ID: 1090296500

View in Genome Browser
Species Human (GRCh38)
Location 11:125592840-125592862
Sequence CACCCAACCCTGGCAGGAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 313}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090296500_1090296513 29 Left 1090296500 11:125592840-125592862 CCGGCTCCTGCCAGGGTTGGGTG 0: 1
1: 0
2: 0
3: 26
4: 313
Right 1090296513 11:125592892-125592914 CGCGGATCGTTTAGGAAAGCCGG 0: 1
1: 0
2: 0
3: 0
4: 17
1090296500_1090296504 -6 Left 1090296500 11:125592840-125592862 CCGGCTCCTGCCAGGGTTGGGTG 0: 1
1: 0
2: 0
3: 26
4: 313
Right 1090296504 11:125592857-125592879 TGGGTGCGCCGCTGAACGGATGG 0: 1
1: 0
2: 0
3: 3
4: 53
1090296500_1090296505 0 Left 1090296500 11:125592840-125592862 CCGGCTCCTGCCAGGGTTGGGTG 0: 1
1: 0
2: 0
3: 26
4: 313
Right 1090296505 11:125592863-125592885 CGCCGCTGAACGGATGGCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 46
1090296500_1090296503 -10 Left 1090296500 11:125592840-125592862 CCGGCTCCTGCCAGGGTTGGGTG 0: 1
1: 0
2: 0
3: 26
4: 313
Right 1090296503 11:125592853-125592875 GGGTTGGGTGCGCCGCTGAACGG 0: 1
1: 0
2: 2
3: 1
4: 62
1090296500_1090296506 1 Left 1090296500 11:125592840-125592862 CCGGCTCCTGCCAGGGTTGGGTG 0: 1
1: 0
2: 0
3: 26
4: 313
Right 1090296506 11:125592864-125592886 GCCGCTGAACGGATGGCTGAGGG 0: 1
1: 0
2: 0
3: 9
4: 49
1090296500_1090296508 11 Left 1090296500 11:125592840-125592862 CCGGCTCCTGCCAGGGTTGGGTG 0: 1
1: 0
2: 0
3: 26
4: 313
Right 1090296508 11:125592874-125592896 GGATGGCTGAGGGAGCCCCGCGG 0: 1
1: 0
2: 1
3: 26
4: 281
1090296500_1090296509 21 Left 1090296500 11:125592840-125592862 CCGGCTCCTGCCAGGGTTGGGTG 0: 1
1: 0
2: 0
3: 26
4: 313
Right 1090296509 11:125592884-125592906 GGGAGCCCCGCGGATCGTTTAGG 0: 1
1: 0
2: 0
3: 1
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090296500 Original CRISPR CACCCAACCCTGGCAGGAGC CGG (reversed) Exonic
900285809 1:1899777-1899799 CACCCAGCCATGGCAGGAAATGG - Intergenic
900315938 1:2056338-2056360 CTCCCGACCCTGCCAGGAGGTGG + Intronic
900396026 1:2453600-2453622 CACCCCCCTCTGGCAGGGGCAGG + Intronic
900583809 1:3422893-3422915 CAGCTGACCCGGGCAGGAGCAGG + Intronic
900700680 1:4047002-4047024 CACCCAGCCCTGGTGGGGGCAGG - Intergenic
901063413 1:6484314-6484336 CACCAGCCCCTGGCAGCAGCTGG - Intronic
901456254 1:9364523-9364545 AACCCAACCCTGTGAGGAGCCGG + Intronic
901473471 1:9473408-9473430 CACCCAGCAGCGGCAGGAGCTGG + Intergenic
902251994 1:15159931-15159953 CACCAAATCCTGGCAGAACCTGG + Intronic
902513417 1:16978057-16978079 CAGCCAACCCTGGCAGCATCTGG - Intronic
903445647 1:23420988-23421010 ATCCCCACCCTGGCAGGACCTGG + Intronic
903741921 1:25563219-25563241 CTCCCAGCCCAGGCAGGAGTGGG - Intronic
903886857 1:26545864-26545886 CACGGCACCATGGCAGGAGCAGG - Exonic
904704216 1:32378164-32378186 CACTCAACCCTGGGGGAAGCAGG - Intronic
904756367 1:32770831-32770853 CACCCAACCCAGCCAACAGCTGG + Exonic
905038115 1:34930184-34930206 CGCCCCATCCTGGCAGGGGCTGG - Intergenic
905551612 1:38845463-38845485 CACCCACCCCTGACAGGCCCTGG - Intronic
905754179 1:40494100-40494122 CTCCCCACTCTGGCAGCAGCAGG - Intronic
907323657 1:53621270-53621292 CCCCCAGCCCAGCCAGGAGCAGG + Intronic
907373791 1:54019466-54019488 CAACCAAGACTGGCAGGAGCTGG - Intergenic
907399255 1:54214555-54214577 CTCCCAACTCAGGCAGGAGAAGG + Intronic
908768153 1:67572516-67572538 CACCCACTCCTGTCCGGAGCCGG + Intergenic
909275702 1:73683805-73683827 CCCCCAACCCTGACAGGCCCTGG + Intergenic
910772224 1:90841923-90841945 TACGCAGCCCTGGCAGGAGGTGG + Intergenic
912719006 1:112004078-112004100 CATCCATCCCTGCCTGGAGCTGG - Intergenic
915591681 1:156874490-156874512 CCCCCAACCCTGGCCCCAGCTGG - Intronic
916100190 1:161387945-161387967 CACCCAGCCCTATCAGGAGTTGG - Intergenic
916107348 1:161441447-161441469 CACCGAACCCAGACAGGCGCCGG + Intergenic
916108933 1:161448865-161448887 CACCGAACCCAGACAGGCGCCGG + Intergenic
916110521 1:161456246-161456268 CACCGAACCCAGACAGGCGCCGG + Intergenic
916112106 1:161463656-161463678 CACCGAACCCAGACAGGCGCCGG + Intergenic
916113693 1:161471037-161471059 CACCGAACCCAGACAGGCGCCGG + Intergenic
916784818 1:168078981-168079003 CACCCAATCTTGGAAGCAGCTGG - Intergenic
917523688 1:175768710-175768732 CTCCCAAGCCTGAGAGGAGCAGG + Intergenic
922785206 1:228279225-228279247 CACTCAAACCAGGCAGGAGCGGG - Exonic
922796504 1:228342203-228342225 CACCCAAGCCTGTCATCAGCTGG + Exonic
922882371 1:228990519-228990541 CACCGCACCCTGGCAGGGGAGGG + Intergenic
923084570 1:230693914-230693936 CCCCGACCTCTGGCAGGAGCCGG + Exonic
923293404 1:232569376-232569398 AACCCAATCCTGGCAAGAGATGG + Intergenic
924954015 1:248910108-248910130 GACCCAAACCTGGCTGGACCTGG + Intronic
1062911254 10:1213891-1213913 CACGCAACACTGGCAGGTCCGGG - Intronic
1062911336 10:1214378-1214400 CACGCAACGCTGGCAGGTCCAGG - Intronic
1063369198 10:5509891-5509913 CACCCAGTCCTGGCACGGGCAGG + Intergenic
1064798083 10:19036392-19036414 CACTCCACCCTGGCAAGAGAGGG + Intergenic
1065625937 10:27628362-27628384 CACAGAACCCTCGCAAGAGCTGG + Intergenic
1066109371 10:32182650-32182672 CACCCACCCGGGGCAGCAGCTGG - Intergenic
1066381498 10:34905750-34905772 CACCCAAGCTTGGCAGAAGGGGG - Intergenic
1067081719 10:43216171-43216193 GTCCCCACCCTGCCAGGAGCGGG + Intronic
1067282858 10:44886030-44886052 CCCCCAAGCCTGGCAGGGACAGG + Intergenic
1067786519 10:49253484-49253506 CACCCAGCCCTGGAGGGTGCAGG - Intergenic
1067786577 10:49254721-49254743 CACCCAGCCCTGGAGGGTGCAGG - Intergenic
1069782136 10:70963445-70963467 GGCCCTGCCCTGGCAGGAGCTGG - Intergenic
1070703377 10:78619377-78619399 CACCCAAGCCTTGAAGGAGGAGG - Intergenic
1070726778 10:78797478-78797500 CATCCTAGCCTGGCAGGAGAGGG - Intergenic
1071463999 10:85923199-85923221 CCCCCACCCTTGGCAGGAACAGG + Intronic
1072995081 10:100236486-100236508 CACCCACGCCTGGCAAGATCTGG - Intronic
1073578114 10:104641685-104641707 CCGCCAAGCTTGGCAGGAGCTGG - Exonic
1074087647 10:110220600-110220622 CTCCCTCCCCTGCCAGGAGCTGG - Intronic
1074756474 10:116627673-116627695 CCCCCATCCCTGGCAGGGCCCGG + Intronic
1075447811 10:122526040-122526062 CACACGAGTCTGGCAGGAGCGGG + Intergenic
1075723886 10:124602024-124602046 CACCCACCCCCGGATGGAGCTGG - Intronic
1076224102 10:128759405-128759427 CACTGAAGCCTGGCAGGAGGTGG - Intergenic
1077150589 11:1071334-1071356 CAGCCAACCCTGCCAGCACCAGG - Intergenic
1077509263 11:2947493-2947515 CACCAAAGCCTGGCAGGGGTGGG - Intronic
1079023108 11:16925021-16925043 CACCCACACTTGCCAGGAGCCGG - Intronic
1079402790 11:20119319-20119341 CCCCCAGCCCTAGCAGGAGGAGG - Intronic
1080485786 11:32705088-32705110 CACCCAGCACTGGCAGAGGCTGG - Intronic
1082626923 11:55497322-55497344 CACTCCGCTCTGGCAGGAGCAGG - Intergenic
1083633455 11:64107726-64107748 CACCCTGCCCTGGCGGGAGCTGG + Intronic
1083881073 11:65548524-65548546 CTCCCAAGACTAGCAGGAGCTGG + Intronic
1084490616 11:69476366-69476388 CACCCAGCCCTGGCACCGGCAGG + Intergenic
1084774137 11:71364474-71364496 GGCCCAGCCCTGGCAGGGGCAGG + Intergenic
1084775303 11:71370847-71370869 CCCCCAGCCCTGGCTGGAGGAGG + Intergenic
1086345193 11:85889236-85889258 CACCTAAGCCTCACAGGAGCTGG - Intronic
1087828146 11:102789572-102789594 CACCCAACTCTGCAAGGAGTTGG + Intergenic
1089215973 11:116835048-116835070 CTGCCAGCCCTGGCAGAAGCTGG - Intergenic
1089284885 11:117399137-117399159 CCCCCAACCCTGACAGGCCCCGG + Intronic
1089292103 11:117443656-117443678 CACCCGCCCCAGGCAAGAGCCGG + Intronic
1089730547 11:120516284-120516306 CATTCAGACCTGGCAGGAGCTGG + Intronic
1089942214 11:122430654-122430676 CACCCAGCCCTGGCTCAAGCAGG + Intergenic
1090288275 11:125519173-125519195 CACTCCTCCCTAGCAGGAGCAGG + Intergenic
1090296500 11:125592840-125592862 CACCCAACCCTGGCAGGAGCCGG - Exonic
1090418148 11:126555169-126555191 CACTCATCTCTGGCAGAAGCAGG - Intronic
1092202098 12:6591877-6591899 GACCCAACCCAGGGAGGAACAGG + Intronic
1093127649 12:15349746-15349768 CACTCTACCATGGCAGGAACAGG + Intronic
1094359020 12:29609897-29609919 CCTCCAACTCTGGCAGTAGCCGG + Intronic
1096109546 12:49020742-49020764 CACCCAACCCGTCCAGGGGCTGG + Exonic
1098143043 12:67469973-67469995 CCCCCACCCCTGGCTGCAGCAGG - Intergenic
1100150717 12:91734190-91734212 CACCCAGGCCTGTCAGGAGATGG + Intergenic
1102689931 12:114752415-114752437 CACCTCACCCTGGCTGGAACTGG + Intergenic
1102780613 12:115561444-115561466 CAGCCAGCCCAGGGAGGAGCAGG + Intergenic
1103269086 12:119657284-119657306 CACCCAACCCTGGGATGATTAGG - Intergenic
1103900976 12:124303492-124303514 CCCCAGACCCTGGAAGGAGCTGG + Intronic
1103995143 12:124824784-124824806 GGCCCTAGCCTGGCAGGAGCTGG - Intronic
1104082006 12:125437191-125437213 GATCCAAACCTGGGAGGAGCGGG - Intronic
1104843547 12:131835643-131835665 GGCCCAACCCAGGCAGCAGCTGG + Intronic
1104849168 12:131863143-131863165 CCCCCAAACCTGGCAGCAACCGG - Intergenic
1104990448 12:132621349-132621371 CACCCACCCCCAGCAGGTGCAGG - Intronic
1105317745 13:19282711-19282733 CCCCCAACCCCGGCAGGCCCTGG - Intergenic
1105620585 13:22062042-22062064 GACCCAACTCTGGCAGGTGCTGG + Intergenic
1107838071 13:44428164-44428186 CCCCCAACACTGGCAGGAGATGG - Intergenic
1109155087 13:58900009-58900031 CCCCCAACCCCAGCAGGAGATGG + Intergenic
1110488963 13:76080018-76080040 CCCCCAACCCTGACAGGTCCTGG - Intergenic
1114493662 14:23118604-23118626 CCCCCAACTCTGGCAGCACCCGG - Exonic
1116875615 14:50108103-50108125 CACCCAAGCCTGGGAAGAGTAGG + Intergenic
1118759960 14:68874774-68874796 AACCGAACCCAGGCAGGAGATGG + Exonic
1119320875 14:73729603-73729625 TCCGCGACCCTGGCAGGAGCGGG - Intronic
1119768152 14:77203800-77203822 GAGCCCACCCTGGCAGCAGCAGG + Intronic
1119857835 14:77913985-77914007 CACCCGACCCTGACAGAAGATGG - Intronic
1120657945 14:87217965-87217987 CCCCCAACCCAGAGAGGAGCAGG + Intergenic
1122276717 14:100594494-100594516 CCCCCAATCCTGGCTAGAGCGGG - Intergenic
1122504874 14:102226186-102226208 CACCCCACACTGGCGGGGGCAGG - Intronic
1122685239 14:103501286-103501308 TACCCATCCCAGCCAGGAGCAGG + Intronic
1123095574 14:105765581-105765603 GCCCCCACCCAGGCAGGAGCTGG - Intergenic
1123722197 15:23069411-23069433 CACCCAAACCTGGGAGGCGGAGG - Intergenic
1123752941 15:23372739-23372761 CACCCAAACCTGGGAGGCGGAGG + Intergenic
1123933255 15:25182005-25182027 CACCGAACCCTGGAAGGACAGGG - Intergenic
1123936637 15:25197194-25197216 CACTCAACCCTGGAAGGATAGGG - Intergenic
1123939417 15:25209621-25209643 CACCGAACCCTGGAAGGACAGGG - Intergenic
1123946916 15:25243243-25243265 CACCCAACCCTGGAAGGACAGGG - Intergenic
1123947733 15:25246973-25246995 CACCGAACCCTGGAAGGACAGGG - Intergenic
1124146853 15:27135819-27135841 CACTCAAACCTGGAAGGAGGAGG + Intronic
1128305919 15:66598933-66598955 CACTCAAACCTGGGAGGAGGAGG - Intronic
1128321103 15:66694883-66694905 CTCCCAGCCCTGTTAGGAGCAGG - Intergenic
1128780820 15:70357558-70357580 CACCCAACCCTGGGCTGAGTGGG + Intergenic
1129107456 15:73319508-73319530 CAGCCAGCCCTGGCAGTAGGGGG + Intergenic
1129719811 15:77871912-77871934 GACCCCACCCTGTAAGGAGCTGG + Intergenic
1132575128 16:660621-660643 CACCCACCGCTGGCGGGAGGCGG - Exonic
1134890423 16:17836915-17836937 CACCCAACCTTGAAAAGAGCTGG - Intergenic
1136284323 16:29232320-29232342 CCCCCACCCCTGCCAGCAGCCGG - Intergenic
1137676952 16:50308505-50308527 CACCCAACCTTGACCAGAGCAGG - Intronic
1138721779 16:59090703-59090725 CAGCCAACCCTCCCAGAAGCTGG - Intergenic
1138902933 16:61296496-61296518 CACTCCTCTCTGGCAGGAGCAGG + Intergenic
1139531560 16:67545089-67545111 CAGCCAAGCCTGGCTGGCGCAGG - Exonic
1139548162 16:67659480-67659502 CACCCCAGCCTGGCCGGCGCTGG - Intronic
1139655030 16:68382363-68382385 CACCCAGGGCTGGCAGGGGCAGG + Intronic
1139826688 16:69762564-69762586 CACCCCACTCGGGCGGGAGCCGG - Intronic
1139842431 16:69892348-69892370 CACCCACCCCTGACAGGCCCCGG + Intronic
1140191450 16:72820523-72820545 CTCCAAATCCTGGCATGAGCCGG - Intronic
1142089356 16:88201826-88201848 CCCCCACCCCTGCCAGCAGCCGG - Intergenic
1142196877 16:88743067-88743089 CACCCACACCTGGCAGGAAGCGG + Intronic
1143135883 17:4711987-4712009 CTCCCCAGCCTGGCAGGAGGTGG + Intronic
1143548452 17:7614392-7614414 CCCCCTCCCCTGGCCGGAGCAGG - Intronic
1143798931 17:9361753-9361775 CACCAATAACTGGCAGGAGCTGG + Intronic
1144842609 17:18197416-18197438 CACCCATCCCTGGCTGCAGTTGG - Intronic
1145013640 17:19383396-19383418 CACCGAGCCATGGCAGGATCGGG + Exonic
1145118796 17:20236909-20236931 CTCCCAATCATGGCAAGAGCTGG - Intronic
1145229789 17:21165239-21165261 CACCCACCCCTGACAGAAACTGG - Intronic
1146736373 17:35242483-35242505 CACCTATGCCTGGCAGGTGCTGG + Intergenic
1147331308 17:39700800-39700822 CACCCGACCCCGCCAGAAGCAGG - Intronic
1148213974 17:45824561-45824583 CACCCAACCCTGCCAGGACAGGG + Intronic
1148343726 17:46889639-46889661 CTCCCAACCCTGGATGGAGGGGG + Intergenic
1148701288 17:49588546-49588568 CACCCAGGCTTGGCAGGAGCAGG - Intergenic
1150103516 17:62444566-62444588 CACCGCACCCGGCCAGGAGCAGG + Intronic
1150388903 17:64779933-64779955 CACCCAGCCGGGGCGGGAGCGGG - Intergenic
1150854783 17:68741366-68741388 CTCACACCCCTGACAGGAGCAGG - Intergenic
1151494046 17:74449030-74449052 TTCCCAAGCCTGGGAGGAGCAGG - Intronic
1152540451 17:80971915-80971937 AACCCAGGGCTGGCAGGAGCTGG + Intergenic
1152684135 17:81685526-81685548 CACCCCAGCTTGGCAGCAGCTGG - Intronic
1153636667 18:7118160-7118182 CACGCGCCCCTGCCAGGAGCTGG + Intergenic
1155538353 18:26840967-26840989 TTCCCAACCCTGGCAGGAGAAGG + Intergenic
1156221733 18:35059752-35059774 CAGCCAACCCTGCCAAGTGCTGG + Intronic
1156453549 18:37280150-37280172 CACCCCACCTGCGCAGGAGCTGG + Intronic
1161010165 19:1956027-1956049 GACCCAACGCTGTCGGGAGCTGG - Intronic
1161889418 19:7023747-7023769 CACCCTGCCCTGGCAGGACTTGG - Intergenic
1161892034 19:7047000-7047022 CACCCTGCCCTGGCAGGACTTGG + Intergenic
1162158437 19:8695622-8695644 CTCCCGACCCTGGCAGGGACAGG + Intergenic
1162205716 19:9054749-9054771 CACCCAACCAGGGCGGGAGAGGG + Intergenic
1162584747 19:11551958-11551980 CTGCTAGCCCTGGCAGGAGCCGG - Intronic
1162871391 19:13589380-13589402 CTCCCCAGCCTGGCAGGCGCCGG - Intronic
1163587862 19:18173653-18173675 CCCCCACCCCTGCCAGGTGCTGG - Exonic
1163727239 19:18929628-18929650 CACCCTTTCCTGGCAGGACCTGG - Exonic
1164145777 19:22511653-22511675 GACCCAGGACTGGCAGGAGCAGG + Intronic
1164886321 19:31781767-31781789 CACCAAAGCCTGGAAGGAGAAGG + Intergenic
1165293091 19:34904953-34904975 CTCCCTACCCTGGGAGGATCTGG + Intergenic
1167249736 19:48393572-48393594 TCCCCAAGCCTGGCAGGAGAAGG + Intergenic
1168427664 19:56252277-56252299 TACCCAAACCTGGCTTGAGCAGG + Intronic
925062622 2:905037-905059 CACCCAGGCCTGGCATGAGCAGG + Intergenic
925360736 2:3278513-3278535 CACAGCACCCTGGCAGGAGCAGG + Intronic
928332251 2:30366667-30366689 AACCTAACCCTGCCAGGAGCAGG + Intergenic
928359210 2:30649320-30649342 CTCCCTTCCCTGGCAGGTGCTGG - Intergenic
928737633 2:34310635-34310657 CACCCAAACCTGGGAGGCGGAGG - Intergenic
929602402 2:43212651-43212673 CACCCAACCCTGGCCCCACCGGG - Intergenic
929856702 2:45643643-45643665 CACCCCACCCCGGCCGGAGCCGG - Intergenic
929927715 2:46229396-46229418 CAGCCTTCCCTGGCTGGAGCTGG + Intergenic
930116180 2:47720314-47720336 CACCCCACCCTCCCAGTAGCTGG + Intronic
930762132 2:55049431-55049453 CACCCACCCGTAGTAGGAGCCGG - Intronic
930765564 2:55081777-55081799 CACTCGAGCCTGGCAGGTGCAGG + Intronic
931528514 2:63186134-63186156 AATCCCACCCTGGCATGAGCTGG + Intronic
932442789 2:71748409-71748431 CAGCCAACCCTGGCCACAGCAGG - Intergenic
932885267 2:75543574-75543596 CACCCCACCCCGCAAGGAGCTGG + Intronic
933842835 2:86301318-86301340 CCCCTGACCCTGGCAGGAACTGG - Intronic
934751655 2:96797771-96797793 CAGCCACCCCTGGAAGGGGCCGG + Intronic
934890137 2:98060420-98060442 TACCCATCCCTAGGAGGAGCTGG + Intergenic
937919003 2:127117400-127117422 CACCCAACGCTGGTGGGAGTGGG + Intergenic
939177065 2:138760961-138760983 CAAACATCCCTGGCAAGAGCAGG + Intronic
946178739 2:217937572-217937594 CCCCCAACTCTGGCAGTCGCTGG - Intronic
949043484 2:241859689-241859711 CACCCCACCCTGGCACGAGTGGG - Intergenic
949075190 2:242052748-242052770 TACCCACCACTGGCAGGAGCAGG + Intergenic
1170862010 20:20114184-20114206 CACCTAACCCTGGGAGGTGGAGG + Intronic
1171813203 20:29762169-29762191 CTCCCAACCCCTCCAGGAGCCGG + Intergenic
1172297790 20:33825876-33825898 CTCCTAAACCTGGAAGGAGCTGG - Intronic
1172654624 20:36529267-36529289 CACGCAGTCCTGGCAGAAGCAGG + Intergenic
1173180733 20:40804600-40804622 CAACCAAGGCTGGCAGGATCTGG - Intergenic
1173614518 20:44394147-44394169 CAGCCAGCCCTGGGAGGAGGGGG + Intronic
1173993419 20:47320036-47320058 AACCCAAGCCAGGCAGGGGCTGG - Intronic
1174369687 20:50078161-50078183 TACACAAACCTGGCAGGGGCTGG + Intergenic
1174410303 20:50330767-50330789 CTTCCCACCCTGGCTGGAGCAGG - Intergenic
1175208212 20:57328229-57328251 CACCCCACCCATGCAGGACCAGG + Intergenic
1175276229 20:57772755-57772777 CATCCACCCCAGGCAAGAGCAGG + Intergenic
1175301401 20:57945877-57945899 CACTGAAACCTAGCAGGAGCTGG + Intergenic
1177517847 21:22177817-22177839 CACCCAAACGTGCAAGGAGCCGG + Intergenic
1180090198 21:45530457-45530479 GACCCCATCCAGGCAGGAGCGGG - Intronic
1180897981 22:19351174-19351196 CTCCACAACCTGGCAGGAGCTGG - Intronic
1181485015 22:23225064-23225086 CAGCCAAGCCTGCCTGGAGCAGG + Intronic
1181829902 22:25551909-25551931 CACCCACCCCTGACAGGCCCTGG + Intergenic
1182494751 22:30698111-30698133 CACGTAACCCTGACAGCAGCAGG + Intronic
1182524450 22:30906661-30906683 CCCCCAACCCAGGGAGGAACTGG + Exonic
1183214850 22:36472976-36472998 CACCCAGCCCTGGCATTACCTGG + Intronic
1183330684 22:37219354-37219376 CACCAAGCTGTGGCAGGAGCTGG - Intergenic
1184122411 22:42460699-42460721 CACCCAAGCCCTGCTGGAGCTGG - Intergenic
1184281864 22:43442001-43442023 CGCCCTCCCCTTGCAGGAGCAGG + Intronic
1184393857 22:44221093-44221115 AACCCCACCCTGGCAGGCGTGGG + Intergenic
1184779791 22:46641649-46641671 CACCCAACCCCGCCACGACCAGG - Intronic
1184986665 22:48140593-48140615 CCCCCAACCCTGTCATCAGCAGG + Intergenic
950309226 3:11941463-11941485 CACCTTACCCTGGCAGGTGGAGG - Intergenic
950464132 3:13143316-13143338 CACCCATCCCAGAAAGGAGCGGG - Intergenic
951587960 3:24234613-24234635 CACCTAAGCCTTGCAGGAGTGGG - Intronic
952878360 3:37967138-37967160 CCCCCACCCAAGGCAGGAGCTGG + Intronic
953381560 3:42476446-42476468 CACCACACCCTGGGAGGAGGAGG - Intergenic
953586406 3:44205226-44205248 CACCCAACCTAGGGAAGAGCGGG - Intergenic
954036366 3:47853210-47853232 CACCCCACCCTGTCAGGGGGTGG - Exonic
954070690 3:48140934-48140956 CACCCAAGCCTGGGAGGTGGAGG - Intergenic
954373547 3:50182840-50182862 CCCCAAGCCCTGGCTGGAGCAGG - Intronic
954374795 3:50188607-50188629 CCCCCAACCCAGGCAGGGGCTGG - Exonic
954538775 3:51380318-51380340 CTCCCCAGCCTGGCAGAAGCTGG + Intronic
956750321 3:72339862-72339884 CACCTCACCCTGGCGGGGGCTGG + Intergenic
958075961 3:88678905-88678927 CACCCCCACCTGGGAGGAGCAGG - Intergenic
961447326 3:126987008-126987030 CACCCACTCCTGGCTGGAGCCGG - Intergenic
964052813 3:152417555-152417577 CTCCCAAACCTTGGAGGAGCAGG + Intronic
964376032 3:156050015-156050037 CACCCAAGTCTGGAAGGAGAAGG - Intronic
968560623 4:1279421-1279443 CACACTAACCTGGCAGGAACTGG - Intergenic
968907787 4:3462670-3462692 CCCCCATCCCAGGCAAGAGCAGG - Intergenic
969584923 4:8085957-8085979 CACCCACCCCTGCCAGGTACAGG + Intronic
970412211 4:15819173-15819195 CACCCACCCCTGACAGGCCCTGG - Intronic
974921126 4:68240464-68240486 TACAGAACCCTGGCTGGAGCAGG - Intronic
975707034 4:77121722-77121744 CACTCCTCTCTGGCAGGAGCAGG + Intergenic
976205382 4:82619070-82619092 TAACCAACCCAGTCAGGAGCAGG + Intergenic
978019784 4:103793238-103793260 CCCCCAACCCTGACAGGCCCTGG - Intergenic
980454402 4:133020449-133020471 CCCCCAACCCTGACAGGCCCTGG - Intergenic
981391865 4:144200297-144200319 CCCCCAACCCTGACAGGCTCTGG - Intergenic
984983608 4:185306062-185306084 CACATAACTCTGGCATGAGCTGG + Intronic
985818545 5:2144695-2144717 AGCCCAACCCTGGAAGGAGATGG + Intergenic
985987004 5:3524204-3524226 AACAAAACCCTGGCAGTAGCCGG - Intergenic
986170102 5:5308061-5308083 CATGCAACCCTGGCCGGAGGCGG - Intronic
986371554 5:7085569-7085591 CGCCCAACCCCTGCAAGAGCTGG + Intergenic
994227217 5:97266675-97266697 CACTCAAACTTGGCAGCAGCAGG - Intergenic
996426093 5:123314680-123314702 CACCCAACCCTGACAGGCCCTGG + Intergenic
998544377 5:143014138-143014160 CTCCCAACCCTGGCTGTAGAAGG - Intronic
998827784 5:146121813-146121835 CACCCCACCCTGACAGGCCCTGG - Intronic
999241725 5:150131880-150131902 CACCCACCCATGGGAGGAGTGGG - Intronic
999480816 5:151946768-151946790 CAGCCACCCCAGGCTGGAGCAGG + Intergenic
999828794 5:155299482-155299504 TGCCCAGCCCTGGCAGCAGCTGG + Intergenic
1001274354 5:170339420-170339442 CCCCCAACCAGGGCAGGAGCTGG - Intergenic
1001561804 5:172674636-172674658 AGCACAACCCTGGCAGCAGCTGG - Intronic
1001939362 5:175729613-175729635 AACCCAACCCGGGCAGGAGTGGG - Intergenic
1002598027 5:180336805-180336827 CACCCTAGCTAGGCAGGAGCAGG - Intronic
1002756499 6:165497-165519 GACCCAAACCTGGCTGGACCTGG - Intergenic
1006296243 6:33171316-33171338 CACCTCACCCTGGGAGGAGAAGG + Exonic
1006425994 6:33963329-33963351 CAGCCCACCCTGGCTGGTGCAGG - Intergenic
1006452088 6:34111160-34111182 GATCCAACCCTTCCAGGAGCTGG + Intronic
1006850335 6:37093476-37093498 CCACCACCCCTGGCTGGAGCAGG + Intergenic
1007285283 6:40743256-40743278 CACCAAACCCTAGCAGTAGGGGG + Intergenic
1011040055 6:83019990-83020012 CAGCCAACGCTGTCAGCAGCTGG + Intronic
1013263851 6:108474039-108474061 CACCAGAGCCTGTCAGGAGCCGG - Intronic
1014265214 6:119269351-119269373 CACACAACCTTGGGAGCAGCAGG + Intronic
1019367803 7:644319-644341 CACCCCACACTGTGAGGAGCTGG + Intronic
1022892344 7:34714301-34714323 CCCTGAACCCTGGCTGGAGCTGG - Intronic
1022970519 7:35512949-35512971 TACCCAGCCCTGGCTGGAGGTGG - Intergenic
1024583725 7:50823161-50823183 CAGCAAACCTTGTCAGGAGCTGG - Intergenic
1026024198 7:66732071-66732093 CACCAGGCCCTGGCAGAAGCAGG - Intronic
1026888922 7:73970963-73970985 CACCAGGCCCTGGCAGAAGCAGG - Intergenic
1028154925 7:87418875-87418897 CTCCCAGCCTTGGGAGGAGCTGG - Intronic
1030870457 7:114749398-114749420 CCCCCAACCCTGACAGGCCCTGG + Intergenic
1032196771 7:129793956-129793978 CACCCAAAGTGGGCAGGAGCAGG + Intergenic
1034497647 7:151431985-151432007 ATCCCAGCCCTGGGAGGAGCTGG - Intronic
1034547160 7:151796674-151796696 AATCCAGCCCTGGGAGGAGCCGG - Intronic
1034849341 7:154479472-154479494 CACTCAAACCTGGGAGGTGCAGG + Intronic
1035231912 7:157470385-157470407 CACCCAACCCAGGCCAGCGCCGG - Intergenic
1035231921 7:157470419-157470441 CACCCAACCCAGGCCAGCGCCGG - Intergenic
1035231930 7:157470453-157470475 CACCCAACCCAGGCCAGCGCCGG - Intergenic
1035231939 7:157470487-157470509 CACCCAACCCAGGCCAGCGCCGG - Intergenic
1035231948 7:157470521-157470543 CACCCAACCCAGGCCAGCGCCGG - Intergenic
1035231957 7:157470555-157470577 CACCCAACCCAGGCCAGCGCCGG - Intergenic
1035231966 7:157470589-157470611 CACCCAACCCAGGCCAGCGCCGG - Intergenic
1035231987 7:157470683-157470705 CACCCAACCCAGGCCAGCGCCGG - Intergenic
1036656552 8:10680900-10680922 CAGGCAGCCCAGGCAGGAGCGGG + Intronic
1039753486 8:40498163-40498185 CAGCCAGACCTGGCAGGACCTGG - Intergenic
1041634229 8:60124823-60124845 CGCCCAACCCTGACAGGCCCTGG + Intergenic
1042406927 8:68416613-68416635 CACTCAAACCTGGTAGGAGGAGG - Intronic
1045430885 8:102114244-102114266 CACCCATCCCTACCAGGAGCTGG + Intronic
1047220888 8:122917288-122917310 CTCCCAACTCTGGCAGGGGCAGG - Intronic
1048330337 8:133466630-133466652 CCCCCATCCCTGGCCGGGGCTGG - Intronic
1048331267 8:133472233-133472255 GTCCCAGCCCTGGCAGGAACAGG - Intronic
1048442443 8:134469881-134469903 CATCCCACCCTGACCGGAGCTGG + Intergenic
1048799983 8:138186437-138186459 CCCCCACCACTGGCAGGAGTGGG + Intronic
1049394818 8:142395068-142395090 CCCCCTTCCCTGCCAGGAGCAGG - Intronic
1049584402 8:143426207-143426229 CAGCCAGACCTGGCTGGAGCCGG - Intronic
1051720558 9:20032790-20032812 GACCCAACCCAGGGAGGAGTGGG + Intergenic
1052997656 9:34559741-34559763 CCCCCAGCGGTGGCAGGAGCGGG - Intronic
1053128078 9:35599061-35599083 CACCTACACCTGGCAGGGGCGGG - Intergenic
1053281173 9:36820570-36820592 CACACAGCCCTGGGAGGATCAGG + Intergenic
1054747270 9:68867263-68867285 CACGCCACCCTGGCAGGTGCCGG + Intronic
1056311897 9:85349186-85349208 CTCCCTACCCCGGTAGGAGCAGG + Intergenic
1056722131 9:89081651-89081673 CATCCAGCCCAGGGAGGAGCAGG - Intronic
1057037866 9:91824826-91824848 CAGCCTGCCCTGGCAGGAGGGGG + Intronic
1057043634 9:91866499-91866521 CACTCAAACCTGGCAGGTGGAGG - Intronic
1057182373 9:93037066-93037088 CACCCAGCTCAGGCTGGAGCAGG + Intergenic
1057686194 9:97237333-97237355 CCCCCATCCCTGGAAGGCGCTGG + Intergenic
1057759862 9:97863343-97863365 GAACCAACCCTGGCTGAAGCTGG - Intergenic
1058063571 9:100524894-100524916 CCCCCACCCCTGGCAGGCCCCGG + Intronic
1058693729 9:107541334-107541356 CACACAACCCTTGCAACAGCAGG + Intergenic
1062188105 9:135229344-135229366 CACTCTGCCCTGGGAGGAGCAGG + Intergenic
1062454005 9:136627236-136627258 CAGCCAGTCCTGGCAGCAGCAGG - Intergenic
1062456980 9:136644587-136644609 CGCCCAAGGCTGGCAGCAGCAGG + Intergenic
1062475085 9:136722721-136722743 CACCCAAGGCTGCCAGGAGGCGG + Intronic
1187597238 X:20786213-20786235 CCCCCAACCCTGACAGGCCCTGG + Intergenic
1189123890 X:38425238-38425260 CACGCAACCCTGTCAGCAGCTGG - Intronic
1190511065 X:51174974-51174996 CCCCCACCCCTGGCAGGCTCCGG - Intergenic
1190706593 X:53033850-53033872 CACCTAAACCTGGGAGGAGGAGG + Intergenic
1190778596 X:53575720-53575742 CACCCATGTCTTGCAGGAGCTGG + Exonic
1190885691 X:54529655-54529677 TACCCAACCCGAGCTGGAGCAGG - Intergenic
1190965243 X:55293744-55293766 CACCCATGCCTGTCAGGAGGTGG - Intergenic
1192167395 X:68834543-68834565 CCCCCGAGGCTGGCAGGAGCAGG - Intronic
1192234951 X:69289797-69289819 CACCCAACTGTGGCAGGAAATGG - Intergenic
1192251382 X:69416847-69416869 CACCCAACACTCGGAGCAGCCGG + Intergenic
1192429720 X:71103688-71103710 CACCTAACCCCTGCAGGAGTAGG + Intergenic
1195264243 X:103164466-103164488 GACACCACCCTGGCAGGAGGGGG + Intergenic
1197747234 X:129939833-129939855 CAGCCCAACATGGCAGGAGCAGG + Intergenic
1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG + Intergenic