ID: 1090306264

View in Genome Browser
Species Human (GRCh38)
Location 11:125693720-125693742
Sequence CTGTCTCAGCCCAGGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090306264_1090306271 23 Left 1090306264 11:125693720-125693742 CCTGTGGCCCTGGGCTGAGACAG No data
Right 1090306271 11:125693766-125693788 GTGCAAGGAAAAGTTGAGATGGG No data
1090306264_1090306270 22 Left 1090306264 11:125693720-125693742 CCTGTGGCCCTGGGCTGAGACAG No data
Right 1090306270 11:125693765-125693787 AGTGCAAGGAAAAGTTGAGATGG No data
1090306264_1090306269 8 Left 1090306264 11:125693720-125693742 CCTGTGGCCCTGGGCTGAGACAG No data
Right 1090306269 11:125693751-125693773 CAGGGTAGAACAAGAGTGCAAGG No data
1090306264_1090306268 -10 Left 1090306264 11:125693720-125693742 CCTGTGGCCCTGGGCTGAGACAG No data
Right 1090306268 11:125693733-125693755 GCTGAGACAGTGACTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090306264 Original CRISPR CTGTCTCAGCCCAGGGCCAC AGG (reversed) Intergenic
No off target data available for this crispr