ID: 1090323890

View in Genome Browser
Species Human (GRCh38)
Location 11:125868332-125868354
Sequence ACCTAGGAGAAACTCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090323890_1090323894 29 Left 1090323890 11:125868332-125868354 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1090323894 11:125868384-125868406 AAATCTAAACTCTTTAGATTTGG No data
1090323890_1090323893 -3 Left 1090323890 11:125868332-125868354 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1090323893 11:125868352-125868374 GGTCTGGTCAGACTTTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090323890 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr