ID: 1090323893

View in Genome Browser
Species Human (GRCh38)
Location 11:125868352-125868374
Sequence GGTCTGGTCAGACTTTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090323885_1090323893 23 Left 1090323885 11:125868306-125868328 CCATCTATAAACAAGTGTCATCC No data
Right 1090323893 11:125868352-125868374 GGTCTGGTCAGACTTTTGTATGG No data
1090323888_1090323893 2 Left 1090323888 11:125868327-125868349 CCTGTCCTGAAGGGAGTTTCTCC No data
Right 1090323893 11:125868352-125868374 GGTCTGGTCAGACTTTTGTATGG No data
1090323890_1090323893 -3 Left 1090323890 11:125868332-125868354 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1090323893 11:125868352-125868374 GGTCTGGTCAGACTTTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090323893 Original CRISPR GGTCTGGTCAGACTTTTGTA TGG Intergenic
No off target data available for this crispr