ID: 1090305848

View in Genome Browser
Species Human (GRCh38)
Location 11:125690321-125690343
Sequence TCTGATTTTTAGTAGATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090305848_1090305849 -2 Left 1090305848 11:125690321-125690343 CCTTACATCTACTAAAAATCAGA No data
Right 1090305849 11:125690342-125690364 GAGCACAAAGAAACTTATCTAGG No data
1090305848_1090305850 13 Left 1090305848 11:125690321-125690343 CCTTACATCTACTAAAAATCAGA No data
Right 1090305850 11:125690357-125690379 TATCTAGGAAAAACTTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090305848 Original CRISPR TCTGATTTTTAGTAGATGTA AGG (reversed) Intergenic
No off target data available for this crispr