ID: 1090299851

View in Genome Browser
Species Human (GRCh38)
Location 11:125626042-125626064
Sequence AGGTTTCTAAAGAAGGAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 256}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090299845_1090299851 9 Left 1090299845 11:125626010-125626032 CCGGTGAGGAAGGGCGGCCGGTA 0: 1
1: 0
2: 1
3: 12
4: 72
Right 1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG 0: 1
1: 0
2: 5
3: 26
4: 256
1090299849_1090299851 -8 Left 1090299849 11:125626027-125626049 CCGGTAGAGTAGGGAAGGTTTCT 0: 1
1: 0
2: 1
3: 12
4: 112
Right 1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG 0: 1
1: 0
2: 5
3: 26
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090299851 Original CRISPR AGGTTTCTAAAGAAGGAGTT CGG Intronic
901173398 1:7280439-7280461 AGGTTTCTGCAGAAGCAGCTTGG + Intronic
901544301 1:9943852-9943874 AGATTTGGAAAGAAGGATTTAGG - Intronic
905641710 1:39594519-39594541 AGGTATATGATGAAGGAGTTGGG - Intergenic
907676061 1:56518991-56519013 AGGCTTCTAAAGAAGGTGGGTGG + Intronic
907822056 1:57979826-57979848 AGGGATCTAAAGAAGGAATTAGG - Intronic
908564571 1:65341249-65341271 TGGTTTCCAAAGAAGGAACTAGG - Intronic
908672560 1:66564153-66564175 AGATCTCTAAAGAAGCAATTTGG + Intronic
908947290 1:69514465-69514487 TGGTTTTTAAAGATGGTGTTTGG - Intergenic
910810611 1:91231886-91231908 AAGTTTCTAAAGAAGAACCTGGG + Intergenic
911021719 1:93396086-93396108 AGCTTTCTGAAGAAGAAGTCAGG + Intergenic
911409491 1:97484448-97484470 AGATTTCTAAACATGGATTTAGG - Intronic
912145808 1:106792709-106792731 AGGTTGGTCAAGAAAGAGTTCGG + Intergenic
914812131 1:151036690-151036712 AGGTGTTTAAAGAAGGAGGCAGG + Exonic
915701962 1:157804742-157804764 AGGTTTGTAAAGAAGCTGTGTGG - Intronic
916286620 1:163112417-163112439 AGAGTGGTAAAGAAGGAGTTTGG + Intronic
919792254 1:201299828-201299850 TGGTTTGGAAAGAGGGAGTTGGG - Intronic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
922890270 1:229056754-229056776 AGTGTTCTAAGCAAGGAGTTAGG + Intergenic
922970107 1:229729036-229729058 GGGTTGTTAAAGAAGGGGTTTGG - Intergenic
923016586 1:230131163-230131185 AGGTTTCTAAAAAACGACTCAGG - Intronic
923277343 1:232408773-232408795 AGATTTCTAAAGAATGTGATAGG - Intronic
1063295530 10:4801475-4801497 ATGTTTCTCAGGAAGGGGTTTGG - Intronic
1063942006 10:11140399-11140421 AAATGTCTAAAGACGGAGTTGGG - Intronic
1064837966 10:19555798-19555820 TGGTCTCTAAAGATTGAGTTGGG + Intronic
1067797120 10:49328663-49328685 AGGTTTCTAAACAAAGAGGGAGG - Intergenic
1070835359 10:79444435-79444457 AGGTTTCTGCAGAAGGCGCTGGG + Intronic
1072953559 10:99869698-99869720 AGGAATCTAAAGAAGCAGTCTGG + Intergenic
1073988590 10:109238211-109238233 TGGTTTCTCTGGAAGGAGTTAGG - Intergenic
1074838108 10:117319488-117319510 GAGTTTCTAGAGGAGGAGTTGGG - Intronic
1076128215 10:127992678-127992700 AGGTTTCTAGAGCAGGTGTCTGG - Intronic
1076712165 10:132343474-132343496 AGCTTTTTAAAGAAGGAGTTTGG + Intronic
1077532714 11:3104674-3104696 AGGTTTCAACAGCAGGTGTTGGG - Intronic
1077533579 11:3108373-3108395 AGGTTTCTGCAGGTGGAGTTAGG + Intronic
1077693855 11:4375507-4375529 ATTATTCTAAAGAAGGAGTTGGG + Intergenic
1078226792 11:9399460-9399482 AGCATTTTAAAGAAGGATTTTGG + Intronic
1078353846 11:10618631-10618653 AGATATCTAAAGATTGAGTTGGG + Intronic
1078409655 11:11103676-11103698 GGCTTTCTAAAGAAGGAGTTTGG + Intergenic
1080011240 11:27461813-27461835 AGGTTCCCAAAGATTGAGTTAGG + Intronic
1080070820 11:28084525-28084547 ATGTTTCTACATAATGAGTTAGG - Intronic
1080112075 11:28579680-28579702 AGCTTGCTAAAGAAAGAATTAGG - Intergenic
1080139796 11:28902876-28902898 AGGTTTCTATATAAAGGGTTAGG + Intergenic
1081263942 11:40995848-40995870 AGGTTACTAAAAAATGAATTTGG - Intronic
1081700635 11:45150434-45150456 AGGATTCAACAGAAGGTGTTTGG - Intronic
1083262203 11:61529245-61529267 AGGTTTCTACAGGGGAAGTTGGG - Intronic
1085761402 11:79244319-79244341 TGTGTTCTGAAGAAGGAGTTAGG + Intronic
1086165978 11:83778658-83778680 AGTTTTCTAATTTAGGAGTTAGG + Intronic
1086268930 11:85035980-85036002 AGGTTTCAAAATAAAAAGTTAGG + Intronic
1086968821 11:93058359-93058381 AGGGTTTTAAAGAAAAAGTTGGG + Intergenic
1087672467 11:101124510-101124532 ATCTTTCAAAAGAAGGAGCTGGG + Intronic
1088121597 11:106376698-106376720 ATGTTTCAAAACAGGGAGTTGGG + Intergenic
1088572000 11:111231408-111231430 AGGTTTCTAGAGGTGGAGTGAGG - Intergenic
1089393925 11:118122387-118122409 ATTTTTCTAAATAAGGATTTAGG + Intergenic
1090299851 11:125626042-125626064 AGGTTTCTAAAGAAGGAGTTCGG + Intronic
1090404067 11:126466812-126466834 AGCTTTCTGAAGCAGGAGGTGGG - Intronic
1092233903 12:6793568-6793590 AGGTTTCTGAAAAAGGAGGAAGG - Intronic
1093005690 12:14048405-14048427 AGATTTCTGAAGAAGGAAATGGG - Intergenic
1093822430 12:23637852-23637874 AGTTTTCTAAAGCCGGAGGTGGG + Intronic
1093955022 12:25207050-25207072 AGTTTTGCAAAGAAGGGGTTTGG - Intronic
1096010956 12:48213923-48213945 GGGTTTCTGCAGAAGCAGTTGGG + Intergenic
1096999681 12:55866065-55866087 AGCTTTTTGAAAAAGGAGTTTGG + Intergenic
1097598682 12:61665869-61665891 AAATTTTTTAAGAAGGAGTTTGG + Intergenic
1097619536 12:61923028-61923050 AGGAATCTAAAGAAGCAGTGTGG - Intronic
1098929860 12:76398770-76398792 ACATTTAGAAAGAAGGAGTTGGG + Intronic
1099222212 12:79928462-79928484 AGGTTTTTAAAAATGGATTTAGG + Intronic
1099312122 12:81039556-81039578 AAGTTTCTAAAGAAGCAATGAGG + Intronic
1099818279 12:87675977-87675999 AGGTTTCAAAATACGGATTTTGG + Intergenic
1100289681 12:93201926-93201948 AGCAGTCTTAAGAAGGAGTTTGG - Intergenic
1103179966 12:118902256-118902278 AGGTATCTAAAAAAGGACCTGGG - Intergenic
1105591471 13:21796627-21796649 ATGTTTCTAAAGAAATAGCTTGG + Intergenic
1105720268 13:23106840-23106862 AGTTTTTTAAAAAAGGAGTTTGG - Intergenic
1106967388 13:35087928-35087950 AGTTTTCTATAGCTGGAGTTTGG + Intronic
1108083456 13:46761048-46761070 ACGCATATAAAGAAGGAGTTTGG - Intergenic
1108236857 13:48416850-48416872 AGGACTCTAGAGAAGCAGTTGGG - Intronic
1108671428 13:52693315-52693337 CAGTTTCTTTAGAAGGAGTTAGG + Intronic
1108703800 13:52966822-52966844 AGATTTCTAAAGAAGGAATTTGG - Intergenic
1109674591 13:65658405-65658427 ATGTTTCTCAAGATGTAGTTTGG - Intergenic
1110987512 13:81989254-81989276 ACTTTTCTAAAGAAGGAGAATGG + Intergenic
1111056101 13:82953034-82953056 AGGAATCTAGAGAAGGAGTCTGG - Intergenic
1111859784 13:93688082-93688104 TGGCTTCTAAAGAATGAATTGGG - Intronic
1112867192 13:103919126-103919148 AGGTTGCTAAAGAAGGAACAAGG + Intergenic
1114187557 14:20414314-20414336 AGGTTTCTAAGGAAGGAAAGGGG - Intergenic
1115339103 14:32273135-32273157 AGGGATCTAAAGAAGCAGTCTGG - Intergenic
1116975201 14:51108312-51108334 AGGATTCAAAAGAAGGAGCTGGG + Intergenic
1117348118 14:54854159-54854181 ATTATTCTAAATAAGGAGTTTGG + Intronic
1118926987 14:70200000-70200022 AGGTATCTAGAGAAGCAGTCTGG + Intergenic
1120155063 14:81084392-81084414 AGGTTTAAAAAGAAGGAATGTGG - Intronic
1120233817 14:81868123-81868145 AGGTTTCTGAAGAAGGGACTTGG + Intergenic
1121238234 14:92409058-92409080 GGGTTTCTATAGAAAGAGGTGGG + Intronic
1121823064 14:96987298-96987320 ATGTTTCTAAAGAGGAAATTGGG + Intergenic
1122074251 14:99225616-99225638 AGCTGTCTTAAAAAGGAGTTTGG - Intronic
1125249639 15:37685152-37685174 AGGTTTCTAAGGAAGCACTGAGG - Intergenic
1125261046 15:37825058-37825080 AGGTTTCTAGAGACGCAGTCTGG - Intergenic
1126805342 15:52342611-52342633 AGGTTTTTAAAGAAGGTGTTTGG + Intronic
1129423277 15:75447166-75447188 AGGTTTCAAAAGAATCACTTGGG + Intronic
1131756023 15:95563702-95563724 AGTTTTGTAAATAAGGAATTCGG - Intergenic
1132365411 15:101252774-101252796 GGATTTCTAAAGACGGATTTTGG + Intergenic
1134483816 16:14640929-14640951 AGGTTTCTGAATAAAAAGTTGGG - Intronic
1135741733 16:24981142-24981164 AGGTTACTGAGCAAGGAGTTGGG - Intronic
1135827662 16:25743854-25743876 ATGTTGCTACAGAAGGAGCTAGG - Intronic
1138817751 16:60222132-60222154 AGTTTTCACAAGAAGGAGTTGGG + Intergenic
1140052841 16:71498075-71498097 TGTTTTCTAAAGATGGTGTTTGG + Intronic
1140597901 16:76437637-76437659 AGTTTTCAAAATAAGGAGTTGGG - Intronic
1141215078 16:82016219-82016241 AGGATTCAAAAGAAGCAGGTTGG - Intergenic
1142425689 16:90001143-90001165 AGGGTTCTAAAGCAGCTGTTTGG + Intergenic
1143111267 17:4554324-4554346 AGGTTTGTGAAGACGTAGTTGGG - Intronic
1144285146 17:13766957-13766979 AGCTTTGTAAAGAAGGTGGTTGG + Intergenic
1144314138 17:14042725-14042747 AGGTTTCTAAAATATGAGTTGGG + Intergenic
1144366999 17:14554188-14554210 AGGTCTCAGAAGAAGGAGGTTGG + Intergenic
1144599381 17:16599131-16599153 AGTTTTCTAAAGAGGGACCTGGG + Intergenic
1150875784 17:68968800-68968822 GGCTTTCTAAAGAAGGAGATGGG - Intergenic
1151140134 17:71983798-71983820 GTGTTTCTGGAGAAGGAGTTGGG - Intergenic
1153907271 18:9673307-9673329 AGGTTTCTGAAGAACAAGTGTGG - Intergenic
1155311503 18:24528893-24528915 GGGTTCCTAGAGAAGGAGCTAGG - Intergenic
1156084602 18:33383128-33383150 AGGGATCTAAAGAAGCAGTCTGG - Intronic
1157897452 18:51482674-51482696 AGGTTTCAACAGAGGGATTTTGG - Intergenic
1157932329 18:51836677-51836699 AGATGTGTAAAGATGGAGTTAGG - Intergenic
1159349791 18:67257972-67257994 AGGTTTCTAAATATGAATTTTGG + Intergenic
1160348180 18:78151931-78151953 AGGTTTCCAAAGAAGGGATTCGG + Intergenic
1160914961 19:1491904-1491926 ATGTTTGTTAAGACGGAGTTGGG + Intronic
1161787966 19:6339971-6339993 AGGTTTTTAAAAGAGGGGTTTGG + Intergenic
1161865457 19:6829295-6829317 AGGTTTCTAGATAGGCAGTTGGG + Intronic
1162684264 19:12368661-12368683 GGGTTTTTAAAGAAAGGGTTTGG - Intergenic
1166096211 19:40541146-40541168 AGGTTTTAGAGGAAGGAGTTGGG + Intronic
1166418656 19:42615802-42615824 AGGTTTTACAAGAAGGAATTTGG - Intronic
1166570858 19:43796193-43796215 AGGTTTCAAAAGATGAATTTTGG + Exonic
1167262831 19:48468758-48468780 ATGGTGATAAAGAAGGAGTTCGG + Intronic
1168557142 19:57352522-57352544 AGGTATCAGAGGAAGGAGTTAGG + Intronic
925235521 2:2273738-2273760 AGGTTACTAAGGAGGGAATTTGG + Intronic
926185075 2:10683973-10683995 AAGTTTCTTAAGAAGGAGAAAGG + Intronic
928199607 2:29239307-29239329 AAGTTTCTGGAGAAGGAGCTGGG + Intronic
928632659 2:33209774-33209796 AGGTTTTTAAAGGAGGAGCCTGG + Intronic
929490919 2:42395398-42395420 AGGCTGTTTAAGAAGGAGTTGGG + Intronic
929869160 2:45743691-45743713 AGGTTTTGAAAGAAGCAGTCGGG - Intronic
931659420 2:64544814-64544836 AGGTTTCTAAAGGGTAAGTTGGG + Intronic
931692538 2:64847495-64847517 TGATTTTTAAAAAAGGAGTTGGG - Intergenic
932903051 2:75722181-75722203 AGTCTTCTAAAGAAGGAATTAGG + Intergenic
933324264 2:80815562-80815584 AGGAATCTAAAGAAGCAGTCTGG - Intergenic
936285112 2:111175695-111175717 AGGATTCTAAAGGATGATTTGGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937627487 2:124059664-124059686 AGGGCTGTTAAGAAGGAGTTGGG + Intronic
937679127 2:124625342-124625364 AGTTTTCTAAAGCATGAGCTGGG + Intronic
937813916 2:126230067-126230089 AGGTTTCTGAATAAACAGTTGGG + Intergenic
938575040 2:132595828-132595850 AGGTTTCTAATGAAAGTGCTAGG + Intronic
938751937 2:134340617-134340639 AGGTTTGTAAAGAAGGAGCCTGG - Intronic
941518695 2:166511289-166511311 AGGAATCTAAAGAAGGAGTCTGG + Intergenic
941665872 2:168243916-168243938 ACCTCTCTAAAGAAGGAATTTGG - Intronic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
945842487 2:214904773-214904795 GGGTTTTTAAAGAAAGGGTTTGG + Intergenic
945959846 2:216121657-216121679 AGGTTTCAAAATAATGATTTTGG + Intronic
946766216 2:223043470-223043492 TTGGTTCTAAAGAAGGACTTAGG - Intergenic
1172196154 20:33093071-33093093 AGTTTTCAAAAGAAAAAGTTTGG - Intronic
1172823767 20:37762308-37762330 AGCTTTCTCAAGAATGAGATTGG - Intronic
1173087942 20:39942377-39942399 AGGTTTAGAAAGCAGGAGTTAGG - Intergenic
1173572048 20:44083626-44083648 GGGTTTCTTTAGAGGGAGTTGGG - Intergenic
1175084723 20:56448624-56448646 GGGTTTCTGTAGAGGGAGTTGGG - Intronic
1175293915 20:57895838-57895860 AGGGTTCTGAAGAAAGATTTAGG - Intergenic
1181375629 22:22455676-22455698 AGCTTTCAAAAGAAAGATTTTGG - Intergenic
1181422501 22:22811585-22811607 AGGTGACTGAAGAAGGAGTTGGG - Intronic
1183163002 22:36127268-36127290 AAGTTTCTAAAGTAGGAAATGGG + Intergenic
1185018296 22:48358441-48358463 AGGGTTTTCAAGTAGGAGTTTGG - Intergenic
1185025814 22:48411284-48411306 AGGTTTCTTCAGAAGGAGAGAGG + Intergenic
949133081 3:529698-529720 AGATTTTTAAAGAAAGATTTTGG + Intergenic
949878254 3:8641207-8641229 AGGATTCTTAAGAAGCCGTTTGG - Intronic
950805513 3:15599782-15599804 AGGGATGTAAAGAAGGAGTGAGG - Intronic
951842247 3:27046968-27046990 AGGTTTTTAAAGAGAGGGTTTGG - Intergenic
952462358 3:33541314-33541336 AGTTTTTTTAAGAAGGAGTTGGG - Intronic
952548187 3:34445845-34445867 AAGTTGCTAAAGAAGGTTTTGGG + Intergenic
954937920 3:54343792-54343814 TGATTTCTAAAGAAGGACATAGG + Intronic
955246819 3:57232519-57232541 AGGTGTCAAAAGAAGGTTTTCGG - Intronic
955248856 3:57257068-57257090 AGTTATTTAAAGAAGGAGATGGG + Intronic
955630907 3:60973780-60973802 AGCTTTCTCAAGTAGGAGTATGG + Intronic
956636487 3:71370452-71370474 ATATTTCTAAAGGAGGAGTTGGG - Intronic
957939356 3:86986081-86986103 AGGTTACTGAAGAAGAAGCTGGG - Intronic
959601077 3:108186353-108186375 AGGTTTCAAAATATGGATTTTGG + Intronic
959640966 3:108634254-108634276 AGGTTTCTCAAGAATGCTTTAGG + Intronic
960201505 3:114842406-114842428 AAGTTTTTAAAGAAGGGGTAAGG - Intronic
961093271 3:124133660-124133682 ATGTTCCTGGAGAAGGAGTTTGG + Intronic
961144312 3:124581475-124581497 TGATTTCTAAAGTAAGAGTTGGG + Intronic
961564280 3:127752501-127752523 ATGATTAAAAAGAAGGAGTTAGG - Intronic
962279783 3:134041124-134041146 AGTTTTCTCAAGAAGGAGTTTGG - Intronic
964301728 3:155294664-155294686 AGGTGTCTAAACAAAGAGTTGGG - Intergenic
964330516 3:155597131-155597153 ATGTTTCTAAAGGAAAAGTTGGG - Intronic
965375987 3:167924746-167924768 ATTTTTCTAGAGAAGGATTTTGG + Intergenic
966420409 3:179729169-179729191 GGATTTATAAACAAGGAGTTGGG + Intronic
967305630 3:188056338-188056360 AGATTGCTAAAGGAGGGGTTTGG - Intergenic
967354313 3:188550950-188550972 TTGTTTCTACAGAAGGAGTTTGG + Intronic
968627351 4:1632200-1632222 CGGTCTCTAAAGAGGTAGTTAGG + Intronic
970274485 4:14383376-14383398 AGGTTTGTAAAGCAGGAGTCGGG - Intergenic
970951070 4:21756016-21756038 CTGATTCTAAAAAAGGAGTTGGG - Intronic
971466050 4:26962045-26962067 AGGTAACTAAAGAAGGAGGCTGG - Intronic
971877651 4:32325962-32325984 AGCTTCCTAGAGAAGGAGTTGGG - Intergenic
973821781 4:54668155-54668177 AGGTTTCTAAAACAGGACTCGGG - Intronic
973980281 4:56303039-56303061 ATGTGTATAAAGAAGGAGTCTGG + Intronic
975468852 4:74740832-74740854 GGGCTTTTAAGGAAGGAGTTGGG + Intergenic
977092033 4:92689666-92689688 ATGTTTCTAAAGATGGGGGTGGG - Intronic
977115286 4:93016611-93016633 AGGTGTCCAAAGAAGGAGCAAGG + Intronic
977124138 4:93142752-93142774 AGGTTTCTAAACAACGACTGTGG + Intronic
977997826 4:103516017-103516039 ATGTTTCTAAACAATGTGTTTGG + Intergenic
978568994 4:110116013-110116035 AGGGTTCTTAACAGGGAGTTGGG - Intronic
978842786 4:113234115-113234137 AGGTTTCTAGTGTAGGATTTAGG + Intronic
979431580 4:120639119-120639141 AGATTTCCAAAGTGGGAGTTAGG + Intergenic
979513949 4:121585543-121585565 AGGCTTGTAAAGTAGGAGTGAGG + Intergenic
979918670 4:126472217-126472239 AACTTTTTAACGAAGGAGTTTGG + Intergenic
981452428 4:144913869-144913891 AGGATTATAGAGAGGGAGTTGGG - Intergenic
983169572 4:164520752-164520774 AGGAATCTAGAGAAGGAGTCTGG + Intergenic
983610683 4:169641653-169641675 ACGTTTCAAAAGAAGAAGCTTGG + Intronic
984769664 4:183426447-183426469 AAGTTTTTAAAGAAAGAATTTGG - Intergenic
986378810 5:7162510-7162532 AGGAATCTAGAGAGGGAGTTTGG + Intergenic
988439072 5:31211468-31211490 AAGTCCCTAAAGAAGGATTTGGG - Intronic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
988965261 5:36410346-36410368 AGGGTACTCAGGAAGGAGTTGGG + Intergenic
989327041 5:40210332-40210354 AGATTTATAAAGAAGGATTAAGG - Intergenic
992217943 5:74543936-74543958 AGCTTTCTAAAGAAGGGATTTGG + Intergenic
992895629 5:81242737-81242759 GGGTTTTTAAAGCAGGAGTGAGG + Intronic
993677670 5:90836707-90836729 ATGTTACTAATGAAGGAGTTTGG + Intronic
994235260 5:97355721-97355743 AGCTATCTAAAGAAGCAGTCTGG + Intergenic
995330654 5:110942170-110942192 AGTTTTCTTAGGAAGGAGCTAGG - Intergenic
995508852 5:112887754-112887776 AGAGCTGTAAAGAAGGAGTTAGG - Intronic
997453594 5:134002445-134002467 GGGATTCTACAGAAGGTGTTGGG - Intronic
998767469 5:145503892-145503914 ATGCTTCTAAAGAAGGAACTGGG + Intronic
1000645331 5:163754615-163754637 GGGTTTTTAAAGAAAGGGTTTGG - Intergenic
1003146502 6:3514642-3514664 AGGCTCTAAAAGAAGGAGTTAGG + Intergenic
1004440930 6:15652946-15652968 TGGTTTCTAAAAAAGGGGCTTGG - Intronic
1005787999 6:29265770-29265792 TGATTTCTAAAACAGGAGTTGGG - Intergenic
1006392744 6:33768383-33768405 TGGTTTCTAAAGAAAGTGATGGG - Intergenic
1006935912 6:37717527-37717549 AGGTCACTAAAGAGAGAGTTGGG - Intergenic
1007602431 6:43090852-43090874 AGTTTTGTAAGGAAGGAGCTAGG + Intronic
1008754184 6:54773879-54773901 AGTTTTGCAAAGAAGGGGTTTGG + Intergenic
1009382378 6:63048495-63048517 ATTTTTAAAAAGAAGGAGTTTGG - Intergenic
1009513253 6:64579983-64580005 TGGTTCCTAAGGAAGAAGTTGGG - Intronic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011593988 6:88998346-88998368 AGGGTTTTCAACAAGGAGTTTGG - Intergenic
1012026909 6:94007670-94007692 AGGTTTCAAAATAAGAATTTGGG - Intergenic
1012922392 6:105233712-105233734 AGGAATCTAAAGAAGCAGTCTGG + Intergenic
1014445555 6:121523309-121523331 AGGTTACTGTAGAAGGAGTAAGG + Intergenic
1014676445 6:124372909-124372931 AGCTTTCTAAAAACAGAGTTTGG + Intronic
1014743607 6:125173594-125173616 AGGCTTCTTAAGAACGAGCTGGG - Intronic
1016608271 6:145960120-145960142 AGGTTTCTGGAAAAGCAGTTTGG + Intronic
1017020521 6:150136427-150136449 AGGTTTCTACAGATGAATTTTGG + Intergenic
1017303327 6:152887582-152887604 AGATTTCTAGCCAAGGAGTTGGG - Intergenic
1017402130 6:154076702-154076724 TAGTTTATAAAAAAGGAGTTAGG - Intronic
1020505850 7:8987045-8987067 AGGATTCTCAAAAGGGAGTTGGG - Intergenic
1020557740 7:9691365-9691387 AGGAATCTAAAGAAGCAGTCTGG - Intergenic
1022210181 7:28200985-28201007 AGGATTCTAAAGAAGAAATATGG - Intergenic
1022736988 7:33085330-33085352 AGGTTTGTCAAGACAGAGTTTGG - Intergenic
1023234115 7:38065900-38065922 AGGTTTCTTAAAAAGACGTTGGG + Intergenic
1024999464 7:55302903-55302925 GGGTTTTTAAAGAAAGGGTTTGG + Intergenic
1027868532 7:83677021-83677043 TGGTTTCTAAATGAAGAGTTAGG + Intergenic
1028429930 7:90735519-90735541 AGGAATCTAGAGAAGGAGTCTGG + Intronic
1030246959 7:107393284-107393306 GGTTTTGTAAAGAGGGAGTTTGG - Intronic
1031326719 7:120408982-120409004 ATGTTTCTTAAGAAGGAGGGAGG + Intronic
1035309906 7:157960428-157960450 ACCTTTCTGAAAAAGGAGTTGGG + Intronic
1036621382 8:10426297-10426319 TGGATTCTACAGAAGGAATTCGG + Intronic
1037131985 8:15417604-15417626 AACGTTGTAAAGAAGGAGTTAGG + Intronic
1037245761 8:16833099-16833121 AGGGTTCTAAAGAACAAATTTGG - Intergenic
1040747451 8:50662706-50662728 AGGTTTCAGAAAAAGGAATTTGG + Intronic
1041591722 8:59594395-59594417 AGGTTTCAACAGAAGGGGTTGGG - Intergenic
1041620982 8:59969076-59969098 TGGTTTCAAAAGAAGAAATTGGG - Intergenic
1044713015 8:95074904-95074926 AGGTTGTAAAAGAAGGAATTTGG - Intronic
1044923851 8:97192972-97192994 AGGTTTCCACAGAAAGAGCTGGG + Intergenic
1045801682 8:106109564-106109586 AGCTTTTTCAAGAAGGAATTTGG + Intergenic
1046325511 8:112639549-112639571 AGTTTTATAAAGAAGGCGCTGGG - Intronic
1047382685 8:124378109-124378131 AGGTTTCAAAGGAAGAAGTTTGG + Intergenic
1048365073 8:133731325-133731347 GGGTTTTTAAAGAAAGAGTTTGG + Intergenic
1048454490 8:134565684-134565706 AGGCTCCTAAAGAAAGAGTAAGG + Intronic
1048533438 8:135271550-135271572 TGGTTTGTAAAAATGGAGTTGGG + Intergenic
1051799305 9:20913962-20913984 AAGTTTCTTAAGAATGATTTCGG + Intronic
1051999106 9:23254694-23254716 AGTTTTGTAAAGAATGAGCTGGG - Intergenic
1052080991 9:24204947-24204969 ATGTTTTCAAAGAAGAAGTTGGG + Intergenic
1052480883 9:29024210-29024232 AAGTTTCTAAATATGGGGTTTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054740651 9:68802885-68802907 AGGATTTTAAAGAAGGAGAGTGG + Intronic
1054882839 9:70163089-70163111 AGTTTTCTAAAGCAGGAAATTGG + Intronic
1055928288 9:81533028-81533050 AAGTCTCCAAAGAAGGAGTGGGG + Intergenic
1057599487 9:96445018-96445040 AGGTTTCTAAACCAGCAGGTAGG - Intergenic
1060120442 9:120984259-120984281 ATGTTTCTAGAGAAAGAATTAGG - Intronic
1187792910 X:22970227-22970249 AAGTTTCTTAAGAAAGAGGTTGG - Intergenic
1188910382 X:35840011-35840033 AGATATCTATAGAAGTAGTTGGG + Intergenic
1191766707 X:64705792-64705814 AGAGATCTAAAGGAGGAGTTTGG + Intergenic
1191790499 X:64967366-64967388 AAGTTTGTAAAGAGGGAATTTGG - Intronic
1192674331 X:73179743-73179765 AGGTGTGTATAGAAGGAGTGGGG + Intergenic
1197013481 X:121595039-121595061 AGAGTTCTAATGAAGGATTTAGG - Intergenic
1198823033 X:140669023-140669045 AGTTTTCTTAAGATGAAGTTAGG + Intergenic
1199718801 X:150527011-150527033 AGGTTTCTAAACCAGGTGCTCGG - Intergenic