1135979637 16:27137460-27137482 AAGCAAAGCTCAAAATAACCTGG + Intergenic
1138971723 16:62152308-62152330 CAACAAATGCAAAAATAGGCAGG - Intergenic
1145104801 17:20105977-20105999 CAGCAAAGGCCAAGAGAGGAAGG - Intronic
1145119375 17:20243412-20243434 CAGCCAATTCTAAAATAGGCTGG + Intronic
1147698036 17:42371372-42371394 CAGTAAAAGCCAAAACAGGCGGG + Intronic
1147806836 17:43137888-43137910 AACAAAAACCCAAAATAGGCCGG + Intergenic
1149669265 17:58391470-58391492 CACCAAAGCCCAAGACATGCAGG - Intronic
1150416773 17:64994743-64994765 CAGCAAAAACCAAAAGAGACAGG + Intergenic
1150831420 17:68523306-68523328 CAGCATAACTCAAAATAGCCTGG - Intronic
1153306180 18:3633099-3633121 CATCAAAGCCTAAATTGGGCTGG + Intronic
1156463271 18:37333500-37333522 CAGCAGAGTCCAAAAGAGCCTGG - Intronic
1163855532 19:19698880-19698902 CATTAAAGCCCAAGAAAGGCAGG - Intergenic
1165322485 19:35094569-35094591 CAGCAAAGAACAAAAGAGACAGG + Intergenic
1166312005 19:41968215-41968237 TGGCAAAACCCAAAATGGGCTGG + Intronic
1166400874 19:42478864-42478886 CAGAAATACCCAGAATAGGCCGG - Intergenic
1166630107 19:44399267-44399289 CAACAAAGGCCAAAATAAGGAGG + Intronic
1166727091 19:45035166-45035188 CAGCAAAACCCAAAATAACAGGG + Intronic
1168484949 19:56753431-56753453 CAGCGAGGCTCAAAAGAGGCAGG - Intergenic
926102107 2:10124411-10124433 CAGCAAAGCCACAAAAAGGAGGG - Intronic
928648057 2:33375836-33375858 CATTAAAACCCAACATAGGCCGG - Intronic
929728793 2:44463419-44463441 CAGCATAGCTCATAATAGGGAGG + Intronic
931087603 2:58850772-58850794 CAGACAGGCCCAGAATAGGCCGG - Intergenic
932754483 2:74397283-74397305 TGGAAAAGGCCAAAATAGGCCGG + Intergenic
933502393 2:83130545-83130567 CATAAAACCCCAAAATATGCTGG - Intergenic
934877411 2:97937332-97937354 CAGCAAACTCAAAAATAGGTTGG + Intronic
935075851 2:99743146-99743168 CAGCAAATCCCAACAGAGGGTGG + Intronic
940668268 2:156635792-156635814 CTGCTATGCCCAAAAGAGGCAGG + Intergenic
943560801 2:189459553-189459575 GAGCAAAGCCCAAAATACAGGGG - Intronic
945156834 2:206848219-206848241 CAGAGAAGCCCACAAGAGGCAGG - Intergenic
948038727 2:234881665-234881687 CAGCAATGCCAAAAATACCCAGG + Intergenic
1169372832 20:5041798-5041820 TAGCAAGTCCTAAAATAGGCAGG - Intergenic
1169772965 20:9221416-9221438 CAGCAAAGCACACAAAAGCCGGG + Intronic
1172011053 20:31845719-31845741 CCACAAGGCCCAAAAGAGGCGGG + Intergenic
1172073436 20:32276131-32276153 CAGGAAATACCAAAAGAGGCTGG + Intergenic
1172421563 20:34823219-34823241 TAGAAAAACCCAGAATAGGCTGG + Intronic
1173014031 20:39208902-39208924 CAGCAAAGCCCACAAAAGCTGGG - Intergenic
1174873709 20:54206458-54206480 CTGGAGAGCCCAGAATAGGCAGG + Intergenic
1177338312 21:19762497-19762519 CGGTAAAGTCCAAAATTGGCAGG + Intergenic
1179485297 21:41706136-41706158 CTCCAAAGCCCAAAGGAGGCAGG + Intergenic
1181485137 22:23225785-23225807 CAGCAAAGGCCAGAAAAGGGAGG - Intronic
1182278389 22:29204683-29204705 CAGCATAGGCCACCATAGGCAGG - Intergenic
1182588612 22:31361940-31361962 CAGCAAAGGGGAAAACAGGCTGG + Intergenic
1183501818 22:38184620-38184642 CAGAAAAGGCCAAGAGAGGCTGG + Intronic
1185211578 22:49573540-49573562 CAGCAAGGCCCAGAGTGGGCAGG + Intronic
952559415 3:34573266-34573288 CAGCAAACACCAGAATAGCCAGG - Intergenic
952947837 3:38492108-38492130 CAGCAAAGGACAAAATTTGCAGG + Exonic
954572599 3:51654642-51654664 CAGAAAAGCCCAAAAAAGAGGGG - Intronic
957874211 3:86124368-86124390 CAGCAAAGCCCAACATATCTTGG - Intergenic
958262381 3:91396727-91396749 CACCAAAGCCAAAGATGGGCAGG - Intergenic
959654108 3:108781334-108781356 CAGAAAAGTCCAGACTAGGCTGG + Intergenic
960579331 3:119261379-119261401 AAACAAGGCCCAAAAGAGGCTGG + Intergenic
960622307 3:119648558-119648580 CAGCAGAGCCGAGAAGAGGCAGG + Exonic
960863657 3:122179331-122179353 AAACAAAACCGAAAATAGGCTGG + Intergenic
961376888 3:126473175-126473197 CACCGAAGCCCAAAATACCCTGG - Intronic
962614003 3:137105848-137105870 CAGAAAGGGCTAAAATAGGCAGG + Intergenic
966520465 3:180868806-180868828 CATCAAAGCTCCAAACAGGCAGG - Intronic
967369423 3:188727107-188727129 CAGAAAAGCCCAAAGTAGCTTGG + Intronic
969410092 4:7022322-7022344 CTGCAAGGCCCAAAAGATGCAGG + Intronic
974263369 4:59553655-59553677 TGGCAAAGCCCACATTAGGCTGG + Intergenic
977290483 4:95160098-95160120 CAGGGAAGCCCAAAATTGTCTGG + Intergenic
978730132 4:112016183-112016205 ATGTAAAGCCCAAAATAGCCTGG + Intergenic
984221224 4:176979435-176979457 CAGAAAAGACCAAAATAAACTGG - Intergenic
985343569 4:188976953-188976975 CTGCAAAATCCAAAATGGGCTGG - Intergenic
987887179 5:23827944-23827966 CAGCAAAAAGGAAAATAGGCTGG - Intergenic
991187955 5:63832914-63832936 CAGCAAAGTGGAAAACAGGCAGG - Intergenic
991203278 5:64019170-64019192 CAGCAAAGCCTAAACTAATCTGG - Intergenic
995380254 5:111523656-111523678 CAGCAGCTTCCAAAATAGGCAGG + Intergenic
997011349 5:129882304-129882326 CTGCAAAGAGCAAAAGAGGCTGG + Intergenic
997723811 5:136103436-136103458 CAGCAAAGGCCAAGACAGGCTGG - Intergenic
998013620 5:138715057-138715079 CAGCAAAGGCAAAGAGAGGCTGG + Intronic
998488258 5:142522857-142522879 AAGGAAAGCCAAGAATAGGCAGG + Intergenic
998770627 5:145540628-145540650 CAGCCAAGCCCCAAATATGAGGG + Intronic
999203203 5:149831041-149831063 CAGAAAACCCTAAACTAGGCTGG - Intronic
999244309 5:150145309-150145331 CAGTAAGGCCCACAGTAGGCTGG + Intronic
1000374871 5:160570131-160570153 AAGAAAAGCACAAAACAGGCAGG - Intronic
1001122686 5:168993220-168993242 CAGCCAAGCGCAGAATAGCCAGG + Intronic
1001513153 5:172337653-172337675 CAGCAAAGCGCAGCATACGCGGG + Exonic
1002392873 5:178929417-178929439 CAGCAAAGCACACAAGAGGTGGG - Intronic
1003307461 6:4942739-4942761 AAGCAAATCCCAAAATAGCATGG + Intronic
1004567915 6:16816538-16816560 CAGCAATGCCCAAAATGGCAGGG + Intergenic
1005389053 6:25314822-25314844 CAGCAAAACCTTAAATATGCAGG - Intronic
1008993036 6:57626150-57626172 CACCAAAGCCAAAGATGGGCAGG + Intronic
1009181650 6:60525256-60525278 CACCAAAGCCAAAGATGGGCAGG + Intergenic
1011657861 6:89567654-89567676 TAGCAAAGCCAAGAAAAGGCAGG + Intronic
1015054195 6:128879753-128879775 CAGCAAACACCAAAATTTGCTGG + Intergenic
1016868410 6:148792403-148792425 CAGCAAACCCCAAAGTCGCCTGG + Intronic
1019482019 7:1271233-1271255 CAGCAAAACCCAAACTCGTCGGG + Intergenic
1020172948 7:5859167-5859189 TAGAAAAGCCCAAGATAGGATGG + Intergenic
1020657815 7:10948587-10948609 CAGCAAAGCCCAAAGTTGCTAGG + Intergenic
1023196502 7:37645661-37645683 CAGCAAAGTGCAAATTAGGAGGG + Intergenic
1026080584 7:67215582-67215604 CAACAAAATCCAAAATATGCAGG - Intronic
1026696506 7:72598447-72598469 CAACAAAATCCAAAATATGCAGG + Intronic
1026729540 7:72899279-72899301 CAGAAACACACAAAATAGGCCGG - Intronic
1027114457 7:75467831-75467853 CAGAAACACACAAAATAGGCCGG + Intronic
1029080813 7:97972438-97972460 CAGCAAAACACAAACTCGGCCGG - Intergenic
1029085842 7:98011088-98011110 TAGAAAAGCCCAAGATAGGATGG - Intergenic
1036034927 8:5008269-5008291 CATCAAAGCCCATTATGGGCCGG - Intergenic
1038317987 8:26503644-26503666 CACCAAAGGCCTAAAAAGGCAGG + Intronic
1039479551 8:37862068-37862090 TAGCAAAGCGCTGAATAGGCTGG + Exonic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1041880833 8:62748231-62748253 CAGCAAAGCTCAAGATTGACAGG - Intronic
1042383884 8:68150885-68150907 CACCAAAGGCCAAAAGAGGAAGG - Intronic
1043657539 8:82688732-82688754 AAGAAAAGCCCAAAATATGATGG + Intergenic
1044408820 8:91862161-91862183 CAAGAAAGACTAAAATAGGCAGG + Intergenic
1045304373 8:100945521-100945543 TATCAAAGCCCAGAAAAGGCTGG + Intronic
1045339947 8:101244670-101244692 CAACAATGACCAAAATAGACAGG - Intergenic
1045394629 8:101748532-101748554 CAGCCAAGCCCACCATGGGCAGG - Intronic
1045625104 8:104036552-104036574 CAGCACAGCTCAAAATAGGAAGG + Intronic
1045661919 8:104446993-104447015 CAACAAAGCCAAAAGTATGCTGG + Intronic
1046081875 8:109379266-109379288 AAGCAAAGCCCATAATTGGAGGG - Intronic
1047985561 8:130229741-130229763 TAAAAAACCCCAAAATAGGCTGG + Intronic
1048271813 8:133034846-133034868 CAGCAAAGCCCTAAGACGGCAGG - Intronic
1049275337 8:141717476-141717498 CTGCAAGGCTCAATATAGGCAGG - Intergenic
1049636833 8:143693589-143693611 CAGCAAAGCCCAGAGGAGGCCGG - Intronic
1052796343 9:32927015-32927037 CAGCAATGTCCAGAAGAGGCTGG + Intergenic
1053140458 9:35679559-35679581 CAACAAAACCAAAAATAGCCGGG + Intronic
1053473350 9:38363250-38363272 AAACAAAGCCAAAAAAAGGCAGG + Intergenic
1055799740 9:80021970-80021992 AATCAAAGCCAAGAATAGGCTGG - Intergenic
1056718233 9:89051585-89051607 CAGCGAAGCCGAAACTATGCCGG + Intronic
1057368042 9:94442552-94442574 CACCAAAAACAAAAATAGGCCGG + Intronic
1057371807 9:94480284-94480306 CAGAAAAGCCTAAAACAGGATGG - Intergenic
1058789804 9:108432456-108432478 AAGCAAAACCCAAAGCAGGCAGG + Intergenic
1058852429 9:109025821-109025843 CAGCAGAGGCCAAAATAGTTGGG + Intronic
1059583654 9:115580860-115580882 CAGCCAAGTACAGAATAGGCAGG - Intergenic
1060000894 9:119957843-119957865 CACCAAAGCCCAGAAAAGGGAGG + Intergenic
1060530734 9:124345941-124345963 CAGCAGACCCCAAAATGGGCAGG + Intronic
1061699131 9:132402041-132402063 CATCCAAGCCCACAGTAGGCTGG + Exonic
1187010116 X:15270013-15270035 CAGCAAAGCACAGAGCAGGCAGG + Exonic
1189642302 X:43086014-43086036 CAGAAAAGCACACAAGAGGCTGG - Intergenic
1192172240 X:68864032-68864054 ATGCAAACCCCAAAATAGACAGG + Intergenic
1201394640 Y:13535859-13535881 CAGCAAGGTCCAAAATGGGGTGG - Intergenic