ID: 1090314589

View in Genome Browser
Species Human (GRCh38)
Location 11:125774018-125774040
Sequence CTGTAGTGCGAAAGGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090314589_1090314594 22 Left 1090314589 11:125774018-125774040 CCACATGGCCTTTCGCACTACAG No data
Right 1090314594 11:125774063-125774085 ACAAATGTGTAGACTAGCAATGG No data
1090314589_1090314592 -10 Left 1090314589 11:125774018-125774040 CCACATGGCCTTTCGCACTACAG No data
Right 1090314592 11:125774031-125774053 CGCACTACAGCAGGCACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090314589 Original CRISPR CTGTAGTGCGAAAGGCCATG TGG (reversed) Intergenic
No off target data available for this crispr