ID: 1090307118

View in Genome Browser
Species Human (GRCh38)
Location 11:125701045-125701067
Sequence AAAAAACCACAGATGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090307115_1090307118 -8 Left 1090307115 11:125701030-125701052 CCTGGTCTCACCAGAAAAAAACC No data
Right 1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG No data
1090307113_1090307118 18 Left 1090307113 11:125701004-125701026 CCTCAATTTATCTGGGTCTACTT No data
Right 1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG No data
1090307112_1090307118 22 Left 1090307112 11:125701000-125701022 CCAGCCTCAATTTATCTGGGTCT No data
Right 1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090307118 Original CRISPR AAAAAACCACAGATGGATCA TGG Intergenic
No off target data available for this crispr