ID: 1090304203

View in Genome Browser
Species Human (GRCh38)
Location 11:125676358-125676380
Sequence ATGTTAAAGAAGATCTTTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090304203_1090304206 6 Left 1090304203 11:125676358-125676380 CCTTCAAAGATCTTCTTTAACAT 0: 1
1: 0
2: 0
3: 29
4: 316
Right 1090304206 11:125676387-125676409 CTGGGAATTCTGAGTGATGCAGG 0: 1
1: 0
2: 2
3: 23
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090304203 Original CRISPR ATGTTAAAGAAGATCTTTGA AGG (reversed) Exonic
900669868 1:3844868-3844890 AAGTAAAAGAAGTTCATTGATGG + Intronic
902149123 1:14428501-14428523 ATTTTAGAAAAGATCTTTGTAGG - Intergenic
906395176 1:45456586-45456608 ATGTTAAAAAAATTCTTTTAAGG - Intronic
908143722 1:61215160-61215182 ATATTAAAAAATACCTTTGATGG + Intronic
908696947 1:66854505-66854527 AGGTTGAAGAAGATCTTGGCCGG + Intronic
909186144 1:72488743-72488765 ATGTTCAACAAGACCTTTGCTGG - Intergenic
909251276 1:73359605-73359627 ATGTGAAATAAGAGCTTAGAAGG + Intergenic
909750444 1:79153674-79153696 AGTTTAAAGATGATCTGTGAAGG + Intergenic
909871747 1:80748885-80748907 ATATTTAAGAAGATTTTTAAAGG - Intergenic
910675474 1:89812267-89812289 ATGTAAAAGAGGATTTATGATGG + Intronic
910890472 1:92013530-92013552 ATGCTAAAGAATATCTATAAGGG + Intronic
911496368 1:98636850-98636872 ATTTTAAAAAAGAACTTGGAAGG + Intergenic
911585199 1:99682469-99682491 CTGTTAATGAATATTTTTGAAGG - Intronic
911659239 1:100481511-100481533 ATGTAAAAAAAGACCTGTGAAGG + Intronic
912892972 1:113555086-113555108 ATGTTAAAGATGTTATTTGATGG - Intronic
913024789 1:114826852-114826874 ATGTAATAGAAAATCATTGAAGG - Intergenic
914415440 1:147477119-147477141 TTGTCAAGGAAGATCTGTGATGG - Intergenic
914429774 1:147610859-147610881 AAGTAAAAGAACATCTTTGAAGG - Intronic
915862946 1:159466276-159466298 ATGTGAAAGAACTTCTGTGAAGG - Intergenic
916316707 1:163456715-163456737 AAGGTAAAGAGGATCTGTGAAGG - Intergenic
916992717 1:170261948-170261970 ACGTTAAAGGAGATAATTGAAGG - Intergenic
917074255 1:171187434-171187456 ATGTTAAAAAAGATCGCTGTTGG - Intronic
917204559 1:172558781-172558803 ACGTTAAAACACATCTTTGAAGG + Intronic
917257714 1:173133515-173133537 ATGTTATATAAGATCACTGATGG - Intergenic
918880055 1:190107456-190107478 TTGTTAAGGAAGATCATTTAGGG - Intronic
919024688 1:192151924-192151946 ATGTTAAATATGATTTTTTAAGG - Intergenic
919116944 1:193292003-193292025 ATGCTAAAGAAAATATTTAATGG + Intergenic
919498197 1:198303399-198303421 AATTTAAAGAAGATTTTTAAGGG + Intronic
919867740 1:201794844-201794866 ATTTTAACGATGGTCTTTGATGG - Intronic
921397947 1:214688881-214688903 GAGTAAAAGAAGATCTTTGCTGG - Intergenic
921980732 1:221255740-221255762 ACGTGAAAGCAGAACTTTGAGGG - Intergenic
924046442 1:240036798-240036820 AAGATAAAGAAAATATTTGATGG + Intronic
924927613 1:248698310-248698332 ATGTGAAAGAATATGTCTGAAGG + Intergenic
1063271448 10:4514042-4514064 TTGTTAAAGCACTTCTTTGAAGG - Intergenic
1064865262 10:19872135-19872157 AGGTTAAAGAAGAAATTTCAGGG + Intronic
1065216783 10:23456772-23456794 ATGTTAAAGAGGATTTGGGATGG + Intergenic
1065793847 10:29287904-29287926 ATTTTGAAAAAGATGTTTGAGGG + Intergenic
1066075469 10:31871125-31871147 ATGTTTAACATGATCTTTAAAGG + Intronic
1066382926 10:34917101-34917123 TTTTTAAAGAGTATCTTTGAGGG - Intergenic
1066414779 10:35211364-35211386 ATGGCAATAAAGATCTTTGAGGG - Intronic
1066520260 10:36210031-36210053 ATGTGAAAGATGATATTTAATGG - Intergenic
1067965507 10:50908420-50908442 ATGTCGAAGAAGCTCTTTCATGG + Intergenic
1068036174 10:51762761-51762783 ATATTAAAAATGTTCTTTGAGGG - Intronic
1070124789 10:73612539-73612561 ATGATAAAGAATATACTTGATGG + Intronic
1070462739 10:76686218-76686240 TTTTAAAAGAAGATCATTGAGGG + Intergenic
1071852948 10:89593817-89593839 ATGCTACAGCAGATCCTTGAAGG + Exonic
1072330608 10:94346665-94346687 ATGTTATAAAAGATGTTTGAAGG - Intronic
1072843892 10:98806785-98806807 AAGTTAAAAAAAATCTTTAAAGG - Intronic
1073170426 10:101502428-101502450 ATATTGTAGAAGATCTTTGAGGG + Intronic
1073434650 10:103508832-103508854 ATGTGAAAGAAGCTGTTTTAGGG + Intronic
1073629176 10:105131119-105131141 AAGATAAATATGATCTTTGAAGG + Intronic
1073819036 10:107238855-107238877 ATTTTAAAGAAGGTCTTGGTGGG + Intergenic
1074940450 10:118231716-118231738 ATGTAAATGAACATCTTTTAAGG + Intergenic
1075347745 10:121696700-121696722 ATGGAAAAGCAGATCTTGGATGG - Intergenic
1075777889 10:124999815-124999837 AGGTTCAAGAAAATCTTTGGCGG + Intronic
1079487823 11:20953768-20953790 GTTTTAAAGAAGAGATTTGAAGG - Intronic
1079559035 11:21798962-21798984 ATGATAAAAATGTTCTTTGAAGG - Intergenic
1080119076 11:28655451-28655473 ATATAAATGAAAATCTTTGATGG + Intergenic
1081067447 11:38563141-38563163 ATCTTAAAAAAGATCTTTAAAGG + Intergenic
1081466724 11:43326105-43326127 ATCTTAAAAAACATCTTTAAAGG + Intronic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1086862890 11:91946052-91946074 ATTTTATGGAAGGTCTTTGAAGG + Intergenic
1087718351 11:101634599-101634621 ATTTTAAAATATATCTTTGAGGG + Intronic
1087739261 11:101869036-101869058 TCTTCAAAGAAGATCTTTGAGGG - Intronic
1089025145 11:115261172-115261194 TTTTTAAATAACATCTTTGATGG - Intronic
1090304203 11:125676358-125676380 ATGTTAAAGAAGATCTTTGAAGG - Exonic
1091013361 11:132026440-132026462 ATGTTCAAGAAGCTCTTTTTAGG + Intronic
1093078202 12:14778917-14778939 ATGATAAAGGATATCTTTAAGGG - Intergenic
1093227173 12:16499136-16499158 ATGTTAAAGAAAATACTTAAAGG - Intronic
1093527396 12:20117928-20117950 ATGTTAAGGAAGATTTATGATGG + Intergenic
1094414663 12:30203758-30203780 ATGTTAAAGAAGTGCTTTCCAGG - Intergenic
1095123920 12:38452343-38452365 ATGATAAAGAAAATCTTTAAAGG + Intergenic
1095276841 12:40295808-40295830 ATGTTCAGGAGCATCTTTGAGGG + Intronic
1095646329 12:44552402-44552424 ATTTTAAAGAAAATATGTGAAGG - Intronic
1096013619 12:48245826-48245848 ATGTTGGAAAAGATCTTTTAAGG + Intergenic
1096225286 12:49862534-49862556 ATTTTTAAAAATATCTTTGATGG - Intergenic
1097478504 12:60090396-60090418 ATGTGAAAGAACTTCATTGAAGG + Intergenic
1097540090 12:60931391-60931413 ATGTTTAAGAATATTTTTTAAGG - Intergenic
1098422490 12:70315602-70315624 AGGATAAAGAAGTTCTGTGAAGG + Intronic
1098728561 12:74001614-74001636 ATCTTAAAAAAAATCTTTAACGG + Intergenic
1098928967 12:76387462-76387484 ATTTTAAAGAAGAAATTTGTAGG + Intronic
1099459831 12:82908699-82908721 ATTTTACATAAAATCTTTGAGGG - Intronic
1103685804 12:122731063-122731085 ATGTTAGAAAAATTCTTTGACGG + Intergenic
1106484875 13:30163194-30163216 CTGTGACAGAAGATATTTGAGGG - Intergenic
1106744890 13:32691154-32691176 ATGTTAAAAAAAATTTTTAAAGG - Intronic
1106891560 13:34251592-34251614 ATGATAAAAAATACCTTTGATGG + Intergenic
1107607635 13:42076996-42077018 GTGATGAAGAAAATCTTTGAGGG - Intronic
1107643783 13:42473230-42473252 AAGTTAAACAAAATCTTTTACGG - Intergenic
1108964174 13:56275755-56275777 ATGCTAAAGAATAACTTTAAAGG + Intergenic
1109177125 13:59169925-59169947 ATTTTAAAAAAGATCTTTCCAGG + Intergenic
1110159843 13:72362291-72362313 ATATTATAGAACATCATTGAAGG - Intergenic
1110833605 13:80059588-80059610 CTGGTAAAGAAAATGTTTGAAGG - Intergenic
1111068650 13:83133056-83133078 TTGTTAAAGAAAATCTATAATGG - Intergenic
1111440565 13:88278750-88278772 ATGTAAAATAAGATATTTGAGGG + Intergenic
1111620567 13:90719706-90719728 ATGTTTAAGAAGGCCTTTGGGGG + Intergenic
1112672563 13:101657447-101657469 GTTTTAAAGAAAATGTTTGATGG - Intronic
1114367896 14:22049902-22049924 ATCTTAAAAAAAATCTTTAATGG + Intergenic
1114585260 14:23806249-23806271 ATTTTAAAAAATATGTTTGATGG + Intergenic
1115005317 14:28475613-28475635 AGGTCAAAGAAGATGTTGGAAGG + Intergenic
1115187513 14:30707132-30707154 ATGTTCAATAAGATTTTTAAGGG - Intronic
1115266434 14:31505530-31505552 ATGTTAAAGAGGATATTTTAAGG - Intronic
1115863583 14:37716995-37717017 AGGTTAAAGAAGAAGTTTCAAGG + Intronic
1115946340 14:38665566-38665588 TTTTTAAAGAAGGTCTGTGAAGG - Intergenic
1116371901 14:44145722-44145744 ATGTTAAAGAAGATAAATGATGG + Intergenic
1117196016 14:53340910-53340932 ATATTAAAGAAAATGTCTGAAGG + Intergenic
1117386572 14:55220073-55220095 ATCTTAAAAAAAATCTTTAATGG + Intergenic
1117855708 14:60030234-60030256 ATGTTAAAGTAGGTCAATGAGGG - Intronic
1117997883 14:61495080-61495102 GTATTAAAGCAGATGTTTGATGG + Intronic
1118226818 14:63908702-63908724 GTTTTAAAGAAAATCCTTGAAGG + Intronic
1118973837 14:70660567-70660589 ATGTTAAATAGGAACTTTGGGGG - Intronic
1118995759 14:70834183-70834205 ATGTTTCAGAAGAAATTTGAAGG - Intergenic
1119359780 14:74039252-74039274 ATGTTATAGAAAATATTTAATGG - Intronic
1119707386 14:76791765-76791787 ATGTAATAGAAAGTCTTTGAAGG - Intronic
1119964441 14:78898321-78898343 ATTTTAAACAAGGACTTTGAAGG + Intronic
1120591497 14:86379259-86379281 TTGTTATAGAAGAATTTTGAGGG - Intergenic
1121032642 14:90672277-90672299 ATGTAAAAGAAGATCTAGCAAGG + Intronic
1121666009 14:95672938-95672960 GTATTAAGGCAGATCTTTGATGG + Intergenic
1121912901 14:97808243-97808265 AGGTTAATGAAAATCTATGAAGG + Intergenic
1123955496 15:25330300-25330322 ATGTGAAAAATGATCTTGGATGG - Intergenic
1124183942 15:27504720-27504742 ATGTTAGAGGAAATCTTTGTTGG - Intronic
1126230442 15:46317119-46317141 CTGTGAAAGAAGAGCTTTTAAGG - Intergenic
1127205892 15:56718352-56718374 ATTTTAATAAAGATGTTTGAGGG + Intronic
1127343747 15:58072457-58072479 ATGTCAAAGAAGTTCTTTGTTGG - Intronic
1127374986 15:58376200-58376222 ATGTTGATGAAGATGTTTAAGGG + Intronic
1128035622 15:64523129-64523151 ATGTTAAGGAAGATCTCTTTTGG - Intronic
1128510275 15:68309947-68309969 ATCTTAAAAAAAATCTTTAAAGG - Intronic
1128894297 15:71358226-71358248 ATGTTAAGGAACAGCTTGGAAGG - Intronic
1130035352 15:80355657-80355679 TTTTTAAAGAACATTTTTGATGG - Intronic
1133296588 16:4756095-4756117 ATGATAAAGAATGTTTTTGAGGG + Intronic
1134995441 16:18735027-18735049 TTGTTAAACAAGATGCTTGAAGG + Intergenic
1135618167 16:23929954-23929976 ATGTTACAGAAGATTTTTTCGGG - Intronic
1136219074 16:28816273-28816295 ATTTTAAAAAAGATCTTAGCTGG - Intergenic
1140630787 16:76849546-76849568 AAGTTAATGAAAATCTCTGAAGG + Intergenic
1141216776 16:82032619-82032641 ATGTTTAAGCAGATATCTGAAGG + Intergenic
1143525355 17:7468748-7468770 ATGGGAAAGAAGATTTTTCAGGG - Intronic
1143833925 17:9674882-9674904 AAGTCAAGGAAGATCTGTGAGGG - Exonic
1144258316 17:13491872-13491894 ATGTTGATGAAGATATTTCAAGG + Intergenic
1148113221 17:45159247-45159269 CTTTTAAAGACGATCTTTGTGGG - Intergenic
1150502338 17:65663350-65663372 ATGGCAAAGTAGATGTTTGATGG + Intronic
1150932386 17:69599275-69599297 AAGATTAAGAAGATCTTGGAAGG - Intergenic
1150974448 17:70068071-70068093 ATATTAAACATAATCTTTGAGGG + Intronic
1153720596 18:7897607-7897629 ATCAAAAATAAGATCTTTGAGGG - Intronic
1154256953 18:12790218-12790240 ATGTTTAAAGAGATCTTTGCTGG - Intronic
1155300167 18:24421873-24421895 AAGATAAAGAAAATATTTGATGG + Intergenic
1155747457 18:29376704-29376726 ATTTTGAAGAAGGTCTTTGGTGG + Intergenic
1156753633 18:40493305-40493327 ATGTTACAGTAGATCCTTAAGGG - Intergenic
1158819014 18:61136600-61136622 ATGTTTAAAAAGTTTTTTGATGG - Intergenic
1159083211 18:63758923-63758945 ATGTTTAAGAAGAAATTTAAAGG + Intronic
1159401562 18:67943214-67943236 CTGTAACAGAAGATCTGTGAAGG - Intergenic
1164296988 19:23920279-23920301 ACGTTAAGGAAGATCATTGAAGG - Intronic
1164409584 19:27989645-27989667 ATTTTAAGGAAGATAATTGATGG - Intergenic
926570714 2:14527042-14527064 GTGTGAAAGAAGATATTAGAGGG + Intergenic
927392213 2:22608333-22608355 AGGTTAAAGAAAATGTTTTAAGG + Intergenic
927732877 2:25490451-25490473 ATGTTTTCTAAGATCTTTGATGG - Intronic
927947453 2:27145156-27145178 AAGTTAAAGAAGATATTGCAAGG - Intergenic
928480696 2:31680386-31680408 ATGGTAGATAAGATTTTTGATGG + Intergenic
929018802 2:37529510-37529532 ATCTTAAAGAAAATCCTTGAAGG + Intergenic
929261329 2:39869916-39869938 ATTTTAAACATGATCTCTGATGG + Intergenic
929844881 2:45513655-45513677 GAGTTAGAGCAGATCTTTGAGGG + Intronic
930336466 2:50053652-50053674 ATGATAAAACAGATCTTTTATGG + Intronic
930829227 2:55725463-55725485 CTGTTACAGAATTTCTTTGAGGG - Intergenic
932534423 2:72577737-72577759 ATGTTAGAAAAGATCTCTGAAGG - Intronic
932911351 2:75809502-75809524 ATGGGAAAAAAGATCTATGAAGG - Intergenic
933359281 2:81258292-81258314 ATGTGAAAGAGGACATTTGAAGG - Intergenic
933528191 2:83470995-83471017 ATGCTAAAAAAAATCTTAGAAGG + Intergenic
933697222 2:85228691-85228713 ATGATAAAGAAGGACTTTGAGGG - Intronic
934525654 2:95049997-95050019 ATGTTAAATAAGATTGTTCAGGG - Intronic
935567004 2:104619796-104619818 ATGATAAAGGAGATATTTGGTGG + Intergenic
939420249 2:141957822-141957844 ATGTGAAAGATGATCTGTGCTGG - Intronic
940792126 2:158040054-158040076 AAGTTAAAAATGATCTTTGTGGG + Intronic
941443576 2:165570261-165570283 ATGTTGAAAAAGATATTTAAAGG - Intronic
941475339 2:165944914-165944936 ATGTGAAAGAATTTTTTTGAAGG - Intronic
942128728 2:172855675-172855697 ATGTTGAAGAATATTTTTGTTGG + Intronic
942842949 2:180385833-180385855 ATGTGTCAGAAGATCTTTTAGGG - Intergenic
942847085 2:180439979-180440001 ATGTTAAAGATGGTCCTTGGAGG - Intergenic
943012842 2:182472864-182472886 ATGTTAAAGAAGTTCTTCTCCGG - Intronic
943056784 2:182991717-182991739 AAGTTGAAGAAAATCTTTGAAGG + Intronic
943058508 2:183013175-183013197 AAGTTGAAGAAGATTATTGAGGG - Intronic
943569982 2:189562842-189562864 TTGCTAGAGAAGACCTTTGAAGG + Intronic
944037585 2:195314414-195314436 ATATTCAAGAAGTTCTATGAAGG + Intergenic
945223565 2:207508780-207508802 ATATTAAAGAACATCTTAGTAGG - Intergenic
1170173672 20:13442988-13443010 ATATTAAAAGACATCTTTGAAGG + Intronic
1175017903 20:55811409-55811431 ATGTTAAAGCAGAGATTTGAAGG - Intergenic
1175384995 20:58589140-58589162 ATTTTAAAAAACATTTTTGATGG + Intergenic
1179285155 21:39971179-39971201 ATGATAAAGAAGATAATTCAAGG + Intergenic
949174707 3:1045969-1045991 GTGTTAAGGAAGGTCTTTCAGGG - Intergenic
949188777 3:1225911-1225933 ATGTTAAAGATGAGATGTGATGG - Intronic
949377051 3:3401733-3401755 ATGCTAAAGAAAATTATTGAAGG + Intergenic
950889471 3:16390376-16390398 TTATTAAAGCAGATCTCTGAAGG - Intronic
951342344 3:21503746-21503768 ATGATAAAGAAGATATCTGATGG - Intronic
951473066 3:23077187-23077209 ATGTTAGAGAAGATTTGAGATGG + Intergenic
952561635 3:34601796-34601818 ATGTAAAAGAAAATCAATGAAGG + Intergenic
953091677 3:39733243-39733265 ATTTTAAAAAATATTTTTGAAGG + Intergenic
953760134 3:45680179-45680201 ATGTGAAAGTAGAGCTGTGATGG + Exonic
954191595 3:48966186-48966208 ATGCTAAAATAGATCTTGGAAGG + Intronic
954543889 3:51416330-51416352 ATGTTTAAGCAGAGCCTTGAAGG - Intronic
955156955 3:56426334-56426356 ACCTTAAAGGAGATCTGTGAAGG - Intronic
956983373 3:74667373-74667395 ATTTTAAATAATATCTGTGAAGG - Intergenic
957691346 3:83574686-83574708 TTTTTAAATAAGATCTCTGAAGG - Intergenic
957933566 3:86913528-86913550 ATGTCAAGCAACATCTTTGATGG - Intergenic
958852752 3:99348707-99348729 ATGTTAAAAAATATTTTGGAAGG - Intergenic
960274227 3:115708799-115708821 CTGGTAAAGAAGATCTGAGAGGG + Intronic
960437065 3:117639743-117639765 ATGTTAAAAATTATCTCTGATGG + Intergenic
960717680 3:120593901-120593923 AGGTTAAAGAAGATTTCTTAAGG - Intergenic
961870690 3:129985551-129985573 AGGTTAAAGATGATCTCTGAGGG + Intergenic
962060404 3:131920940-131920962 AAGCTAAAGAAGATGTCTGATGG + Intronic
964205185 3:154166522-154166544 TTGTTGAACAACATCTTTGAGGG + Intronic
965784177 3:172318812-172318834 ATGTGAAAGATGGTCTCTGATGG - Intronic
965930268 3:174033659-174033681 AAGTTGAAGAATATCTTTGATGG + Intronic
968032789 3:195516569-195516591 AAGTTAAACAATATCTTTGGGGG - Exonic
968931782 4:3583937-3583959 AAGTTAAAAAAGATCTTTATTGG + Intronic
970253941 4:14147181-14147203 GTGTTCAAGATGATCTTAGAAGG + Intergenic
970356272 4:15256321-15256343 ATCTTAAAGGAGAGATTTGAGGG - Intergenic
972754436 4:42030622-42030644 ATGTTAAAGATGCTCATTGATGG - Intronic
972757464 4:42063315-42063337 ATGTTGAACAAGATCTCTGTAGG + Intronic
973096141 4:46202636-46202658 ATGTTAAAAAAGAGGTTTAATGG + Intergenic
974153085 4:58035470-58035492 ATTTTAAAAAAGATGTTTGTGGG + Intergenic
976362049 4:84191603-84191625 ATTTTAATGTAGACCTTTGAAGG - Intergenic
976421564 4:84850657-84850679 AAGTTATAAAGGATCTTTGATGG + Intronic
976864177 4:89704332-89704354 ATGTTAATCAAGGTCTTTCAGGG - Intergenic
977352694 4:95908311-95908333 AGCTTAAAGAATATCTTTGGAGG + Intergenic
979962018 4:127032561-127032583 TCTTTAAAGAAGATCTTTGGAGG + Intergenic
979988725 4:127348372-127348394 ATGTTTAAGAAGTTCTTATAAGG - Intergenic
980631386 4:135439593-135439615 ATGTTGAAGAACAGCTTTGCTGG - Intergenic
981042576 4:140237044-140237066 ATGTGATAGAAGATCCTTGCTGG + Intergenic
981757839 4:148160793-148160815 CTGTTAAAGAAGATAGTTGGTGG - Intronic
981855214 4:149281313-149281335 TTGTAAAAGAAGATTTCTGAGGG + Intergenic
982875470 4:160643020-160643042 AAATAAAAGAAGTTCTTTGAAGG + Intergenic
987502548 5:18732289-18732311 AGATAATAGAAGATCTTTGATGG + Intergenic
988349317 5:30081068-30081090 CTGTTAGAGAAGAGCTTTGAAGG - Intergenic
988668664 5:33358011-33358033 CTGTTAAAAAATATTTTTGAGGG + Intergenic
989304014 5:39930538-39930560 ATTTTTAAGGAGATCCTTGAAGG - Intergenic
989770045 5:45133763-45133785 ATTTTAACAAAGATCTTTGAAGG + Intergenic
992018917 5:72603378-72603400 ATGCTAGAGCAGAGCTTTGAAGG + Intergenic
992034686 5:72760959-72760981 ATGTTAATGAACATCTTTTGGGG - Intergenic
992589352 5:78277639-78277661 ATCCAAAAGAAGATCTATGAAGG + Intronic
993414445 5:87609225-87609247 ATGCTAAAGAAGAGCATTTAGGG - Intergenic
993535279 5:89076613-89076635 ATATTAAAGTAACTCTTTGAAGG + Intergenic
994877424 5:105442798-105442820 ATGTTAAAGAAAAACTTCAATGG - Intergenic
995074433 5:107965639-107965661 ATGTTTAAAAACATATTTGAGGG - Intronic
995251390 5:109997059-109997081 GAGTAAAGGAAGATCTTTGAAGG + Intergenic
996265675 5:121536389-121536411 ATGTTAAAGAAAAAATTTAAAGG + Intergenic
996580085 5:125022107-125022129 ATTTTACAGAAGATATTAGAAGG - Intergenic
997222579 5:132181466-132181488 ATGGTATAGAAGGTCCTTGAAGG - Intergenic
1000670204 5:164052268-164052290 ATGTTAAAAAGTATCTTTGTGGG - Intergenic
1001039561 5:168324133-168324155 ATGTTAAAGGAAATTTTTCAGGG + Intronic
1004210890 6:13642249-13642271 ATTTTACAGAAGTTTTTTGAAGG - Intronic
1004987930 6:21103764-21103786 ATGTTAAACAAGTTGTGTGATGG - Intronic
1005073551 6:21885365-21885387 ATGTTATATGAGATCTTTGGAGG - Intergenic
1005379752 6:25221560-25221582 ATGTTATATGAGATATTTGAGGG + Intergenic
1005754502 6:28913986-28914008 CTGTGAAAGAAGAGCTCTGAGGG - Intronic
1006069115 6:31484876-31484898 ATGTCAAAGAAGATTTTAAAGGG - Intergenic
1006261658 6:32878894-32878916 AGGTTAAACAATATCTTTGGGGG - Intergenic
1008464034 6:51810393-51810415 ATTTAAAACAAGATTTTTGAAGG - Intronic
1008744862 6:54657505-54657527 ATGTTTAAGGAGGTCCTTGAAGG + Intergenic
1008952563 6:57176505-57176527 ATGGTAATGAAGATGTTTGGGGG + Intronic
1010253005 6:73727760-73727782 ATGTTTAAAAATATATTTGATGG - Intronic
1010283930 6:74052945-74052967 ATGTTGAATATGATCTTTCAGGG - Intergenic
1011767227 6:90635437-90635459 AAGTTAAGGAATATGTTTGAAGG + Intergenic
1012325468 6:97910782-97910804 ATGGTAAAGAAAAGCATTGAGGG + Intergenic
1012786846 6:103641243-103641265 ATATTAAAGTAAAGCTTTGATGG + Intergenic
1013030670 6:106329461-106329483 ATGGTAAACAAGGTCTTTTATGG + Intergenic
1014045449 6:116879576-116879598 ATTTTAAATCAAATCTTTGAAGG + Intronic
1014497378 6:122142638-122142660 ACTATTAAGAAGATCTTTGAAGG + Intergenic
1015688279 6:135890980-135891002 ATGTTAAACAAGAGCTTTTTTGG - Intronic
1016508149 6:144808424-144808446 ATTTTAAAGAAGATCTGAGTAGG - Intronic
1016734789 6:147466131-147466153 GAGATAAAGAGGATCTTTGAGGG + Intergenic
1018274788 6:162119095-162119117 TTGTTAAAGGAAATCTTTGAAGG - Intronic
1019266879 7:122071-122093 AAGTTAAAGAAGAGGTTTCACGG - Intergenic
1020393837 7:7690442-7690464 ATGTGAAAGAAGAGTTTTAAAGG + Intronic
1020587604 7:10088889-10088911 ATCTTAAAATAGGTCTTTGAAGG - Intergenic
1021411952 7:20338891-20338913 ATTTTAAAAAATATCTTAGAAGG + Intronic
1021462593 7:20905443-20905465 ATAATAAAAAAGATCTTTGAGGG + Intergenic
1022621451 7:31988477-31988499 ATGTTAAAGATGATTCTTGAAGG - Intronic
1023533614 7:41184365-41184387 AAGTTACAGAAAATTTTTGATGG - Intergenic
1023675508 7:42625327-42625349 TTTTTAAGGAAGTTCTTTGATGG - Intergenic
1024424338 7:49208247-49208269 ATATCAAAGAAGTTCTTTAAGGG - Intergenic
1024635230 7:51283017-51283039 ATGATAAAGAAGTGCTTAGAAGG + Intronic
1025011322 7:55401758-55401780 TTGTTAAACAAGATGCTTGAAGG - Intronic
1026372053 7:69709923-69709945 ATTTTTAAGAAAATTTTTGAAGG - Intronic
1027642827 7:80758074-80758096 GTGTTACAGAGGAGCTTTGAAGG + Intronic
1027820086 7:83031830-83031852 ATGTTAGTGATTATCTTTGAGGG - Intronic
1027998941 7:85466542-85466564 ATTTTGAAGAAGCTCTCTGAGGG + Intergenic
1030054565 7:105571827-105571849 ATCTTAAAAAAAATCTTTAAAGG + Intronic
1030912509 7:115269297-115269319 ATGTTAAAGCATATCTAAGAAGG - Intergenic
1031371830 7:120977550-120977572 AAGTTAAAGAATATTTTTAAGGG - Intergenic
1031895514 7:127343954-127343976 ATGTTAAAGATGTGGTTTGATGG - Intergenic
1032373064 7:131379564-131379586 ATTTTAAAAAATATTTTTGAAGG + Intronic
1032677063 7:134140923-134140945 ATTTTAAAGCAAATCTTAGATGG + Intronic
1033724556 7:144100532-144100554 ATGTTAATGAAGAAATTTGGGGG + Intergenic
1033850628 7:145490116-145490138 AGGTGAAACAAGATCTTTGCAGG + Intergenic
1033870161 7:145744331-145744353 ATGTTAAGGAAGATCTTAGGCGG - Intergenic
1034364978 7:150538469-150538491 TTGGTAAAGAACATCTTTGCTGG - Intergenic
1034613200 7:152391169-152391191 ATGTTAAAGAGGAGATTTTAAGG - Intronic
1037068813 8:14618241-14618263 ATGTTATACAAGGTCTTTGGAGG + Intronic
1037116406 8:15234594-15234616 ATGTTAAAGGATTTATTTGATGG - Intronic
1038095861 8:24309094-24309116 ATTTTAAAGAAGATGTTTTGGGG - Intronic
1038142139 8:24857498-24857520 ATGTTAAAGAATATTGTTAATGG + Intergenic
1038279187 8:26148195-26148217 ATGTTGAAGAGGTCCTTTGAAGG - Intergenic
1038631634 8:29250574-29250596 ATATTAAAGGCCATCTTTGATGG - Intronic
1038836668 8:31132529-31132551 AAGTAAAAGAAGATCTATGAAGG - Intronic
1039668741 8:39570044-39570066 AGGTTAAAGATGACCTCTGAGGG - Intergenic
1040977364 8:53208695-53208717 AAATGAAAGAACATCTTTGATGG + Intergenic
1041752894 8:61280592-61280614 ATGTTAATGCAGATATTTAATGG - Intronic
1041948689 8:63475835-63475857 CTGTTAAAGAAAATATTTGTGGG + Intergenic
1042031333 8:64479121-64479143 ATGGGAAAGAAGACCTTTAAAGG - Intergenic
1042990833 8:74637825-74637847 ATGGTAAAGTAGAGCATTGAAGG - Intronic
1043972347 8:86545607-86545629 ATGTTAAACAAATTCTTTGATGG - Intronic
1045233617 8:100329959-100329981 ATGTTCAAGTAGAGCTTAGATGG + Intronic
1046803825 8:118458177-118458199 ATGTGAAAGAGGATTTTAGATGG - Intronic
1048089124 8:131219469-131219491 ATGTAAAAGAACCTGTTTGATGG + Intergenic
1048414715 8:134213471-134213493 ATGTAAAAAATTATCTTTGATGG - Intergenic
1050058189 9:1677711-1677733 ATGTTGAAAAAGAGCTGTGAGGG - Intergenic
1050406975 9:5319902-5319924 AAGTTTAAGAACATCTTTAAAGG - Intergenic
1051128162 9:13828992-13829014 AAGTAAAACAAGATTTTTGAGGG - Intergenic
1051316383 9:15837786-15837808 ATGTTAAAAAATAACTTTCATGG + Intronic
1052096038 9:24385475-24385497 ATGTTCAAGCAGATAATTGATGG + Intergenic
1052407021 9:28073875-28073897 GTTTTAAAGAACATTTTTGATGG + Intronic
1052772881 9:32705650-32705672 AAGTAAAAAAAGATCTATGAAGG - Intergenic
1054458342 9:65447994-65448016 AAGTTAAAAAAGATCTTTATTGG - Intergenic
1054975638 9:71141259-71141281 ATATTAATAAAGATCTCTGAAGG - Intronic
1055277713 9:74638245-74638267 ATGTTAATAGAAATCTTTGAAGG + Intronic
1056058043 9:82849573-82849595 ATTTTAAAAATGATTTTTGAAGG + Intergenic
1057166640 9:92932552-92932574 ATGATCAAGAAGACCTTTCATGG - Intergenic
1057327699 9:94080875-94080897 ATTTTCAAGAATATCTTTGTGGG + Intronic
1059220859 9:112617354-112617376 ATGACAAAGCAGATCTTTTATGG - Intronic
1059640832 9:116215108-116215130 ATGACAGAGAAGATGTTTGAAGG + Intronic
1060429921 9:123542239-123542261 ATGTCAAGGAAGCTCTATGAAGG + Intronic
1203774806 EBV:66912-66934 ATTTTAAACATGCTCTTTGATGG + Intergenic
1185705140 X:2261255-2261277 ATATTAAAGAAAGGCTTTGACGG - Intronic
1185750130 X:2604307-2604329 ATGCTAAAGAAGAACCATGAGGG - Intergenic
1186304911 X:8246000-8246022 ATTTTAAATACAATCTTTGAAGG + Intergenic
1186347634 X:8710531-8710553 AACTCAGAGAAGATCTTTGAGGG + Intronic
1186693136 X:12001019-12001041 ATGTTAAAGTACTTCATTGAAGG + Intergenic
1187916485 X:24157398-24157420 AAGTCAAAATAGATCTTTGATGG + Intronic
1188821653 X:34782904-34782926 ATATTAAAGCAGAGATTTGAAGG + Intergenic
1192349072 X:70340693-70340715 TTTTTATAGAAGATCTTAGAAGG - Intronic
1192691373 X:73368261-73368283 ATGTTGAATAAGAGTTTTGAGGG + Intergenic
1193976650 X:88128417-88128439 ATGTTAAAAGAGATTTGTGAAGG + Intergenic
1194472540 X:94314957-94314979 ATGTTAAAAAGTATTTTTGAGGG - Intergenic
1195318728 X:103703802-103703824 ATGTAGAATAAGCTCTTTGACGG - Intergenic
1196849806 X:119926734-119926756 ATGGTAAAGTAGAACCTTGAAGG - Intronic
1197980252 X:132210770-132210792 ATTTTAAAGATGATTTTTCAAGG - Intronic
1200096755 X:153668225-153668247 ATGATAAAAATGATCTTTGTGGG - Intergenic
1200888314 Y:8295519-8295541 ATGTTGAACAAAATCTTTTATGG + Intergenic
1201562323 Y:15331368-15331390 AGCATAAAGAAGATATTTGAAGG + Intergenic