ID: 1090323892

View in Genome Browser
Species Human (GRCh38)
Location 11:125868348-125868370
Sequence ACAAAAGTCTGACCAGACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090323892_1090323894 13 Left 1090323892 11:125868348-125868370 CCTAGGTCTGGTCAGACTTTTGT No data
Right 1090323894 11:125868384-125868406 AAATCTAAACTCTTTAGATTTGG No data
1090323892_1090323895 26 Left 1090323892 11:125868348-125868370 CCTAGGTCTGGTCAGACTTTTGT No data
Right 1090323895 11:125868397-125868419 TTAGATTTGGATCCCCTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090323892 Original CRISPR ACAAAAGTCTGACCAGACCT AGG (reversed) Intergenic
No off target data available for this crispr