ID: 1090323894

View in Genome Browser
Species Human (GRCh38)
Location 11:125868384-125868406
Sequence AAATCTAAACTCTTTAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090323890_1090323894 29 Left 1090323890 11:125868332-125868354 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1090323894 11:125868384-125868406 AAATCTAAACTCTTTAGATTTGG No data
1090323892_1090323894 13 Left 1090323892 11:125868348-125868370 CCTAGGTCTGGTCAGACTTTTGT No data
Right 1090323894 11:125868384-125868406 AAATCTAAACTCTTTAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090323894 Original CRISPR AAATCTAAACTCTTTAGATT TGG Intergenic
No off target data available for this crispr