ID: 1090319883

View in Genome Browser
Species Human (GRCh38)
Location 11:125833065-125833087
Sequence CAGGGAAGGCAGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090319871_1090319883 22 Left 1090319871 11:125833020-125833042 CCCTGTCTCTTAAAAAAAAAAAG 0: 55
1: 1103
2: 4356
3: 27675
4: 50368
Right 1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG No data
1090319872_1090319883 21 Left 1090319872 11:125833021-125833043 CCTGTCTCTTAAAAAAAAAAAGT 0: 21
1: 181
2: 1818
3: 7383
4: 36438
Right 1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090319883 Original CRISPR CAGGGAAGGCAGAGGGAGGA TGG Intergenic
No off target data available for this crispr